Introduction History Paths of seed infection Effects of seed infection Advance methods for detection of seed borne diseases Case studies

1. WELCOME
SIDDARUDH K SSIDDARUDH K S
Ph.D ScholarPh.D Scholar
UAS GKVK BangaluruUAS GKVK Bangaluru
SIDDARUDH K SSIDDARUDH K S
Ph.D ScholarPh.D Scholar
UAS GKVK BangaluruUAS GKVK Bangaluru
SIDDARUDH K SSIDDARUDH K S
Ph.D ScholarPh.D Scholar
UAS GKVK BangaluruUAS GKVK Bangaluru
SIDDARUDH K. S.SIDDARUDH K. S.
Ph.D Scholar.Ph.D Scholar.
UAS GKVK, Bengaluru.UAS GKVK, Bengaluru.

2. Sequence of Presentation
Conclusion

3. Any pathogen present in a seed sample that causes
either failure of germination of seed or rotting of
emerged seedling or produces other kind of disease
symptoms on adult plants may, in a broad sense, be
called as a seed borne pathogen.
•The diseases and deterioration are caused by pathogens
•Testing seed before sowing will identify potential disease
problems and allow steps to be taken to reduce the
disease risk.
Definitio
n
INTRODUCTION
08/25/17 3

4. YEAR EVENT
1775 Tillet, a French botanist, showed that stinking smut or hill bunt
of wheat was caused by poisonous substance on seed surface
i.e parasitic fungus.
1892 Beach, in New York , proved the seedborne nature of a
bacterial pathogen X. axonopodis pv. Phaseoli in common
bean.
1883 Frank, described the internally seedborne nature of a fungus in
bean seed.
1942 Mayer, proved virus transmission through seed.
1940 Noble, coined the term “seed pathology”
2007 H S Shetty , an outstanding Indian seed pathologist honoured
with “Seed Health Award” for immense contribution in the
area of seed health and seed quality control for developing
countries.
Brief history

5. Paul Neergaard (1907-
1987)
Father of seed pathology
Neergaard served as Director of the Danish
Government Institute of Seed Pathology for
Developing Countries in Copenhagen.
From 1956 to 1974 he served as the Chairman of
the Plant Disease Committee of the
International Seed Testing Association (ISTA).
During his tenure as Chair of ISTA, he helped
standardize methods for the detection of seed
borne fungi.
Neergaard authored a two-volume text book
entitled "Seed Pathology“ .

6. INFECTED PART OF THE SEEDINFECTED PART OF THE SEEDINFECTED PART OF THE SEEDINFECTED PART OF THE SEED
 Surface contamination
Eg: many smut fungi such as grain smut, smut of barley etc.
 Seed coat infection
Eg: many of seed borne bacteria
 Endosperm infection
Eg: fusarium moniliforme (seedling blight) is present in the
endosperm of sorghum.
 Embryo infection
Eg: loose smut fungi of barley & wheat. 6
INFECTION OF SEEDSINFECTION OF SEEDS
• Seed produced under warm, humid conditions
• Drier regions is often free of infection
• Virus infection often by aphid vectors, and the
genetic susceptibility of the host plant
08/25/17

7. Seeds are attacked by various stages,
• The mother plant get infected by the
pathogen, it attack seed also
• During processing
• At the time of transportation
• During storage
Seeds are attacked by various fungi,bacteria
and virus.
08/25/17 7

8. Complex cells with hard (chitin) cell walls, spread by spores and
tend to colonize OUTSIDE of plants
 Easier to set back in field – often on plant surfaces
 Variable entry into seed
 Variable success in treating on seed (some more sensitive to heat than
others)
 Can live in soil, but usu.insignificantly seed-borne if soil-borne
FUNGI
Botrytis
cinerea on
lettuce seed
Photo High Mowing SeedsFrom Muirbiology

9. BACTERIA
Simple cells with ‘soft’ cell walls, mostly have to stay moist at all
times – so live INSIDE of plants
Hard to stop in the field – get into plant veins and tend to travel throughout
whole plants (systemic)
Likely to get INTO seed because systemic
Easier to treat inside seed than fungi, as more sensitive to heat
Xanthomonas
campestris
From Muirbiology Institute of Cell and Molecular Biology, The University of Edinburgh

10. Packaged DNA or RNA – no cells –hard to
‘kill’ (very different from other two)
Impossible to stop in field
Impossible to treat in seed
Often less devastating as diseases go
Easier to detect before planting – strip tests
VIRUSES
From Muirbiology From Cornell Cooperative
Extension

11. Effects of seed infection ??
 Germination percentage get reduced.
 Due to changes is morphology, the market
level get reduced.
 Due to infection it induces the changes in the
content get reduced.
 Due to infection it induced the secretion of
toxic chemicals ex: Aflatoxn, Rubra toxin,
ochre toxin, chitrinin, patulin etc.08/25/17 11
False head smut
Ustilaginoidea virens

12. 08/25/17 12

13. 08/25/17 13

14. Crop Disease pathogen
Paddy Bacterial blight X. oryzae pv. oryzae
Soybean Bacterial pustules Xanthomonas axonopodis pv glycines
Bacterial blight P. syringae pv. glycinea
Bean Halo bliight P. syringae pv. phaseolicola
Bean wilt Curtobacterium flaccumfaciens pv.
flaccumfaciens
Cowpea Bacterial blight Xanthomonas campestris pv vignicola
Pea Bacterial bligh P. syringae pv. pisi
Wheat Black chaff Xanthomonas campestris pv translucens
Maize Bacterial blight Pantoea stewartii
Sesame Bacterial leaf spot p. Sesami and x.sesami
Carrot Bacterial blight Xanthomonas campestris pv carrotae
cotton Angular leaf spot Xanthomonas campestris pv malvacearum
cucurbits Leaf spot P. syringae pv lachrymans
IMPORTANT SEED BORNE BACTERIAL DISEASES

15. Crop Name of the virus
Soybean Soybean mosaic virus
Barley Barley stripe virus
Bean Bean common mosaic virus
Cereals Barley yellow dwarf virus
Cowpea Cowpea banding mosaic virus
Pea Pea enation mosaic virus
Tomato Tobacco mosaic virus
Cucumber Cucumber mosaic virus
Lucerne Alfaalfa mosaic virus
IMPORTANT VIRAL DISEASE

16. 1 Systemic infection through vascular system
Direct systemic infection
Ex: Vascular wilt
fungi, endophytes (A
organism which lives
inside the plant)
Mude
1996
Routes of active seed infection

17. Penetration through ovary wall
Ex: Cladosporium
variabile (spinach)
Botrytis (onion)
2
Indirect systemic infection
Mude
1996

18. Penetration through floral parts3
Ex: Ustilago nuda
Cucumber mosaic virus
Indirect systemic infection
Mude
1996

19. Seed Health Testing Methods
 Inspection of dry seed
 Examination of soaked seed
 Examination of suspension obtained
from washing of seeds and
sedimentation Examination of Whole
Embryo
Examination of un germinated seed. Incubation testsIncubation tests
 Blotter method
 2,4-D method
 Freezing method
 Agar plate method
 Water agar plate method
 Seedling symptom test
Bio-assays and Biochemical testsBio-assays and Biochemical tests
 Indicator plant test
 Phase-Plaque test
 Serological test
 Electron microscopy
 Molecular methods: ELISA, PCR
Inspection of plants in fieldInspection of plants in field
 Field trials
 Inspection of seed crop
MOLECULAR METHODSMOLECULAR METHODSMOLECULAR METHODSMOLECULAR METHODS
PCR
Real Time PCR
Real Time PCR
using Specific
Flouresent Probes
Reverse
Transcriptase PCR
Nested PCR
BIO-PCR
DNA-CHIPS (Micro
Arrays)
08/25/17 19

20. 20
The main objectives of a seed health test
08/25/17

21. REGIONAL SEED HEALTH CENTRES
21
ISTA SEED RULES
Seed health testing-64 protocols
were being compared
Only 14 protocols were accepted
as rules
ISTA did not satisfy the
international seed industry
SI in 1994 organized the ISHI-
Veg characterized by vegetable seed
industry Netherlands and France
ISHI reference method is a
method through the ISTA
comparative testing and reviewed by
ISTA members
08/25/17

22. International seed
federation
ISF represents the seed industry at intergovernmental
organisations including:
OECD (Organization for Economic Cooperation and Development)
UPOV (International Union for the Protection of New Varieties of Plants)
ISTA (International Seed Testing Association)
IPPC (International Plant Protection Convention)
FAO (Food and Agriculture Organization of the UN)
CBD (Convention on Biological Diversity)
WIPO (World Intellectual Property Organization)
08/25/17 22

23. Seed health test methods approved as standard methods by the ISHI, ISTA or the National
Seed Health System (NSHS)
Munkvold (2009)
08/25/17 23

24. SAMPLE PREPARATION FOR IDENTIFICATION SEED
BORNE DISEASES
 The techniques available - Conventional, present day
Innovative
 Major factor - extraction of target from the sample -
important for detection
 Viruses - has been simplified-imprinting or squashing
 Bacteria - prior enrichment step in solid or liquid
medium
 Serological/Molecular - most appropriate - high
number of samples need to be analyzed
08/25/17 24

25. ELISA
Enzyme Linked Immuno-SorbentAssay
A 96 - well microtiter plate
being used for ELISA.
 A test that uses antibodies and color change to
identify a substance.
 ELISA involves at least one antibody with
specificity for a particular antigen.
1. Antigen: The antigen is your target protein
which comes from your sample extract.
2. Antibody: binds only to the specific wanted
antigen
3. Enzyme Conjugate: An enzyme conjugate (EC)
is an antibody joined with an enzyme.

26. Basic principle of ELISA
26
Enzyme is used to detect the
binding of Antibody – Antigen
Enzyme converts colorless
substrate into colored product,
indicating the presence of Antibody
- Antigen complex
ELISA can be used to detect
either presence of Antigens or
Antibodies
Slides by Mathias Bader and Simon Loew

27. ELISA
Step 1:
Add sample
Step 2:
Add antibodys
E E
E
Step 3:
Washing
EE
E
Step 4:
Add substrate
E
Quick methodology – just one washing
step

28. 08/25/17
Nested PCRNested PCR
 Two pairs of primers are used to
amplify a fragment
 First set of primers amplifies DNA
segment along with target
sequence
 Target sequence within A
amplified portion is re-amplified
using second set of primer (nested
primers)
 It minimizes the amplification of
wrong PCR fragment. Thus very
specific amplification
 Used as a highly sensitive method
in detection of phytoplasmas since
they are unevenly distributed and
present in low titer in phloem
tissues (Eg. Grape vine yellow)

29. 29
RT PCRRT PCR
 Detection of RNA plant viruses
 The RNA strand is first reverse transcribed into
its cDNA strand
 Then amplification of resulting cDNA using PCR
08/25/17

30. Real Time PCR
• It is the direct detection of PCR amplicons using either a double
stranded DNA-binding flourescent dye (SYBR Green I) or a
specific fluorescent probe (light cycler hybridization probes,
TaqMan probes, Molecular beacons)
• The methods of quantifying nucleic acids by conventional PCR
are based on end point analysis where Real time PCR
amplification has reached a plateau phase.
• Real time PCR instruments are able to continually monitor the
amount of product through the log-linear phase of amplification,
which is the most informative part of the PCR.

31. SYBR Green Dye Assay
3208/25/17

32. 33
Bio PCRBio PCR
 PCR to disease diagnosis is limited inPCR to disease diagnosis is limited in
part by the presence of PCRpart by the presence of PCR
inhibitors in plantsinhibitors in plants
 Inhibition can be overcome andInhibition can be overcome and
sensitivity increased by culturingsensitivity increased by culturing
pathogen on agar media prior topathogen on agar media prior to
PCR - (termed BIO-PCR)PCR - (termed BIO-PCR)
 Identification of citrus variegatedIdentification of citrus variegated
chlorosis & Pierce's disease of grapechlorosis & Pierce's disease of grape
caused bycaused by Xylella fastidiosaXylella fastidiosa
08/25/17

33. BIO-PCR. Target cell enrichment followed by PCR improves the
efficiency and sensitivity of PCR by allowing target pathogen
populations to increase in a pre enrichment phase, before DNA ex-
traction and PCR.
Selective pre enrichment increases pathogen populations relative to
nontarget microorganisms and results in higher quantities of target
DNA, which ultimately results in higher sensitivity.
 During incubation and enrichment on artificial media, inhibitory
compounds are adsorbed or diluted during cell harvest, and do not
interfere with DNA amplification.
BIO-PCR, there is no need to identify the pathogen based on
colony morphology since specific PCR primers are used.
BIO-PCR.

34. BIO-PCR
Limits/eliminate some of the problems found in PCR
BIO-PCR
Limits/eliminate some of the problems found in PCR
Select pinpoint-size colonies
of Xoo for Bio-PCR
Extract bacteria from seed or foliage Enrich in
agar or liquid medium Incubate for 15-72 h
Wash plate or centrifuge liquid Use 1-10 μl for
direct PCR Archive sample at-20 ºC
Print capture -PCR (limits inhibitors, prints can be transported/stored for
>3 months)
Infected tomato plant Printing of plant sap on blotter paper (air dry)
Detach bacteria
from print
blotter
in PBS buffer
Conduct PCR
Agar plating
08/25/17 35

35. Examples: Fruit blotch of watermelon,
Halo blight of beans
Bacterial ring rot of potato and
Black rot of carrot
The disadvantages of BIO-PCR
The need for a semiselective medium for each pathogen.
BIO-PCR also requires 2-3 days for bacteria and 5 to7 d for
fungi to grow, significantly increasing the time required for
assay completion.
Another critical drawback of BIO-PCR is that it cannot be
used for obligate parasites (e.g., viruses). As such, it is limited
primarily to readily culturable bacteria and fungi

36. Microarrays are one of the new emerging methods in plant
virology currently being developed by various laboratories.
The principle of microarrays is the hybridization of
fluorescently labeled sequences (targets) to their complementary
sequences spotted on a solid surface, acting as probes.
The main advantage of this method is the opportunity to
detect many pathogens simultaneously.
DNA Micro-arrays

37. DNA microarray technology-
Is an orderly arrangement of thousands of identified
sequenced genes printed on an impermeable solid support,
usually glass, silicon chips or nylon membrane.
These are created using high speed robotics.
High-throughput and versatile technology.
An each microarray can contain hundred to thousands of
probes and it can accomplish many genetic tests in parallel.
The spots can be RNA, DNA, cDNA,
or oligonucleotides, Protiens

38. (De Risi et.al., 1997)
PrinciPle involved in microarray

39. 08/25/17 40
Microarray

40. 08/25/17 41
• Provides data for thousands of genes
• One experiment instead of many
• Fast and easy to obtain results
• Huge step closer to discovering cures for diseases and
cancer
• Different parts of DNA can be used to study gene
expresion
Disadvantages
•The biggest disadvantage of DNA chips is that they are
expensive to create.
• The production of too many results at a time requires long
time for analysis, which is quite complex in nature.
• The DNA chips do not have very long shelf life, which
proves to be another major disadvantage of the technology.
ADVANTAGES

41. Magnetic capture hybridization PCR (a) Coating of magnetic beads with single-
strand oligonucleotide capture probes; (b) hybridization of target DNA with capture probes;
(c) real-time PCR of capture probe-target DNA hybrid
Munkvold (2009)
08/25/17 42

42.  Growing-on test
 Indicator plant test
 ELISA - Monoclonal
Recombinant protein
 Electron microscopy
 PCR-based methods
 RT-PCR
 Real time
Seed Health Testing Methods for Virus
08/25/17 43

43. Immunocapture reverse transcription polymerase chain reaction (IC-
RT-PCR)
Brief assay procedure
Grind sample in PCR sample extraction
buffer
Dispense the ground sample into PCR
tube
Prepare and add positive/negative
controls into the control tube
Incubate the plate for 2 hours at room
temperature, or overnight at refrigerator
Wash the PCR plate with PCR washing
buffer
Prepare and add the primers to master
mix Add the master mix with enzymes into
all of the PCR tubes
Perform RT-PCR cycling
08/25/17 44

44. Comparison IC-RTPCR and ELISA to detect Peanut stripe virus (PStV) and
Peanut mottle virus (PeMV)
Gillaspie et al., 2000
100-seed samples were tested, which allowed larger numbers of seed lots to be
processed more rapidly than could be done easily by ELISA (even at 30 seeds/lot).
allows for a large number of seed lots to be tested in a given time period and is an
important step toward improving virus detection for germplasm handling and
distribution
08/25/17 45

45. Multiplex-PCR is a time and reagent saving amplification
technique in which multiple primer sets are used to amplify
multiple specific targets simultaneously from the same sample.
Multiplex PCR allows the simultaneous and sensitive detection
of different DNA or RNA targets in a single reaction. It helps in
reducing the number of tests required, but care is needed to
optimize the conditions so that all amplicons can be generated
efficiently. Developed a multiplex PCR assay to detect and
quantify four foliar fungal pathogens in wheat.
S. tritici (leaf blotch) and
S. nodorum (leaf and glume blotch),
Multiplex PCR

46.  Seed-borne viruses distributed to
most cowpea producing regions of
the world-exchange of seed
 Legume seeds infected by viral
pathogens-primary source of
infection, resulting infection up to
100%
 Economically significant and
cosmopolitan seedborne viruses of
cowpea, Bean common mosaic virus
strain blackeye cowpea mosaic,
Cucumber mosaic virus and Cowpea
aphid-borne mosaic virus
 BCMV & CMV: High yield losses,
seed-transmitted in cowpea at rates
up to 40%
 The synergistic effects of co-infection
of cowpea with BCMV and CMV
causes severe stunting and nearly
complete yield loss
Multiplex PCR for detection of BCMV-BlCM and CMV in cowpea
08/25/17 47

47. Multiplex PCR for detection of BCMV and CMV in cowpea
 Cowpea seed samples (58) collected
from different parts of India
 Samples subjected to growing on test
 Total RNA extracted from suspected
leaf
samples
 Leaf samples also blotted on FTA
membrane [Whatman, UK]
 BCMV detected in cowpea by primer
FW3,5'gcagtagcacagatgaaggca3' and
Rv3,5'ggttcttccggcttactcataaacat3‘(Coat
protein gene)
 CMV detected in cowpea by primer Fw1,
5'TTAATCCTTTGCCGAAATTTGATTCT
ACC3’andRv1,
5'AAGCTGGATGGACAACCCGTTC3’
Udayashankar et al., 2010
08/25/17

48. BCMVdetected in 19
samples by growing on test
confirmed by PCR
CMV symptoms not
observed in growing on test
However, 7 samples were
positive for3CMV infection in
PCR
Multiplex PCR- All CMV
infection confirmed were co-
infected with BCMV
Out of 58 samples 19
samples were infected by
BCMV, 7 samples co-infected
with CMV
Udayashankar et al., 2010
49

49. Bean common mosaic virus infecting french bean
 Infects legume crops worldwide
 Economically significant losses in grain legumes
 Aphids & seed-transmitted
 Numerous serological strains & variants, differing
symptoms or host range
 Ten major strains (pathotypes)-worldwide
 Primers designed for coat protein gene
 BCMVFw3-5'TTCTTCCggCTTACTCATAAC3
 BCMVRv3 -'5'gCAgTAgCACAgATgAAgCA3‘
 Multiplex primers designed to simultaneously
 amplify BCMV and BCMNV in french bean
Lund (2008)
Multiples PCR detection of BCMV and
BCMNV in french bean by RT-PCR
08/25/17 50

50. Tobacco mosaic virus (TMV) and Tomato mosaic virus (ToMV)
• The tobamovirus genome
is a messenger sense
• RNA -4 proteins during
virus infection
• Economic losses
worldwide
• No reported vector
• Tobamoviruses–share
homology in CP
• Alternate source for primer
designing
08/25/17 51

51. Kumar et al., 2010
08/25/17 52

52. Conventional PCR and real-time quantitative PCR detection of
Helminthosporium solani in soil and on potato tubers.
Conventional PCR and real-time quantitative PCR detection of
Helminthosporium solani in soil and on potato tubers.
Cullen et al., 2001Cullen et al., 2001
PCR amplification of genomic DNA from different isolates of (silver scurf )
Helminthosporium solani using primers Hs1F1/Hs2R1 and Hs1NF1/Hs2NR1. Lanes: 1, DNA
marker; 2, negative control (dH2O); 3–9 (amplification with Hs1F1/Hs2R1)∗ H. solani
isolates, H2, H6, H8, H11, H18, H20, H24; 10–16 (amplification with Hs1NF1/Hs2NR1)∗ H.
solani isolates, H36, H37, H38, H39, H40, H41, H55. Both sets of PCR primers amplified a∗
single product of the correct size from all isolates of H. solani tested
5308/25/17
Automatic ABI
PRISM 7700
sequence detector
ABI Prism flurosence
detection system
automatically
calculated the conc.
Of H. solani DNA
447 bp 371bp

53. The virus was initially isolated on an indicator host Chenopodium quinoa (a) showing the symptoms
and presence of virus infection. A small spherical virus was identified (b) using electron microscopy.
The microarray was used to identify the virus to species (c ); the white spots in location A1, A9, and I9
are the positive control spots for the 18S gene from plants and show that RNA was extracted and
labeled effectively from the healthy control (Cy3) and test plant (Cy5). The red spots D5-D9 indicate
the detection of virus in the test plant (labeled with Cy5 only) the location of these spots indicate the
detection of Broad bean wilt virus 2, the remaining locations represent oligonucleotides for other
viruses and are all negative.
Boonham et. al., 2007
Microarrays for Rapid Identification of Plant Viruses
08/25/17 54

54. Seed Health Testing Methods Bacteria
o Direct plating
o Liquid assay: Semi-
selective media
o Biochemical/Physiological
o Infectivity testing
o PCR-based methods
08/25/17 55

55. PCR-based detection of important seed-borne bacteria infecting rice
• Bacterial leaf blight (BLB) caused by Xanthomonas oryzae
pv. oryzae (Xoo), bacterial leaf streak (BLS) incited by X.
o. pv. oryzicola (Xoc) are considered as the most serious
bacterial diseases of rice in the tropics
• The phenotypic and genotypic features of both pathovars
are rather similar, but differing from each other in their
mode of infection
• Both organisms are seed-borne and seed transmitted and
reported in seeds from Asia and Africa
• Rice seed samples collected
from different agro-climatic
regions of India
• Seed Health Testing – Direct
plating, liquid assay (YDC)
• Suspected colonies
subcultured on the general
growth medium (Nutrient Agar)
08/25/17 56
Sangare et al.,
2015

56. characterize the reaction of these strains according to their difference and their resemblance, and
assess their rate of chlorophyll through their spectral variation depending on light intensity
transmitted, reflected and scattered. Sangare et al., 2015
Multi-spectral and Multi-modal microscope
08/25/17 57
Transmission
Reflection
Scattering

57. Multiplex PCR for detection of important seedborne pathogens infecting rice
 Xanthomonas oryzae pv. oryzae
(designed for Hypothetical protein
amplifying an amplicon of 160 bp)
 Bipolaris oryzae (primers BoVf and
BoVr –designed for ITS region
amplifying an amplicon of 275 bp)
 Alternaria padwickii (primers
ApadF01 and ApadR04 – designed for
ITS region
 amplifying a product of 426 bp)
Pyricularia oryzae (Primer designed
for Pot2 transposon (EMBL Acc. #
33638)amplifying an amplicon of 653
bp
 Rice ITS gene (Acc. #X16280)
amplifying an amplicon of 1050 bp
Lang et al., 201008/25/17
58

58. Seed Health Testing Methods for Fungi
i. Dry seed inspection
ii. Washing test
iii. Embryo-extraction
iv. Incubation tests
v. Knowledge of taxonomy and morphology
vi. Seedling symptom test
vii. PCR-based methods
i. Dry seed inspection
ii. Washing test
iii. Embryo-extraction
iv. Incubation tests
v. Knowledge of taxonomy and morphology
vi. Seedling symptom test
vii. PCR-based methods
08/25/17 59

59. Some important barcoding gene targets
60

60. Some important barcoding gene targets
61

61. PCR-based detection of important seed-borne fungi infecting rice
• Pyricularia oryzae is the earliest known and
most destructive disease of rice worldwide.
seed loss due to rice blast ranges from 70-80%,
under extreme conditions
• Pyricularia and Cladosporium habit
characteristics are very similar conidial tip of P.
oryzae are acute, in Cladosporium they are
straight, whole cluster looks like a brush.
• Seed-borne inoculum are usually located at the
glumes region of rice seed. Early observation of
incubated seeds is important as Cladosporium
over grows or confuse by habit characters
• Specific detection is carried out by Pot2
transposon regions pfh2F
5’cgtcacacgttcttcaacc3’ and pfhR
5’cgtttcacgcttctccg3’
Blast symptoms on rice
Grayish green circular lesions or spots with dark green borders.
Older lesions on the leaves are elliptical or spindle-shaped and
whitish to gray with brownish or necrotic border (A). Lodging of
panicle under severe stages of infection (B).
Harmon et al., 2003
Detection of P. oryzae by specific primers pfh2F and pfhR designed for Pot2 transposon gene. Positive
reaction, amplification of 687 bp product (lane 1-4, 6, 8, 9 & 11). Lane 5, 7, 10 and 11 are negative for PCR.
08/25/17 62

62. Anthracnose of chilli caused by Colletotrichum capsici
Different species of
Colletotrichum, namely C. capsici,
C. gloeosporioides and C.
acutatum are known to cause
anthracnose in chilli
White et al., 199008/25/17 63

63. Molecular detection of Phomopsis azadirachtae, the causative agent
of dieback disease of neem by PCR.
Molecular detection of Phomopsis azadirachtae, the causative agent
of dieback disease of neem by PCR.
64Nagendra et. al., 2006Nagendra et. al., 200608/25/17

64. Selected seed-borne fungi detected by the PCR methodSelected seed-borne fungi detected by the PCR method
6508/25/17

65. Detection of Seed-Borne Ustilaginoidea virens (False smut of rice)
by Nested-PCR
Detection of Seed-Borne Ustilaginoidea virens (False smut of rice)
by Nested-PCR
knowledge of the disease cycle and epidemiology of this pathogen is minimal and incomplete.
 It is not yet known whether seed-borne inoculum is the primary source of infection.
Spore balls are believed to germinate late in the growing season and infect rice flowers.
 Objective: to provide growers with early indicators of false smut infection to predict incidence in
rice fields and to determine if seeds are free of pathogen infestation and infection.
66Ditmore and Te Beest (2005)Ditmore and Te Beest (2005)
Nested-PCR assay provides sensitive and specific detection of the smut pathogen and identifies the
fungus in and on seeds of rice to identify disease free seeds.
08/25/17

66. Fruit rot of brinjal caused by Phomopsis vexans
Phomopsis vexans
is characterized by
the presence of
pycnidia on seed.
• A more specific,
precise
identification and
diagnosis of P.
vexans achieved by
specific primers
targeting the ITS
region
White et al., 1990White et al., 199008/25/17 67

67. Advantage of
Modern molecular methods
• Rapid, sensitive, cost-effective.
• Integration to certification and inspection .
• Commercially available standardized kits.
• Non- culturable phytoplasma can be
analyzed
• less sensitive to mutation and variation.
• Discrimination at low taxonomic level i.e.
strain level.

68. Disadvantage
• Experimental errors and sampling errors.
• Impossibility to discriminate viable and
non- viable cells .
• False negative and false positive difficult to
verify.
• Changing
probes/primers/enzymes/methods/chemic
als/ may yield different.

69. 08/25/17 70
General features of seed detection assays including the time required for
completion, sensitivity, ease of application, specificity, and applicability for
the detection of fungi, bacteria and viruses

70. Seed Improvement Programme both in Public &
Private Sector
The molecular tools have proved to be a powerful means
to study the microbial diversity of environmental samples
Cloning and subsequent sequencing have revealed many uncultured
microorganisms, while fingerprinting and hybridization strategies are
more convenient for routine analyses of changing environment and
comparisons between different samples
The invention of PCR has enabled the detection of
species with very low abundance
DNA chip technology, higher throughput, a more
targeted use of seed treatment is possible08/25/17 71

71. Seed Art
THANK YOU!

74. METHODS OF
SEEDBORNE
DISEASE
MANAGEMENT

75. e-Dressing
It is a new, efficient and environment friendly technique.
Uses the biocidal effect of low energy accelerated
electrons.
It is also known as electron treatment,
Developed by the Fraunhofer FEP in Dresden ,Germany.
The technology is effective against bacterial, virus and
fungal pathogens.
Usable for all kinds of seed.
Have high seed throughput up to 30 t/h.
Treated seeds are marketed under the brand E-PURA®.

76. Mode of action of low energy electrons
Untreated region Treatment zone Treated region

77. Mobile e–Ventus plantSeed dressing unit
Treatment
chamber
Electron
generator

78.  No pollution of the environment.
 Leftover seed can be used as feed.
 No development of pathogenic resistance.
 Equipment is portable.
 Electron treatment is non-specific in nature.
 Apart from electricity, no other materials are required.
 Only one trained person is required to supervise the operation
of the plant.
 Recommended for both conventional and organic agriculture.
 Disadvantage:-
- Pathogens in the embryo and endosperm is not removed.

79. ThermoSeed®
• Innovative seed disinfection technology for sound and healthy
seed.
• Developed by SeedGard AB Company and now owned by
INCOTEC Company, Sweden.
• Principle involved is exposure of the seeds to controlled hot and
humid air.
• Used for seed treatment in different crops from field crops to
vegetables.
• Equipment capacity ranges from 10 kg-15 t/h in cereals and 1
kg/h, 12 kg/h, 2 t/h and 15 t/h in vegetables.
• Technology is in commercial use since 2003.

80. Principle involved
•Seedborne pathogens are killed at temperature time not
injurious to the seed.
•Aims at Narrow interval also called “temperature
window”.
•Width of this interval varies among different seed types
and also from one seed lot to other.
•Hence it is necessary to pre-test the lots before the
process is initiated.

81. Width of the “treatment window” for disinfection of seed in various
crops.
(Forsberg, 2004)

82. Working of the equipment
Device is regulated by modern sensor and computer control
technology.
Consists of two phases:-
- Heating phase
- Cooling phase
Three different types of aerated steam treatment systems:-
- Batchwise treatment in thin-layer.
- Batchwise treatment in fluid bed.
- Continuous fluid bed treatment.

83. Thermoseed Machine

84. Advantages
• Environment and user friendly.
• Leftover treated seed can be used as feed.
• Reduced disposal costs for the seed industry.
• Cost effective – competes with chemical seed treatment.
• Broad spectrum.
• Used in both conventional and organic agriculture.
• The process is fast and does not require additional drying.
• Enhance the effects of subsequent treatment.

85. Gopure®
• Specially formulated process to treat seeds and remove the deep
rooted infections.
• Developed by Germains seed technology and Chemtura
AgroSolutions , Germany.
• Approved by the Federal EPA, in 2012 and from the state of
California in 2013.
• Uses a combination of fungicides in a novel micro-emulsion
formulation.
• Available as ready to use formulations.
• Ipconazole + Cypermethrin - Trade name Rancona C.
• Superior control of smuts and bunt in wheat, barley and oats,
with cypermethrin providing control of stored grain insects.

86. Advantages
•Removal of seed-borne and soil-borne fungal pathogens.
•Control of stored grain insects.
•Compatible with other seed treatments.
•Unique micro emulsion formulation providing,
- Low rate of active substance per ton of seed.
- Ease of application.
- Reduced dust-off.
- Excellent distribution on seeds.

87. New Generation Fungicides
Trade Name Active ingredients Control spectrum Crops
Rancona
Pinnacle
•Ipconazole
•Metalaxyl
•Smuts
•Bunts
•Crown rot
•Pythium root rot
•Cereals
•Vegetables
Rancona
Apex®
•Ipconazole •Seedling blight
•Head blight
•Clover
•Wheat
•Barley
•Oats
•Rice
Kinto® Duo • Triticonazole
• Prochloraz
• Common bunt (Tilletia caries)
• Loose smut (Ustilago tritici and
Ustilago nuda)
• Covered smut (Ustilago hordei)
• Ergot fungi (Claviceps
purpurea)
• Wheat
• Barley
• Oats
• Rye
• Triticale
• Sorghum
(www.seedquest.com)

88. Trade Name Active ingredients Control spectrum Crops
Acronis® • F500®
• Thiophanate-methyl
• Purple seed stain (Cercospora
kikuchii)
• Pod and stem blight (Phomopsis
sojae)
• Soybean
Stamina® F3 • F500®
• Triticonazole
• Metalaxyl
• Common bunt (Tilletia
tritici/syn.
Tilletia caries and T. laevis/syn. T.
foetida)
• Covered smut (Ustilago hordei)
• Barley
• Oats
• Triticale
• Rye
• Wheat
Apron
Advance
•Thiabendazole
• Fludioxonil
• Metalaxyl-M
•Ascochyta sp. •Chickpeas
•Lentil
•Beans
Cruiser Maxx
Vibrance
•Sedaxane
•Difenoconazole
•Metalaxyl-M
•Thiamethoxam
•Common bunt
•Dwarf bunt
•Loose smut
•Wheat
•Barley
•Oats
Vibrance XL •Sedaxane
•Difenoconazole
• Metalaxyl-M
•Loose smut • Wheat
(www.seedquest.com)

89. Crop Disease /pathogen Yield loss %
Rice Blast 75
Bacterial blight 6-60
Brown spot 50-90
Shath rot 50
Wheat Loose smut 100
Ear cockle 100
Chickpea Ascochyta rabici 80-90
Cowpea Anthracnose 30-35
Leaf crinkle virus 3-61
Soybaen Tobacco bud blight 66
Soybean mosaic virus 25-94
Cucumber Cucumber mosaic virus 34-53
Losses due to seed borne diseases

90. Extraction of mRNA from the sample
• RNA solution or dissolve total RNA sample in 450 μl of Elution Buffer
then add 50 μl of 5M NaCl
• Heat at 65°C for 5 minutes and quickly cool in an ice bath for 3
minutes
• Apply total RNA solution to equilibrated oligo (dT)25 -cellulose
• Microcentrifuge for 10 seconds.
• Pipet supernatant back into original microcentrifuge tube.
• Add 400 μl of Wash Buffer to oligo (dT)25 -cellulose beads
• Add 400 μl of Wash Buffer to column reservoir and wash
• Add 200 μl of prewarmed Elution Buffer to column reservoir.
• Place Elution Buffer eluate on ice.
• To recover poly(A)+
material microcentrifuge for 15 minutes at 4°C.
Carefully decant supernant, then wash the pellet (often not visible)
with 70% ethanol. Recentrifuge briefly, decant supernant and allow
pellet to air dry.