Kunak2010MSc[1][1]

Systematics and conservation of a widespread velvet worm species Opisthopatus cinctipes
1
Systematics and conservation of a widespread
velvet worm species Opisthopatus cinctipes:
evidence for cryptic speciation
Ms Charlene Kunaka
Supervisor: Prof S.R. Daniels
Thesis submitted in partial fulfillment of the requirements for
the degree of Master of Science at the University of Stellenbosch
Department of Botany and Zoology
University of Stellenbosch
Private Bag X1, 7602 Stellenbosch, South Africa

2
- Preface -
Declaration
I, the undersigned, hereby declare that the work contained in this thesis is my own original work and that
I have not previously in its entirety or in part submitted it at any university for a degree
Verklaring
Ek, die ondergetekende, verklaar hiermee dat die werk in hierdie tesis vervat, my eie oorspronklike werk
is en dat ek dit nie vantevore in die geheel of gedeeltelik by enige universiteit ter verkryging van `n
graad voorgele het nie
Signature / Handtekening: .......................................
Date / Datum: ..........................................................

3
- Preface -
TABLE OF CONTENTS
ABSTRACT…………………………………………………………………………………………………v
ACKNOWLEDGEMENTS…………………………………………………………………………………vi
LIST OF FIGURES……………..…………………………………………………………………………viii
LIST OF TABLES…………………………………………………………………………………………..x
CHAPTER 1: INTRODUCTION……..…………………………………………………………………….1
AIMS AND RESEARCH OBJECTIVES…………………...................................................................9
CHAPTER 2: MATERIALS AND METHODS
2.1: Sample collection……………………………………………………………………………………10
2.2: DNA extraction, PCR and sequencing…………………………………………………………….10
2.3: Phylogenetic analyses………………………………………………………………………………15
2.4: Population genetics and Phylogeographic analyses……………………………………………..16
2.5: TCS Network………………………………………………………………………………………….16
2.6: Divergence time estimation…………………………………………………………………………17
2.7: Morphological analyses ……………………………………………………………......................18
CHAPTER 3: RESULTS
3.1: Combined COI and 12S rRNA data analysis…..…………………………………………………20
3.2: Population genetics and demographic statistics.…………………………………………………26
3.3: Combined COI, 12S rRNA and 16S rRNA data analysis………………………………………..29
3.4: Nuclear marker data………………………………….….…………………………………………..35
3.4.1:18S rRNA data analysis………………………………………………………………………….35
3.4.2: Combined mtDNA and nDNA data analysis…………………………………………………..39
3.5: Divergence time estimation………………………….….…………………………………………..43

4
3.6: Morphology…………..……………………………….….……………………………………………45
3.6.1: Gross morphology….………………………………………………………………………….45
3.6.2: Scanning electron microscopy…………….…………………………………………………46
CHAPTER 4: DISCUSSION AND CONCLUSION
4.1: Systematics within Opisthopatus cinctipes species complex…………………………………58
4.1.1: Speciation mechanisms……………………………………………………………………….59
4.2: Species distinction criteria……………………….………………………………………………..61
4.3: Application and utility of molecular markers.........……………………………………………...63
4.4: Evolutionary history and Biogeographic patterns within O. cinctipes species complex……65
4.5: Biogeography in relation to habitat colonization………………………………………………...66
4.6: Conservation implications…………………….……………………………………………………69
REFERENCES………………………………………………………………………………………………72

5
- Preface -
ABSTRACT
Opisthopatus cinctipes is a velvet worm endemic to South Africa and is widely distributed in isolated
Afromontane and coastal forest patches throughout the Eastern Cape, KwaZulu-Natal and
Mpumalanga. The species, like most velvet worms is characterized by low vagility, microhabitat
specialization and is hypothesized to harbor significant cryptic diversity. We used partial sequence data
derived from three partial mitochondrial (mtDNA) gene loci (COI, 12S rRNA and 16S rRNA) and a partial
nuclear gene fragment (18S rRNA), as well as gross morphological character analysis and scanning
electron microscopy (SEM) to determine evolutionary relationships amongst a total of 120 specimens of
O. cinctipes from 33 localities. Phylogenetic relationships were investigated using Bayesian inferences,
Maximum Parsimony and Maximum Likelihood analysis. Phylogenetic analysis of mtDNA and nDNA
data revealed the presence of multiple cryptic lineages nested within Opisthopatus cinctipes with at
least nine distinct well supported clades (> 70% / > 0.95 pP), suggesting that the taxon comprises a
“species complex”. Afrotemperate forest specimens were genealogically highly distinct from each other
whilst Indian Ocean Coastal Belt forest (at least in KwaZulu-Natal) specimens were more closely related
and formed a well supported clade. An analyses of molecular variance indicated that (ΦST) 89.31% of
the genetic variation occurred amongst localities. Highly significant FST values were generally observed
across sampled localities (FST = 0.89, p < 0.001). Tajima’s D value was 0.83 over all sampled localities,
implying a decrease in population size and/or balancing selection. Uncorrected pairwise sequence
divergence values between O. cinctipes localities for the COI locus were high and ranged from 3.20% to
19.50%. No haplotypes were shared between localities. There is considerable evidence showing that
past geological events may have shaped the deep genetic divergences observed between sampling
localities suggesting the absence of gene flow. Genetic divergences within the South African O.
cinctipes species complex are shown to have occurred from the onset of the Cenozoic era. The genetic
variation observed within clades was not accompanied by morphological differences suggesting that the
use of morphological characters has grossly underestimated species diversity within South African
Opisthopatus. A robust taxonomic documentation of the species diversity within the O. cinctipes species
complex is critical for the implementation of conservation management plans for this species complex.
We recommend that highly sedentary taxa with limited dispersal abilities and specific habitat
requirements which may be found in sympatry with velvet worms be prioritized for taxonomic revision as
they may also harbor cryptic lineages.

6
- Preface -
ACKNOWLEDGEMNTS
All the experimental work was conducted at the University of Stellenbosch (US) in the Evolutionary
Genomics Group Laboratory and Geology Department.
I would like to thank the Lord Almighty who gave me the strength and the desire to acquire
knowledge, without Him I would not have made it this far.
My sincere gratitude to the following persons and organizations:
My supervisor Prof S.R. Daniels for his relentless support, training, guidance, revision of this
thesis and collection of some 12SrRNA and COI sequences used in this study. Savel my
thanks go beyond what words can say, thank you. You helped me realize that hard work pays
and you imparted a treasure that I will bear until the end.
The National Research Foundation of South Africa and the Department of Botany and Zoology
(US) for financial support, bursaries and running costs.
Members of the Evolutionary Genomics Group for their support.
To Nico Solomons and Francois Van Zyl for their assistance during field trips.
Dr D. Hebert, Prof C. Matthee, Dr M. Hamer and students, Dr Adnan Moussalli, Dr Devi Stuart,
Mary Bursey, Hein van der Worm for samples.
KwaZulu-Natal Wildlife, Eastern Cape Nature Conservation, Mpumalanga Parks Board for
collecting permits.
To Tinashe Muteveri and Prof C. Matthee, thank you for the advice that made me realize a
dream not worth giving up.
To Solace, thank you for all the love and support and encouraging me all the way.

7
Lastly to my beautiful mother Ms Kunaka, thank you for teaching me the true meaning of life
and perseverance. I would not have achieved anything in life without your love and guidance
and may God richly bless you.

8
- Preface -
LIST OF FIGURES
Figure 1. Map of South African provinces Eastern Cape (EC), KwaZulu-Natal (KZN) and Mpumalanga
(MP), showing the distribution of the three Opisthopatus species………………………………………...6
Figure 2: List of localities where Opisthopatus specimens were collected………………………………14
Figure 3. Combined COI and 12S rRNA mtDNA Bayesian topology for Opisthopatus………………..24
Figure 4. Combined MP topology (COI, 12S RNA and 16S rRNA mtDNA) for Opisthopatus…………34
Figure 5. 18S rRNA Bayesian topology for Opisthopatus…………………………………………………38
Figure 6. Total evidence (COI, 12SrRNA, 16SrRNA and 18SrRNA) Bayesian tree topology
for Opisthopatus.………………………………………………………………………………………………40
Figure 7. Geographic distribution of clades of O. cinctipes observed on the total evidence BI
topology (COI, 12S rRNA, 16S rRNA and 18S rRNA) ……………………………………………………42
Figure 8: Total evidence (COI, 12S rRNA, 16S rRNA and 18S rRNA) maximum clade
credibility chronogram of Opisthopatus and Metaperipatus……………………………………………….44
Figure 9: A-L. Images of the dorsal surface of O. cinctipes sample localities …………………………48
Figure 9: M-X. Images of the dorsal surface of O. cinctipes sample localities ………………………..49
Figure 10: A-L. Images of the ventral surface of O. cinctipes sample localities Pictures of the
ventral surface of O. cinctipes………………………………………………………………………………..50
Figure 10: M-L. Images of the ventral surface of O. cinctipes sample localities .…………………….51

9
Figure 11: A-F. Scanning electron micrographs of male genitalia of O. cinctipes male specimens
from selected localities………………………………………………………………………………………..56
Figure 12: A-C. Scanning electron micrographs of dorsal head surface showing a cleft
between antennae of O. cinctipes male specimens..………………………………………………………55
Figure 12: D-F. Sections showing dermal plicae and dermal papillae arrangement in
O. cinctipes specimens………………………………………………………………………………………..55

10
- Preface -
LIST OF TABLES
Table 1: List of Opisthopatus species and localities, provinces and GPS coordinates where samples
were collected during the present study. N is the number of samples collected………………………13
Table 2: Locations where samples of Opisthopatus have been collected and the number of specimens
sequenced for each gene region……………………………………………………………………………22
Table 3: Diversity measures for O. cinctipes localities with locality numbers corresponding to those in
Fig. 1……………………………………………………………………………………………………………28
Table 4: Pairwise FST values among sampled O. cinctipes localities……………………………………31
Table 5: List of primer sets that were tested in this study…………………………………………………37
Table 6: General external body features of O. cinctipes specimens examined

11
CHAPTER 1
INTRODUCTION

12
CHAPTER 1
INTRODUCTION
In recent years there has been a significant loss of biodiversity, sparking a global biodiversity crisis (Qiu-
Hong et al., 2004; Bickford et al., 2006). The loss of biodiversity has had a negative impact on
ecosystem function, services and structure. These negative environmental impacts are largely a by-
product of rapid anthropogenic alterations (Roeding et al., 2007), resulting in significant habitat loss,
population range contraction and species extinction. It is anticipated that habitat alterations will
exacerbate in future with an increase in the human population numbers and the coupled demand for
living space and global climate change, further straining ecosystem processes (New, 1995). These
global environmental changes are likely to further negatively impact species habitats and distributions.
An effective conservation management plan requires a firm grasp of the biodiversity (King and Hanner,
1998; Agapow et al., 2004; Bickford et al., 2006). However, one of the central challenges and
impediments for implementing effective conservation management plans is the inadequate
documentation of species diversity involving basic alpha taxonomic descriptions, since conservation
legislations require formal taxonomic distinction. In this regard the misidentification of species may lead
to the implementation of inefficient conservation measures and potentially result in species extinction
(Bickford et al., 2006). Sound alpha taxonomy is thus critical for species conservation, considering the
dependency on defined and described evolutionary units in conservation.
Numerous invertebrate phyla can be categorized as being poorly studied taxonomically (compared to
vertebrate phyla), particularly considering the dwindling alpha taxonomic expertise globally and the
general decline in funding for monographic taxonomic research. Where there has been recent
(molecular) systematic research on invertebrate groups, these studies have always revealed a
significant increase in taxonomic diversity and endemicity (Hoffman, 1998; Bond and Sierwald, 2002,
2003; Bueno-Villegas et al., 2004). Ancient euarthropodian lineages such as velvet worms are likely to
harbor significant taxonomic diversity. Onychophora has long been regarded as an important template
in evolutionary biology due to its dubious phylogenetic position, ancient fossil record and Gondwanan
distribution (Monge-Nájera, 1995; Gleeson, 1996; Roeding et al., 2007). The phylum is often considered
to be “living fossils” since many of the extant species share a considerable number of morphological
features with fossil species (Hamer et al., 1997). However, there is debate about the sister relationships
between Onychophora and fossil Lobopodia (Snodgrass, 1938; Hou and Bergstrom, 1995; Cavalier-
Smith, 1998; Maas et al., 2007).

13
Velvet worms typically inhabit humid forest areas with closed canopy where they occur predominantly in
saproxylic environments (such as decaying wood logs and leaf litter) but they have also been collected
from grasslands and fynbos where they occur under stones (Newsland and Ruhberg, 1979; Ruhberg,
1992) while some species have been found in caves (Newsland and Ruhberg, 1979). Onychophorans
were categorized as vulnerable organisms (Wells et al., 1983), mostly due to high local endemicity, the
susceptibility of their habitat to disturbances and the fact that their populations are generally thought to
be small and fragmented (New, 1995). Furthermore, it appears that many species exist as small isolated
localized populations in habitats which currently have limited, or no conservation status or legal
protection (Monge-Nájera and Hou, 1999; Almeida et al., 2003) accentuating the need for their effective
conservation. In addition, it has also been demonstrated that velvet worm systematics are in flux and
that the diversity within the group has been underestimated, limiting species conservation (Briscoe and
Tait, 1995; Reid, 1996; 2000a; 2000b; 2002; Trewick, 1998; 1999; 2000; Daniels et al., 2009). The IUCN
Red List includes 11 Onychophoran species (three are listed as Critically Endangered; two are listed as
Endangered; four are listed as Vulnerable; one listed as Lower Risk or Near Threatened; and one is
listed as data Deficient) (IUCN, 2009). Four of the 11 IUCN listed species are endemic to South Africa
(Hamer et al., 1997). These include Opisthopatus roseus and Peripatopsis leonina which are both listed
as Critically Endangered while P. alba and P. clavigera are listed as Vulnerable (IUCN, 2009),
underscoring the need for prioritizing their conservation among terrestrial invertebrates.
The phylum Onychophora is comprised of two extant families, the Peripatidae (Evans, 1901) and the
Peripatopsidae (Bouvier, 1904). The Peripatidae family has a tropical distribution whereas the
Peripatopsidae family has a southern hemisphere distribution (Bouvier, 1905; Clark, 1915; Brinck, 1957;
Ruhberg, 1985; Monge-Nájera, 1995; Reid, 1996). For a list of diagnostic differences between the two
families consult Mayer (2007). In the southern hemisphere velvet worms are present in Chile, South
Africa, Australia, New Zealand and Papua New Guinea and have a typical Gondwanan distribution
(Hamer et al., 1997). To date, 11 species in two genera (Peripatopsis and Opisthopatus) have been
described from South Africa. The taxonomic status within these South African velvet worm genera has
traditionally been determined with the use of variable morphological characters hence the possibility
exists that species diversity within this group has been grossly underestimated. The two endemic South
African genera can be differentiated on the basis of the size of the last pair of legs and the position of
the distal papillae of their feet and the number of leg pairs (Hamer et al., 1997). Peripatopsis (Pocock,
1894) contains eight described species (P. alba, P. balfouri, P. capensis, P. clavigera, P. leonina, P.
moseleyi, P. sedgwicki and P. stelliporata) (Brinck 1957; Hamer et al., 1997; Sherbon and Walker,
2004) while Opisthopatus (Purcell, 1899) contains three described species (O. cinctipes, O. herbertorum
and O. roseus) (Hamer et al., 1997; Ruhberg and Hamer, 2005). The recent discovery of two new point

14
endemic species (one species in each genus i.e. P. stelliporata (Sherbon and Walker, 2004) and O.
herbertorum (Ruhberg and Hamer, 2005) sparked a renewed interest in the diversity and conservation
of the group. The difficulties encountered when determining species diversity within this group using
morphological features are generally attributable to a lack of distinctive characteristics and widespread
intraspecific variation (Reid et al., 1995). In addition, a number of species have wide distribution ranges
and have been undersampled, limiting taxonomic inferences and conservation (Tait and Briscoe, 1990)
especially considering the potential presence of cryptic lineages. Significant evidence exists for
increased taxonomic diversity and cryptic speciation in well-studied areas such as Australasia where
modern systematic studies have been undertaken on the velvet worm fauna of the region.
For example, initially, morphology based taxonomic analysis of Australian Onychophora suggested the
presence of 13 species in six genera (Ruhberg, 1985; Ruhberg et al., 1988, 1991). Recent systematic
investigations based on molecular studies and scanning electron microscopy (SEM) have revealed a
significant increase in the faunal diversity of velvet worms. The fauna currently comprise 38 genera and
81 species, indicating that the diversity of the group had been grossly underestimated (Briscoe and Tait,
1995; Reid, 1995, 1996, 2000a, 2000b, 2002). Systematic research conducted on the New Zealand
fauna using allozyme and DNA sequence data revealed the presence of five to six lineages within the
Peripatoides indigo species complex (Trewick, 1998, 1999, 2000). Recent molecular systematic
research on the South African Peripatopsis revealed eight additional undescribed evolutionary lineages
among the eight described species (Daniels et al., 2009). These findings suggest a two-fold increase in
species diversity within Peripatopsis. Furthermore these results indicate the failure of conventional alpha
taxonomic characters to detect the presence of novel evolutionary lineages within Peripatopsis.
The three Opisthopatus species present in South Africa can be distinguished on the basis of color,
number of leg pairs and dermal plicae (Ruhberg and Hamer, 2005). Two Opisthopatus species (O.
herbertorum and O. roseus) are point endemics (Hamer et al., 1997; Ruhberg and Hamer, 2005).
Opisthopatus roseus is classified as Critically Endangered by the IUCN Red List. Opisthopatus
herbertorum may be classified as either Vulnerable or Critically Endangered (Ruhberg and Hamer,
2005), considering that only two specimens of the taxon have ever been seen and collected despite
exhaustive searches (Daniels pers. com). The third species, O. cinctipes is widely distributed in isolated
forest patches throughout the eastern parts of South Africa (Hamer et al., 1997). The wide geographic
distribution of O. cinctipes is attributed to the eversible sacs found at the base of its legs which aid in
water re-absorption thus allowing this species to survive in xeric areas and potentially aiding its
dispersal (Alexander and Ewer, 1955). Opisthopatus cinctipes was initially divided into three
subspecies, and these include O. c. natalensis (Bouvier, 1901), O. c. amatolensis (Choonoo, 1947), and

15
O. c. laevis (Lawrence, 1947). These subspecies were distinguished on the basis of coloration and
integument texture. However, these subspecies are currently considered invalid taxonomic units (Hamer
et al., 1997).
Opisthopatus cinctipes occurs from the Eastern Cape where it is present along the coast and interior
into KwaZulu-Natal where populations occur along the coast and interior, along the Drakensberg
Mountains into Swaziland and Mpumalanga and is bounded in the north east by the Great Escarpment
(Hamer et al., 1997) (Fig. 1). Opisthopatus cinctipes has conspecific populations that are allopatric (in
discontinuous forest patches) throughout its distribution range. The forested areas where O. cinctipes
populations occurs are small isolated patches that are scattered along the southern and eastern
margins of the country (Hamer et al., 1997) covering approximately 0.1% to 0.5% (depending on the
references) of the total land mass in South Africa and representing one of the smallest biomes
(Geldenhuys, 1998; Mucina and Rutherford, 2006). South Africa’s indigenous forests show floristic and
palaegeographic links to two main forest types namely the Afromontane and Indian Ocean Coastal Belt
(IOCB) forests (White, 1978; Cooper, 1985; Lawes, 1990). Afromontane forests are discontinuous
(Cooper, 1985; Low and Rebelo, 1996), generally cooler and humid and are separated from each other
by lowlands. These forests are also referred to as the Afromontane archipelago due to the island like
distribution of the habitats. Afromontane forests are intolerant of fire regimes, but may be limited in size
by the frequent occurrence of fires in the surrounding fynbos, grasslands and savanna biomes (Mucina
and Rutherford, 2006). Afromontane forests in South Africa show faunal and floral links with the
Afromontane regions which occur further north in Zimbabwe, Malawi, as far north as Ethiopia, along the
east African mountain ranges and westwards to Cameron and northern Angola. These Afromontane
forests also contain high levels of species diversity and endemism (Geldenhuys and MacDevette, 1989,
1998; Lotter and Beck, 2004). Indian Ocean Coastal Belt forests occur on the coast of Eastern Cape
and the KwaZulu-Natal provinces of South Africa. These forests show faunal and floral links with regions
which extend into Mozambique as far as the Limpopo River mouth and continue northwards into
Tanzania, Kenya and southern Somalia (Moll and White, 1978). Historically, forest patches have
undergone significant contraction and expansions, depending on climatic cycles (Hamilton, 1976; 1981;
White, 1981; Taylor and Hamilton, 1994). Afromontane forests were broadly distributed during mesic
periods in the Miocene and Pliocene (White, 1978; Cooper, 1985; Lawes, 1990). Tectonic uplifts in
eastern and southern Africa further impacted Miocene-Pliocene climate by reducing moisture transport
and spatial rainfall patterns resulting in aridification which induced strong shifts in vegetation patterns
and hence resulted in landscape fragmentation (Sepulchre et al., 2006). These climatic cycles directly
impacted the distribution patterns of forest flora and fauna.

16
Figure 1. Map of South Africa showing the distribution of the three Opisthopatus species in the three
provinces, Eastern Cape (EC), KwaZulu-Natal (KZN) and Mpumalanga (MP), modified from Hamer et
al. (1997).

17
Subsequently, by the middle Miocene there was a progressive decrease in precipitation as a direct
consequence of these climatic changes (Lawes, 1990; Eely et al., 1999). The decrease in precipitation
coupled with the development of the proto-Benguela sea current along the Western Cape coast of
South Africa and dramatic uplift along the Eastern Cape Coast resulted in the contraction of
Afromontane forests to high altitude areas (Siesser, 1978, 1980) due to aridification. The tectonic
activities that occurred during the late Pliocene may have further caused fragmentation of forest habitats
(King, 1978) resulting in barriers to dispersal and potentially promoting cladogenesis among allopatric
velvet worm populations. The inland Afromontane forests are thought to represent ancient habitats
(White 1981; Lawes et al., 2000; Wethered and Lawes, 2003) while coastal forests are thought to be
more recent in origin (Martin 1968; Hobday, 1976). Considering the limited vagility of O. cinctipes, their
specific microhabitat requirements, the contemporary fragmented nature of their forest habitats, and the
climatic oscillations that occurred since the Miocene, populations may have survived in micro-refugia in
Afromontane forested areas. It can be anticipated that Afromontane forests represent older lineages
with deeper divergences while Indian Ocean Coastal Belt (IOCB) forests represent more recent
colonizations by O. cinctipes populations. There is a possibility that O. cinctipes may harbor significant
cryptic taxa that were undetected using conventional alpha taxonomic characters (Hamer et al., 1997;
Ruhberg and Hamer, 2005). Therefore, the use of molecular diagnostic markers may be particularly
useful at delineating species boundaries and at identifying novel cryptic taxa. Our null hypothesis is that
O. cinctipes is characterized by significant genetic diversity and contains numerous genealogically
distinct lineages.
The use of mitochondrial DNA in taxonomic classification has revealed profound cryptic speciation
across a wide variety of taxa (Hebert et al., 2004a; Brown et al., 1994; Daniels et al., 2009). However,
there is concern about the limitations of mtDNA as a sole marker for species identification (Zhang and
Hewitt, 2003; Boyer et al., 2007; Lipscomb et al., 2003; Seberg et al., 2003; Rubinoff and Sperling,
2004). Multiple independent data sets (mtDNA, nDNA and morphology) offer the best opportunity of
delineating operational taxonomic units (Cronn et al., 2002) as these data sets reveal species rather
than gene phylogenies. This approach was used in the present study to reconstruct evolutionary
relationships among O. cinctipes populations.
The present study posed four research questions. Firstly, do populations within this widespread South
African Onychophora species Opisthopatus cinctipes represent distinct evolutionary lineages?
Secondly, are cryptic taxa present within this widespread species? Thirdly, are morphological characters
useful at discriminating potential novel taxa? And fourthly, what are the implications of the results of this
study for the conservation of this species in South Africa? This study is also expected to help

18
understand the biogeographic relationships among forested areas in South Africa in order to devise
conservation management plans for potential putative endemic lineages.
AIMS AND OBJECTIVES
The aims of the present study were to examine the evolutionary relationships among O. cinctipes
populations in South Africa using DNA sequence data (mtDNA and nDNA), gross morphological
analysis and scanning electron microscopy (SEM). Sequence data derived from three partial
mitochondrial loci (the cytochrome c oxidase subunit I (COI), 12S rRNA and 16S rRNA), and a single
partial nuclear gene locus (18S rRNA) were used to determine evolutionary relationships among O.
cinctipes populations. The specific objectives of this study were as follows:
To examine the evolutionary relationships among O. cinctipes populations in South Africa using
DNA sequence data.
To apply SEM and gross morphological analysis to the phylogeny to investigate potential
species discriminating characters.
To derive a conservation plan for novel taxa nested within O. cinctipes.
To understand the biogeographic relationships amongst putative clades within O. cinctipes.

19
CHAPTER 2
MATERIALS AND METHODS

20
CHAPTER 2
MATERIALS AND METHODS
2.1: Sample collection
A total of 120 specimens of Opisthopatus cinctipes collected from 33 localities in the Eastern Cape,
KwaZulu-Natal and Mpumalanga provinces in South Africa covering the known distribution range of the
taxon were obtained for this study. In addition, a single specimen of O. roseus from Ngele forest was
collected (Table 1; Fig. 2). We were unable to collect O. herbertorum from Mount Curry Nature Reserve
despite numerous and exhaustive searches, hence the allotype of O. herbertorum (Natal Museum South
Africa 20407) was used for DNA extraction. Locality coordinates were recorded with a handheld GPS
(Garmin-Trek Summit). Samples were hand-collected from saproxylic environments (underneath or
inside decaying logs and leaf litter), in forested areas, targeting the localities included in Hamer et al.
(1997). Where possible five samples were collected per locality, however, this was not always possible
as velvet worms are notoriously difficult to find. Samples were placed in plastic jars, killed by freezing,
preserved in absolute ethanol and stored at 4°C in a refrigerator. Opisthopatus species were identified
in the laboratory using the dichotomous key provided by Ruhberg and Hamer (2005).
2.2: DNA extraction, PCR and sequencing
Tissue biopsies were performed on the ventral surface of samples and subjected to DNA extraction
using a Qiagen DNEasy kit, following the manufacturer’s protocol. Extracted DNA was stored in a fridge
until required for PCR. Prior to use, a 1 µl DNA in 19 µl water dilution was made. Three mitochondrial
gene fragments (cytochrome c oxidase subunit I (COI), 12S rRNA and 16S rRNA) were targeted. These
three loci were selected because they possess varying mutational rates and have been used
successfully for reconstructing evolutionary relationships among a variety of invertebrate groups (Giribet
et al., 2001; Daniels et al., 2004, 2007; Hurst and Jiggins, 2005) including Onychophora (Gleeson,
1996; Trewick, 1999, 2000; Daniels et al., 2009). Mitochondrial DNA has been successfully used for
reconstructing evolutionary relationships in a wide variety of invertebrate taxa due to the widespread
availability of universal primer pairs and the ease of amplification of these gene regions (Sperling and
Hickey, 1994; Funk et al., 1995; Langor and Sperling 1997; Hebert et al., 2004a; Daniels et al., 2007,
2009). However, as the mitochondrial genome is a maternally inherited marker and contains a smaller
number of genes compared to the nuclear genome (Zhang and Hewitt, 2003; Ballard and Whitlock,
2004), systematic conclusions derived exclusively from mtDNA loci may be ambiguous and lead to
spurious evolutionary inferences (Galtier et al., 2009). The inclusion of nuclear markers is critical to
understand species boundaries and phylogenetic relationships. However, nDNA markers are also prone
to a suite of problems. These include recombination, selection (non neutrality), heterozygosity, insertion-

21
deletion polymorphism, low divergence, gene specific variation in rate and history, and PCR sequencing
difficulty (see Zhang and Hewitt, 2003 for a review). The delineation of species boundaries should thus
ideally be derived from independent data sets such as both the mtDNA and nDNA loci. In addition to the
mtDNA data, several nuclear DNA markers were tested but varying levels of amplification precluded
their utility (see results). All specimens were sequenced for COI and 12S rRNA, while only a single
specimen per locality was sequenced for 16S rRNA and 18S rRNA since preliminary sequencing
revealed low levels of genetic variation at the latter two loci, as they evolve the slowest of the four gene
regions investigated in this study.
For each PCR a 25µl reaction was performed that contained 14.9 µl of Millipore water, 3 µl of 25mM
MgCl2, 2.5 µl of 10 x Mg2+ free buffer, 0.5 µl of a 10mM dNTP solution and 0.5 µl of the primer sets at
10mM, 0.1 unit of Taq polymerase and 1 to 3 µl of template DNA. The PCR temperature regime for all
the gene fragments was 94°C for 4 minutes; 94°C for 30 seconds; 48°C for 35 seconds and 72°C for
30 seconds. The last three steps were repeated for 32 to 36 cycles followed by a final extension at 72°C
for 7 minutes. The primer pairs that successfully amplified the respective gene regions are as follows:
LCOI-1490 and HCOI-2198 (Folmer et al., 1994) for a partial fragment of the COI gene; 12Sai and
12Smbi (Kocher et al., 1989) for a partial fragment of the 12S rRNA gene; 16SA and 16SB (Simon et
al., 1994) for a partial fragment of the 16S rRNA gene region and 18S 5F and 18S 7R (Giribet et al.,
1996) for a partial fragment of the 18S rRNA locus. PCR products were electrophoresed on a 1%
agarose gel containing ethidium bromide for about three hours at 90V and products visualized under
ultraviolet (UV) light using a UV transiluminator. The gel bands of DNA were excised and the DNA
extracted and purified using the kit QIA quick gel extraction. Purified PCR products were cycle
sequenced using standard protocols (3 µl of the purified PCR product, 4 µl of the fluorescent-dye
terminators with an ABI PRISM Dye Terminator Cycle Sequencing Reaction Kit, Perkin-Elmer, and 3 µl
of a 10 µM primer solution for each primer pair). Unincorporated dideoxynucleotides were removed by
gel filtration using Sephadex G-25 (Sigma). Sequencing was performed on a capillary automated
machine, housed in the Department of Genetics, University of Stellenbosch.

22
Table 1: List of Opisthopatus localities, provinces and GPS coordinates where samples were collected
during the present study. N is the number of samples collected.
Locality Province N GPS Co-ordinates Species
1. Graaff-Reinet Eastern Cape 4 32° 26′ 585′′ S 24° 49′ 203′′ E O. cinctipes
2. Suurberg Eastern Cape 5 33° 19′ 132′′ S 25° 26′ 226′′ E O. cinctipes
3. Katberg Eastern Cape 5 32° 28′ 132′′ S 26° 40′ 653′′ E O. cinctipes
4. Kleinemonde River Eastern Cape 1 33° 35′ 005′′ S 26° 55′ 000′′ E O. cinctipes
5. Kap River Nature Reserve Eastern Cape 3 33° 48′ 541′′ S 27° 08′ 474′′ E O. cinctipes
6. Baziya Eastern Cape 5 31° 31′ 250′′ S 28° 14′ 738′′ E O. cinctipes
7. Nocu Eastern Cape 6 31° 24′ 928′′ S 28° 29′ 990′′ E O. cinctipes
8. Jenca Valley Eastern Cape 1 31° 21′ 956′′ S 28° 33′ 436′′ E O. cinctipes
9. Port Saint Johns Eastern Cape 5 31° 32′ 097′′ S 29° 50′ 091′′ E O. cinctipes
10. Mount Curry Nature Reserve KwaZulu-Natal 1 30° 28′ 713′′ S 29° 22′ 781′′ E O. herbertorum
11. Ngele Forest KwaZulu-Natal 1 30° 32′ 006′′ S 29° 40′ 907′′ E O. roseus
12. Oribi Gorge Nature Reserve KwaZulu-Natal 5 30° 42′ 376′′ S 30° 16′ 211′′ E O. cinctipes
13. Garden Castle Nature Reserve KwaZulu-Natal 1 29° 44′ 861′′ S 29° 12′ 459′′ E O. cinctipes
14. Kamberg Nature Reserve KwaZulu-Natal 5 29° 23′ 568′′ S 29° 39′ 135′′ E O. cinctipes
15. Highmoor Nature Reserve KwaZulu-Natal 3 29° 18′ 339′′ S 29° 35′ 837′′ E O. cinctipes
16. Injasuthi Nature Reserve KwaZulu-Natal 1 29° 11′ 000′′ S 29° 22′ 000′′ E O. cinctipes
17. Monks Cowl Nature Reserve KwaZulu-Natal 5 29° 02′ 945′′ S 29° 24′ 399′′ E O. cinctipes
18. Cathedral Peak Nature Reserve KwaZulu-Natal 6 28° 57′ 590′′ S 29° 13′ 659′′ E O. cinctipes
19. Royal Natal Nature Reserve KwaZulu-Natal 6 28° 43′ 327′′ S 28° 55′ 993′′ E O. cinctipes
20. Oliviershoek Pass KwaZulu-Natal 2 28° 33′ 000′′ S 29° 04′ 000′′ E O. cinctipes
21. Ixopo (Qunu Falls) KwaZulu-Natal 4 30° 00′ 781′′ S 30° 03′ 839′′ E O. cinctipes
22. Karkloof Falls KwaZulu-Natal 1 29° 24′ 408′′ S 30° 16′ 608′′ E O. cinctipes
23. Vernon Crookes Nature Reserve KwaZulu-Natal 5 30° 16′ 086′′ S 30° 36′ 736′′ E O. cinctipes
24. Umkomaas KwaZulu-Natal 1 30° 20′ 162′′ S 30° 78′ 923′′ E O. cinctipes
25. Krantzkloof Nature Reserve KwaZulu-Natal 5 29° 47′ 703′′ S 30° 43′ 702′′ E O. cinctipes

23
Table 1: continues
Locality Province N GPS Co-ordinates Species
26. Pigeon Valley Nature Reserve KwaZulu-Natal 1 29° 56′ 403′′ S 30° 98′ 506′′ E O. cinctipes
27. Nkandla Forest Reserve KwaZulu-Natal 5 28° 44′ 780′′ S 31° 08′ 079′′ E O. cinctipes
28. Entumeni Forest Nature Reserve KwaZulu-Natal 5 28° 53′ 105′′ S 31° 22′ 699′′ E O. cinctipes
29. Ongoya Forest Reserve KwaZulu-Natal 5 28° 51′ 569′′ S 31° 38′ 996′′ E O. cinctipes
30. Ngome Forest KwaZulu-Natal 3 27° 49′ 448′′ S 31° 25′ 047′′ E O. cinctipes
31. Uitsoek Forest Plantation Mpumalanga 4 25° 16′ 603′′ S 30° 33′ 088′′ E O. cinctipes
32. Buffelskloof Nature Reserve Mpumalanga 4 25° 18′ 040′′ S 30° 30′ 581′′ E O. cinctipes
33. Mount Shiba Nature Reserve Mpumalanga 1 24° 56′ 360′′ S 30° 42′ 545′′ E O. cinctipes
34. Graskop Mpumalanga 5 24° 52′ 588′′ S 30° 45′ 288′′ E O. cinctipes
35. Mariepskop Forest Mpumalanga 2 24° 34′ 077′′ S 30° 50′ 683′′ E O. cinctipes
Total number of specimens 122

24
Figure 2. List of localities where Opisthopatus specimens were collected. Black circles represent O. cinctipes populations,
while the white triangle and the pink square represent the two single localities for O. herbertorum and O. roseus respectively.
Locality 1) Graaff-Reinet (Camdeboo Nature Reserve), 2) Suurberg (Olifantsnek Pass), 3) Katberg, 4) Kleinemonde River, 5)
Kap River Nature Reserve, 6) Baziya, 7) Nocu, 8) Jenca Valley, 9) Port Saint Johns, 10) Mount Curry Nature Reserve
(Kokstad), 11) Ngele Forest (Kokstad), 12) Oribi Gorge Nature Reserve, 13) Garden Castle Nature Reserve, 14) Kamberg
Nature Reserve, 15) Highmoor Nature Reserve, 16) Injasuthi Nature Reserve, 17) Monks Cowl Nature reserve 18) Cathedral
Peak Nature Reserve, 19) Royal Natal Nature Reserve, 20) Oliviershoek Pass, 21) Ixopo (Qunu Falls), 22) Karkloof Falls,
23) Vernon Crookes Nature Reserve, 24) Umkomaas, 25) Krantzkloof Nature Reserve, 26) Pigeon Valley Nature Reserve,
27) Nkandla Forest Reserve, 28) Entumeni Forest Nature Reserve, 29) Ongoya Forest Reserve, 30) Ngome Forest
(Ntandeka Wilderness), 31) Uitsoek Forest Plantation, 32) Buffelskloof Nature Reserve, 33) Mount Shiba Nature Reserve,
34) Graskop and 35) Mariepskop Forest.

25
2.3: Phylogenetic analysis
Sequences were checked for base ambiguities in Sequence Navigator (Applied Biosystems) and a
consensus sequence was created. The protein coding COI sequences were manually aligned. For 12S
rRNA, 16S rRNA and 18S rRNA, sequences were aligned in Clustal X (Thompson et al., 1997) using
the default parameters of the program and further adjusted manually. Evolutionary relationships within
Opisthopatus were determined using Bayesian analysis as well as Maximum Parsimony (MP) and
Maximum Likelihood (ML) optimality criterion. Maximum Parsimony (MP) and Maximum Likelihood (ML)
optimality criterion analysis were executed in PAUP*4 version beta 10 (Swofford, 2002). Bayesian
inferences were used to investigate optimal tree space using the program MRBAYES 3.0b4 (Ronquist
and Huelsenbeck, 2003) for the large COI and 12S rRNA data set as well as the total evidence analysis.
MODELTEST, version 3.06 (Posada and Crandall, 1998) was used to obtain the best-fit substitution
model for each gene locus for the partitioned Bayesian analysis. The best-fit maximum likelihood score
was chosen using the Akaike information criterion (AIC) (Akaike, 1973) since this has been
demonstrated to reduce the number of parameters that contribute little to describing the data by
penalizing more complex models (Nylander et al., 2004). The substitution models calculated using
MODELTEST were used for the partitioned analysis of the combined COI and 12S rRNA. For each
Bayesian analysis 10 Monte Carlo Markov chains were run, with each chain starting from a random tree
and 5 million generations generated, sampling from the chain every 1000th tree. This was done for each
of the gene fragment separately and then repeated for the combined data for all samples. A 50%
majority rule consensus tree was generated from the trees retained (after the burn-in trees were
discarded); with posterior probabilities for each node estimated by the percentage of time the node was
recovered. Posterior probabilities (pP) of < 0.95 were regarded as poorly supported.
Data sets from the mitochondrial gene loci (COI, 12S rRNA and 16S rRNA) were combined into a single
reduced data matrix using a single representative sample per locality and taxon. A partitioned Bayesian
analysis and MP analysis was conducted on this reduced total evidence data set. For the MP analysis,
trees were generated using the heuristic search option with tree bisection and reconnection (TBR)
branch swapping using 100 random taxon stepwise additions and gaps were executed as characters.
Phylogenetic confidence in the nodes recovered from MP analysis was estimated by bootstrap analysis
of 1000 pseudo-replicates of data sets (Felsenstein, 1985). Bootstrap values for nodes of < 70% were
regarded as poorly resolved and those of > 70% were treated as strongly supported. Bayesian, MP and
ML analysis were conducted on the reduced combined mtDNA and nDNA (COI, 12S rRNA, 16S rRNA
and 18S rRNA) data matrix using a single representative sample per locality and taxon. A partition
homogeneity test was also performed separately on the respective combined DNA data sets as
implemented in PAUP*4 version beta 10, to test whether the data sets can be combined. All analysis

26
was performed exclusively on the reduced combined mtDNA and nDNA (COI, 12S rRNA, 16S rRNA
and 18S rRNA) sequence data. The substitution models calculated using MODELTEST were used for
the partitioned Bayesian analysis of the combined mtDNA and nDNA (COI, 12S rRNA, 16S rRNA and
18S rRNA) sequence data. A substitution model was calculated for the mtDNA and nDNA combined
data set (since we had a reduced data set with one sample per locality) using MODELTEST. The
calculated substitution model for the combined mtDNA and nDNA was used for the ML analysis. For the
ML analysis, heuristic searches with 100 random additions of taxa were also performed. Uncorrected
sequence divergence values were calculated in PAUP.
Outgroup selection
The two South African velvet worm genera are not sister taxa (Daniels et al., 2009). Instead
Peripatopsis appears to be closely related to Metaperipatus from Chile (Allwood et al., 2009), with
Opisthopatus basal to this clade. However, the relationship between Peripatopsis and Metaperipatus is
poorly supported. Hence two Chilean Metaperipatus species M. blainvillei and M. inae were used as
outgroups.
2.4: Population genetic structure analysis
Population genetic structure analyses were performed on the COI and 12S rRNA combined mtDNA loci
using ARLEQUIN version 3.01 (Schneider et al., 2005). Standard diversity indices, including number of
haplotypes (Nh), haplotypic diversity (h), nucleotide diversity (π), number of polymorphic sites (Np) and
average number of pairwise differences were used to assess diversity within each population. The same
program was used to calculate the pairwise genetic distances (FST) among populations to investigate
genetic exchange between widespread populations of O. cinctipes. Their significance was calculated by
performing 10,000 permutations of the dataset (Pérez-Portela and Turon, 2008). To examine
hierarchical population structure, analysis of molecular variance (AMOVA) was performed by pooling the
populations from different locations into geographic groups, as well as on separate populations. We
executed 16,000 permutations to guarantee having less than 1% difference with the exact probability in
99% of cases and use our prior expectation of a genetic division between populations. To determine the
history of effective population, Tajima's D-test (Tajima, 1989) was used.
2.5: TCS network
Haplotype networks were constructed using TCS version 1.18 (Clement et al., 2000), which implements
the statistical parsimony procedure (Templeton et al., 1992; Crandall, 1994) with a 95% parsimony
probability. However, due to the fact that we observed no shared haplotypes between localities we were
unable to use Nested Clade Analysis on our combined 12S rRNA and COI data set.

27
2.6: Divergence time estimation
To infer divergence times between Opisthopatus cinctipes clades, the total evidence DNA sequence
data, (COI, 12S rRNA, 16S rRNA and 18S rRNA) was used. Divergence time estimation was performed
in a Bayesian framework, which employs a probabilistic model to define rates of molecular sequence
evolution of lineages over time and uses Markov Chain Monte Carlo (MCMC) method to derive clade
ages as executed in the programme BEAST (Bayesian Evolutionary Analysis by Sampling Trees) v1.5.1
(Drummond and Rambaut, 2007). We designed this analysis based on the recent biogeographic study
by Allwood et al. (2009). We employed a relaxed molecular clock model with uncorrelated rates drawn
from a lognormal distribution (Drummond et al., 2006). The following prior distribution parameters were
applied; coefficient of variation (exponential mean = 1.0), covariance (exponential mean = 1.0), alpha
shape for the gamma distribution of among site rate variation (exponential mean = 1.0), proportion of
invariable sites (uniform 0 - 1.0), mean rate (exponential mean = 1.0). Posterior distributions of
parameters were estimated with two independent MCMC analysis of 10 million generations each,
following a burn-in of 1 000 generations, which yielded similar results. TRACER v1.4 (Rambaut and
Drummond, 2007) was used to monitor the convergence of the two chains and diagnostic analysis of
the MCMC output of BEAST. Tree Annotator v1.5.1 (Drummond and Rambaut, 2007) was used to
summarize the information from sampled trees produced by BEAST onto a single output tree. The
output tree from Tree Annotator was analysed using the programme FigTREE V.1.2.3 (Rambaut, 2006).
Calibrations
With the lack of distinct vicariance events for Opisthopatus cinctipes and the absence of fossil data for
the southern hemisphere Onychophora the palaegeographic date of continental fragmentation between
Africa and South America dated at 135 Million years ago (Mya) (Sanmartín and Ronquist, 2005) and the
divergence of the two Chilean Metaperipatus (20 Mya, obtained from Allwood et al., 2009) and South
African Peripatopsis were used as calibration points (Allwood et al., 2009). Continental drift is thought to
have commenced 135 Mya with all continental connections assumed to have been detached by 105
Mya (McLoughlin, 2001; Torsvik et al., 2009). However, there is some ambiguity as to when the
separation of Africa and South America was initiated (Eagles, 2007; Torsvik et al., 2009).
The Peripatopsidae have a Gondwanan distribution (present in Chile, South Africa, Australia, New
Zealand, and Paupa-New Guinea), suggesting that the separation of Africa and South America may be
a biogeographic factor mapping the current distribution of the fauna (Reid, 1996). We used a
divergence date of between 105 Mya and 135 Mya as the calibration point for the separation between
the Chilean Metaperipatus and the South African Opisthopatus. As applied by Allwood et al., (2009), we
used a normal distribution centered on 120 Mya with a standard deviation of 5 million years for the

28
Chilean Metaperipatus and the South African Opisthopatus. According to this assumption, the split
between the Chilean Metaperipatus and the South African Opisthopatus may have taken place at
anytime between 105 Mya and 135 Mya with equal probability (Allwood et al., 2009). We also calibrated
the node of the split between the two Chilean Metaperipatus species dated at 20 Mya (Allwood et al.,
2009).
2.7: Morphological character analyses
Where possible, at least one male and one female specimen per locality were used for gross
morphological analysis and scanning electron microscopy (SEM), since both sexes have been shown to
have distinct morphological characters (Hamer et al., 1997). A stereomicroscope was used to observe
the following gross morphological characters: number of leg pairs, dominant dorsal body color, distinct
dorsal pattern and the presence of any unique head structures. Images of the dorsal and ventral surface
integument of selected male specimens were captured with a Leica DFC320 digital camera, attached to
a Leica MZ 7.5 stereo microscope and edited using the Leica Application Suite software. These images
were used to investigate potential species delineating differences present in the integument.
For the SEM analysis, the samples were dehydrated and air dried. Specimens were dissected into two
sections that included the head and the posterior section with genitalia. Scanning electron microscopy
was undertaken at the Central Analytical Facility in the Department of Geology at the University of
Stellenbosch using a Leo® 1430VP Scanning Electron Microscope. Prior to imaging the samples were
dried, mounted and coated with a thin layer of gold. Beam conditions during surface analysis were 7 KV
and approximately 1.5 nano ångström, with a working distance of 13 mm and a spot size of 150.
Morphological characters linked with the male genitals, dorsal and ventral papillae and head features
were investigated using SEM. The results of the SEM analysis were used to determine the utility of the
morphological characters at discriminating the potential novel genealogical lineages nested within O.
cinctipes.

29
CHAPTER 3
RESULTS

30
CHAPTER 3
RESULTS
3.1: Combined COI and 12S rRNA data analysis
Exploratory analysis of the two individual mtDNA gene loci (COI and 12S rRNA) using a Bayesian
analysis yielded similar topologies, with good statistical support for the same clades. Since the
mitochondrial DNA is inherited as a single linked locus, the two data sets were combined and a
Bayesian analysis was conducted on the combined mtDNA data for COI and 12S rRNA, for which all
samples were sequenced.
A 610 base pair (bp) fragment of the COI locus was successfully amplified and sequenced for 123
specimens. This included 120 Opisthopatus cinctipes specimens from 33 localities, one O. roseus and
the two outgroup species of Metaperipatus (Table 2). We were unable to amplify the COI locus for O.
herbertorum due to the poor DNA quality of the allotype. Sequences will be deposited in GENBANK at
the termination of this study. The selected substitution model for COI using the AIC criterion was
GTR+I+G (-lnL = 7556.90; AIC = 15133.79). The proportion of invariable sites (I) was 0.46 and alpha,
the shape parameter of the gamma distribution (G) was 0.49. The rate matrix was R(a) [A-C] = 1.63,
R(b) [A-G] = 15.43, R(c) [A-T] = 1.13, R(d) [C-G] = 6.39, R(e) [C-T] = 22.19 and R(f) [G-T] = 1.00. The
base frequency was A = 37.86%, C = 9.25%, G = 8.36%, and T = 44.53%. The COI locus was A and T
rich. Similar results have been reported for other velvet worm genera such as the South African
Peripatopsis
(A = 36.16% and T = 51.78%) (Daniels et al., 2009), the New Zealand Peripatoides (A = 30.0% and
T = 43.30%) (Trewick, 2000), and among selected Australian velvet worm genera (A = 40% and T =
30%) (Gleeson et al., 1998) and other invertebrates (Simon et al., 1994; Dowton and Austin, 1997;
Whitfield and Cameron, 1998; Mardulyn and Whitfield, 1999; Baker et al., 2004). A chi squared (χ2) test
showed no significant variation in base composition among sequences (χ2 = 384.25; df = 400; p > 0.05).
For 12S rRNA, we successfully amplified and sequenced a 331bp fragment for 124 specimens that
included 120 ingroup O. cinctipes specimens from 33 localities, one O. herbertorum, one O. roseus and
the two outgroup species (Table 2). Highly variable loop regions that could not be aligned with
confidence were excluded from the analysis, resulting in a 281bp fragment. Sequences will be
deposited in GENBANK at the termination of this study. The selected substitution model using the AIC
criterion was HKY+I+G (-lnL = 4531.55; AIC =9077.66) (Hasegawa et al., 1985), I was 0.13 and G was
0.67. The base frequency was A = 42.00%, C = 5.30%, G = 7.48% and T = 45.23%.

31
Table 2: Locations where samples of Opisthopatus have been collected and the number of specimens
sequenced for each gene region.
Gene region sequenced
Locality 12S rRNA COI 16S rRNA 18S rRNA
1. Graaff-Reinet 4 4 1 1
2. Suurberg 5 5 1 1
3. Katberg 5 5 1 1
4. Kleinemonde River 1 1 0 1
5. Kap River Nature Reserve 3 3 1 1
6. Baziya 5 5 1 1
7. Nocu 6 6 1 1
8. Jenca Valley 1 1 1 1
9. Port Saint Johns 5 5 1 1
10. Mount Curry Nature Reserve 1 0 0 0
11. Ngele Forest 1 1 1 1
12. Oribi Gorge Nature Reserve 5 5 1 1
13. Garden Castle Nature Reserve 1 1 0 1
14. Kamberg Nature Reserve 5 5 1 1
15. Highmoor Nature Reserve 3 3 1 1
16. Injasuthi Nature Reserve 1 1 1 1
17. Monks Cowl Nature Reserve 5 5 0 1
18. Cathedral Peak Nature Reserve 6 6 1 1
19. Royal Natal Nature Reserve 6 6 1 1
20. Oliviershoek Pass 2 2 1 1
21. Ixopo (Qunu Falls) 4 4 1 1
22. Karkloof Falls 1 1 1 1
23. Vernon Crookes Nature Reserve 5 5 1 1
24. Umkomaas 1 1 1 1
25. Krantzkloof Nature Reserve 5 5 1 1
26. Pigeon Valley Nature Reserve 1 1 1 1
27. Nkandla Forest Reserve 5 5 1 1

32
Table 2: continues.
Gene region sequenced
Locality 12S rRNA COI 16S rRNA 18S rRNA
28. Entumeni Forest Nature Reserve 5 5 1 1
29. Ongoya Forest Reserve 5 5 1 1
30. Ngome Forest 3 3 1 1
31. Uitsoek Forest Plantation 4 4 1 1
32. Buffelskloof Nature Reserve 4 4 1 1
33. Mount Shiba Nature Reserve 1 1 1 1
34. Graskop 5 5 1 1
35. Mariepskop Forest 2 2 1 1
Total number of specimens 122 121 32 35

33
The 12S rRNA locus like COI was also A-T rich. Similar results have been reported for the 12S rRNA in
other velvet worm genera such as Peripatopsis (A = 47.48% and T = 38.47%) (Daniels et al., 2009) and
Planipapillus (A = 39.00% and T = 43.40%) (Rockman et al., 2001) and other invertebrate taxa
(Lydeard, 2000; Jerry et al., 2001; Wetzer, 2001; Gouws et al., 2004; Munasinghe et al., 2004; Suarez-
Martinez et al., 2005; Murphy et al., 2006; Puslednik and Serb, 2008). A chi squared (χ2) test showed
that there was no significant variation in base composition among sequences (χ2 = 143.94; df = 372; p >
0.05).
The combined mtDNA (for all the samples sequenced for COI and 12S rRNA) data yielded a total of 891
bp. The Bayesian topology retrieved the monophyly of Opisthopatus with strong statistical support (1.00
pP) and revealed several distinct clades within O. cinctipes with good statistical support (> 0.95 pP)
(Fig. 3). The tree topology was characterized by short internal branches with poor nodal support and
long terminal branches with good statistical support, indicative of a rapid divergence and historical
isolation between O. cinctipes localities. In the Drakensberg Mountains we observed two genetically
distinct, distantly related clades, comprising samples from the northern and southern Drakensberg
Mountain regions. The northern Drakensberg clade comprised specimens from Karkloof Falls, Injasuthi
Nature Reserve, Oliviershoek Pass, Royal Natal Nature Reserve, Cathedral Peak Nature Reserve and
Monks Cowl Nature Reserve with strong statistical support (1.00 pP). These northern Drakensberg
samples were sister to samples from Ngome Forest Nature Reserve in the north east of KwaZulu-Natal
with strong statistical support (1.00 pP). The northern Drakensberg clade was sister to samples from
KwaZulu-Natal (Nkandla Forest Nature Reserve), Mpumalanga (Graskop and Mariepskop) and the
Eastern Cape (Baziya, Jenca Valley and Nocu) with poor statistical support. O. roseus (Ngele forest,
Kokstad) was basal to a clade comprising samples from the southern Drakensberg Mountains (Kamberg
Nature Reserve and Highmoor Nature Reserve) with O. herbertorum (Mount Curry Nature Reserve,
Kokstad) nested amongst these southern Drakensberg specimens. The latter clade was sister to
specimens from Garden Castle Nature Reserve, the remaining southern Drakensberg locality. In the
Eastern Cape interior we observed an additional clade that was sister to specimens from Mpumalanga
(north eastern Drakensberg). This clade comprised the Graaff-Reneit specimens (Eastern Cape) (1.00
pP) sister to specimens from Buffelskloof Nature Reserve, Uitsoek Forest Plantation and Mount Shiba
Nature Reserve in Mpumalanga (north eastern Drakensberg), albeit with poor statistical support.

34
Suurberg (N= 2)
Katberg (N = 5)
Kap RiverNR(N= 3)
Suurberg(N = 3)
Kleinemonde River(N = 1)
Graaff-Reinet (N = 4)
Mount Shiba NR(N = 1)
Uitsoek Forest (N= 4)
Buffelskloof NR(N =4)
Ixopo(N = 4)
VernonCrookes NR(N= 5)
Port Saint Johns (N= 5)
Oribi Gorge NR (N= 5)
Umkomaas (N= 1)
Ongoya Forest NR(N =5)
Nkandla Forest NR(N =2)
Entumeni Forest NR (N=5)
Krantzkloof NR (N = 5)
Pigeon Valley (N= 1)
Ngome Forest NR (N = 3)
Injasuthi (N= 1)
Cathedral Peak NR (N= 6)
Monks CowlNR (N= 5)
Oliviershoek Pass (N = 2)
Royal Natal NR (N= 3)
Royal NatalNR (N= 3)
Karkloof (N= 1)
Nkandla Forest NR(N= 3)
Graskop( N= 5)
Mariepskop Forest ( N = 2)
Jenca Valley (N = 1)
Nocu (N= 3)
Baziya (N=2)
Baziya (N= 3)
Nocu (N= 2)
Nocu ( N = 1)
Garden Castle NR(N =1)
Kamberg NR (N = 5)
Highmoor NR(N = 3)
O. herbertorum
O. roseusM. inaeM. blainvillei
10 Changes
1.00
1.00
100
Eastern Cape
Eastern Cape
Eastern Cape
KwaZulu-Natal
northern Drakensberg
KwaZulu-Natal
(IOCB)
Mpumalanga
north eastern Drakensberg
KwaZulu-Natal
KwaZulu-Natal
Mpumalanga
KwaZulu-Natal
southern Drakensberg
1.00
1.00
1.001.00
1.001.00
1.00
1.00
1.00
1.00
1.001.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00
1.00 1.00
1.00
0.98
0.98
0.99
0.99
0.99
1.00
Figure 3. Combined COI and 12S rRNA mtDNA Bayesian topology for Opisthopatus. Posterior
probabilities > 0.95 pP are shown and are considered as statistically well supported. An N next to a
sample locality indicates the number of samples sequenced for that locality.

35
The latter samples from Mpumalanga formed a statistically well-supported clade (1.00 pP). Clade two
was comprised of samples from Nocu, Baziya and Jenca Valley from the Eastern Cape (1.00 pP) that
were retrieved as sister to samples from Graskop and Mariepskop Forest (1.00 pP) in Mpumalanga,
with poor statistical support. Furthermore, in the Eastern Cape we observed a clade that comprised
specimens from Suurberg, Kap River Nature Reserve, Katberg, and Kleinemonde River with strong
statistical support (1.00 pP).
Specimens from the KwaZulu-Natal Indian Ocean Coastal Belt (IOCB) formed a well resolved clade with
good statistical support (1.00 pP). Within the IOCB clade we observed three distinct subclades.
Subclade one comprised samples from Vernon Crookes Nature Reserve, Port Saint Johns, Oribi Gorge
Nature Reserve and Umkomaas with strong statistical support (1.00 pP); subclade two comprised
samples from Ongoya Forest Nature Reserve, Nkandla Forest Nature Reserve and Entumeni Forest
Nature Reserve with strong statistical support (1.00 pP); while subclade three comprised samples from
Krantzkloof Nature Reserve sister to Pigeon Valley Nature Reserve with strong statistical support (1.00
pP). The IOCB clade was sister to specimens from Ixopo (< 0.95 pP) with poor statistical support. These
results revealed that specimens from the IOCB were generally closely related (at least in KwaZulu-
Natal) whilst specimens from the Afromontane forest localities were genetically highly distinct. These
findings suggest that O. cinctipes may be comprised of several cryptic divergent operational taxonomic
lineages, a fact underscored by the pronounced sequence divergence values.
The uncorrected pairwise sequence divergence values between O. cinctipes localities for the COI locus
were high ranging from 3.20% to 19.50% while within sampled sites sequence divergence values were
low (< 1.00%), except for Nkandla Nature Reserve and Royal Natal Nature Reserve where the mean
sequence divergence values were 14.00% and 12.00% respectively. The mean uncorrected pairwise
difference among O. cinctipes localities was 15.36% for COI. Such high levels of sequence divergence
values within a single species are remarkable. Lower levels of sequence divergence have been reported
for other velvet worm species. For example, sequence divergence values among Australian
Planipapillus species ranged from 1.10% to 11.60% (Rockman et al., 2001), for Ooperipatus species
divergence values ranged from 6.50% to 12.60% (Gleeson et al., 1998) whereas sequence divergence
values between nominal South African Peripatopsis species ranged from 6.00% to 13.50% (Daniels et
al., 2009). Among the New Zealand Peripatoides, genetic distances ranged from 6.00% to 11.00%
between taxa (Trewick, 1999). Similarly, Sands and Sunnucks (2003) found between 10.00% to 11.00%
sequence divergence values amongst localities of the Australian velvet worm Phallocephale
tallagandensis. Gleeson et al. (1998) reported a maximum sequence divergence of 20.6% among

36
selected Australian velvet worm genera for the COI gene locus. Higher levels of sequence divergence
values for COI have also been reported for other sedentary invertebrate taxa (Hogg et al., 2006; Boyer
et al., 2007).
The uncorrected pairwise sequence divergence values between localities for the 12S rRNA locus were
relatively high and ranged from 3.20% to 19.50%, while within localities the sequence divergence values
were low (< 7.00%). Sequence divergence values were notably high within Nkandla Forest Nature
Reserve and Royal Natal Nature Reserve where sequence divergence values were > 10.00% within
each locality. The mean sequence divergence value between all sampled localities was 18.11%. Lower
levels of sequence divergence have been reported for other velvet worm species. For example,
sequence divergence among Australian Planipapillus species ranged from 2.90% to 4.50% (Rockman et
al., 2001) whereas the divergence between Peripatopsis species ranged from 5.00% to 11.00% (Daniels
et al., 2009). Similar results were reported for other ancient Gondwanan lineages such as freshwater
crayfish and freshwater isopods. For example, pairwise sequence divergence values for the Australian
freshwater crayfish genus Cherax ranged from 2.6% to 23.2% (Munasinghe et al., 2004). Gouws et al.
(2004) found sequence divergence values as high as 11.01% among the South African freshwater
isopod Mesamphisopus capensis localities. The divergence values we observed between O. cinctipes
clades were generally higher than what was reported between congeneric velvet worm taxa. These
results provide further corroborative evidence for cryptic speciation within O. cinctipes.
3.2: Population genetics and demographic statistics
The haplotype network generated using TCS for O. cinctipes for the combined mtDNA analysis (COI
and 12S rRNA) revealed a total of 91 haplotypes for 120 O. cinctipes specimens. The high divergences
between sampled localities prevented the nesting of specimens into a single network using TCS, at 95%
or 90% confidence. The number of haplotypes (Nh) within a locality ranged from one to five (Table 3).
Most localities were genetically isolated as evident from the lack of shared haplotypes between localities
suggesting the absence of gene flow amongst O. cinctipes sample localities. Eight of the sampled
localities (Suurberg, Baziya, Oribi Gorge Nature Reserve, Monks Cowl Nature Reserve, Ixopo, Nkandla
Forest Nature Reserve, Buffelskloof Nature Reserve and Mariepskop Forest) had haplotypic diversity
(h) values of 1.00, indicating that there were no shared haplotypes within these localities (Table 3). The
number of polymorphic sites (Np) within localities was generally low except for Suurberg, Baziya, Nocu,
Royal Natal Nature Reserve and Nkandla Forest Nature Reserve where the Np was high. The levels of
nucleotide diversity (πn) were generally low (Table 3).

37
Table 3: Diversity measures for O. cinctipes localities with locality numbers corresponding to those in
Figure 2, sample size (N), number of haplotypes (Nh), number of polymorphic sites (Np), haplotype
diversity (h) and nucleotide diversity (πn). NA indicates Not Applicable.
Population N Nh Np h πn
1. Graaff-Reinet 4 3 2 0.8333 ± 0.2224 0.001282 ± 0.001216
2. Suurberg 5 5 84 1.0000 ± 0.1265 0.054645 ± 0.033537
3. Katberg 5 4 17 0.9000 ± 0.1610 0.008123 ± 0.005353
4. Kleinemonde River 1 1 NA NA NA
5. Kap River Nature Reserve 3 2 12 0.6667 ± 0.3143 0.008782 ± 0.007019
6. Baziya 5 5 64 1.0000 ± 0.1265 0.041099 ± 0.025336
7. Nocu 5 4 108 0.8667 ± 0.1291 0.050748 ± 0.029739
8. Jenca Valley 1 1 NA NA NA
9. Port Saint Johns 5 2 6 0.4000 ± 0.2373 0.002637 ± 0.002000
12. Oribi Gorge Nature Reserve 5 5 6 1.0000 ± 0.1265 0.002637 ± 0.002000
13. Garden Castle Nature Reserve 1 1 NA NA NA
14. Kamberg Nature Reserve 4 4 5 0.9000 ± 0.1610 0.002646 ± 0.002006
15. Highmoor Nature Reserve 3 2 26 0.6667 ± 0.3143 0.019132 ± 0.014745
16. Injasuthi Nature Reserve 1 1 NA NA NA
17. Monks Cowl Nature Reserve 5 5 20 1.0000 ± 0.1265 0.009956 ± 0.006469
18. Cathedral Peak Nature Reserve 6 5 25 0.9333 ± 0.1217 0.010018 ± 0.006215
19. Royal Natal Nature Reserve 5 3 84 0.7333 ± 0.1552 0.054070 ± 0.031661
20. Oliviershoek Pass 2 2 5 0.0000 ± 0.5000 0.005531 ± 0.006059
21. Ixopo (Qunu Falls) 4 4 9 1.0000 ± 0.1768 0.005311 ± 0.003906
22. Karkloof Falls 1 1 NA NA NA
23. Vernon Crookes Nature Reserve 5 3 4 0.7000 ± 0.2184 0.001758 ± 0.001449
24. Umkomaas 1 1 NA NA NA
25. Krantzkloof Nature Reserve 5 2 1 0.4000 ± 0.2373 0.000439 ± 0.000558
26. Pigeon Valley Nature Reserve 1 1 NA NA NA

38
Table 3: continues
Population N Nh Np h πn
27. Nkandla Forest Nature Reserve 5 5 160 1.0000 ± 0.1265 0.091886 ± 0.056091
28. Entumeni Forest Nature Reserve 5 3 4 0.7000 ± 0.2184 0.001758 ± 0.001449
29. Ongoya Forest Reserve 5 3 5 0.7000 ± 0.2184 0.002637 ± 0.002000
30. Ngome Forest 3 1 NA NA NA
31. Uitsoek Forest Plantation 4 3 15 0.8333 ± 0.2224 0.008637 ± 0.006088
32. Buffelskloof Nature Reserve 4 4 4 1.0000 ± 0.1768 0.02205 ± 0.001850
33. Mount Shiba Nature Reserve 1 1 NA NA NA
34. Graskop 5 2 2 0.6000 ±0.1753 0.001345 ± 0.001191
35. Mariepskop Forest 2 2 2 1.0000 ± 0.5000 0.002413 ± 0.002955

39
Results show that there are high levels of genetic diversity within localities from Suurberg, Baziya, Nocu,
Highmoor Nature Reserve, Cathedral Peak Nature Reserve, Royal Natal Nature Reserve, Nkandla
Forest Nature Reserve and Buffelskloof Nature Reserve (Table 3). AMOVA results revealed that (ΦST)
89.31% of the genetic variation occurred amongst localities (Va = 89.31%, df = 32, sum of squares =
7706.93, variance component = 64.60, p < 0.01) whilst 10.69% of variation was present within localities
(Vb = 10.69%, df = 87, sum of squares = 672.02, variance component = 7.73). Highly significant FST
values were generally observed across sampled localities (Table 4). These results are indicative of an
extensive genetic structure within O. cinctipes. Tajima’s D value was 0.83 over all localities sampled.
This positive value implies a decrease in population size and/or balancing selection.
3.3: Combined COI, 12S rRNA and 16S rRNA mtDNA data analysis
A 477 base pair (bp) fragment of the 16S rRNA locus was successfully amplified and sequenced for 33
specimens that represented a single sample per locality. We were unable to amplify the 16S rRNA gene
locus for O. herbertorum as well as O. cinctipes samples from the following three localities: Katberg,
Garden Castle Nature Reserve and Monks Cowl Nature Reserve. These localities were coded as
absent for the combined mtDNA evidence analysis. The 16S rRNA sequences will be deposited in
GENBANK at the termination of the present study.
A Bayesian Inference (BI) and Maximum Parsimony (MP) analysis was conducted on the reduced
mtDNA data set using a single representative sample per locality for COI, 12S rRNA and 16S rRNA. For
the 16S rRNA we excluded highly variable loop regions that could not be aligned with confidence hence
322bp of the amplified gene locus were used for the combined mtDNA analysis. The combined mtDNA
data yielded a total of 1253bp. The recalculated substitution model for the reduced COI gene locus data
set using the AIC criteria was TMV+I+G (-lnL = 6488.14; AIC = 12994.27). The rate matrix was R(a) [A-
C] = 0.39, R(b) [A-G] = 14.05, R(c) [A-T] = 0.73, R(d) [C-G] = 5.48, R(e) [C-T] = 14.05 and R(f) [G-T] =
1.00, I was 0.47 and G was 0.45. The base frequency for the gene was A = 37.48%, C = 9.73%, G =
7.68% and T = 45.10%. The recalculated substitution model for the reduced 12S rRNA data set using
the AIC criterion was HKY+G (-lnL = 3279.38; AIC = 6568.77). The rate matrix was R(a) [A-C] = 0.39,
R(b) [A-G] = 14.05, R(c) [A-T] = 0.73, R(d) [C-G] = 5.48, R(e) [C-T] = 14.05 and R(f) [G-T] = 1.00 and G
was 0.42. The base frequency for the gene was A = 42.22%, C = 6.14%, G = 8.67%, and T = 42.98%.
For the 16S rRNA gene locus the selected substitution model using the AIC criterion was TMV+G (-lnL
= 2760.32; AIC = 5536.64). The rate matrix was R(a) [A-C] = 3.09, R(b) [A-G] = 10.35, R(c) [A-T] = 5.21,
R(d) [C-G] = 3.82, R(e) [C-T] = 10.35 and R(f) [G-T] = 1.00 and G was 0.43. The base frequency was A
= 33.62%, C = 11.75%, G = 16.25%, and T = 38.38%.

40
Table 4: Pairwise FST values among sampled O. cinctipes localities. Comparisons that were significant at the p < 0.05 level are indicated by asterisks.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
1 -
2 0.728 -
3 0.736* 0.765* -
4 0.816* 1.000* 0.827* -
5 0.831* 0.986* 0.822* 0.991* -
6 0.832* 0.945* 0.844* 0.937* 0.961* -
7 0.841* 0.991* 0.831* 0.994* 0.975* 0.963* -
8 0.755* 0.809* 0.209* 0.867* 0.861* 0.877* 0.864* -
9 0.840* 0.989* 0.836* 0.993* 0.987* 0.958* 0.989* 0.877* -
10 0.760* 0.988* 0.764* 0.996* 0.984* 0.941* 0.989* 0.826* 0.988* -
11 0.845* 0.976* 0.83* 0.986* 0.979* 0.961* 0.981* 0.866* 0.984* 0.976* -
12 0.803* 0.962* 0.852* 0.973* 0.973* 0.951* 0.973* 0.881* 0.971* 0.962* 0.968* -
13 0.856* 0.993* 0.841* 0.995* 0.988* 0.959* 0.991* 0.889* 0.991* 0.933* 0.985* 0.976* -
14 0.722 1.000 0.065 1.000 0.983 0.949 0.989 0.100 0.989 0.988 0.972 0.960 0.993 -
15 0.704 1.000 0.752 1.000 0.985 0.865 0.990 0.802 0.987 0.986 0.976 0.956 0.992 1.000 -
16 0.265 1.000 0.745 1.000 0.984 0.945 0.989 0.790 0.989 0.988 0.975 0.956 0.993 1.000 1.000 -
17 0.743 0.970 0.786* 0.984 0.983* 0.886* 0.986* 0.832* 0.983 0.973 0.974 0.958* 0.986* 0.973 0.939 0.968
18 0.823* 0.993 0.800* 0.996* 0.987* 0.961* 0.990* 0.847* 0.990* 0.991 0.983* 0.972* 0.992* 0.992 0.993 0.992
19 0.840* 0.985 0.826* 0.990* 0.972* 0.960* 0.928* 0.861* 0.987* 0.985* 0.979* 0.971* 0.988* 0.984 0.984 0.984
20 0.814* 0.948 0.833* 0.943* 0.965* 0.793* 0.966* 0.868* 0.961* 0.944* 0.963* 0.951* 0.964* 0.950 0.873 0.943
21 0.839* 0.986 0.828* 0.991* 0.969* 0.961* 0.916* 0.860* 0.987* 0.984* 0.979* 0.971* 0.988* 0.984 0.985 0.984
22 0.612* 0.957 0.815* 0.977 0.974* 0.944* 0.978* 0.851* 0.975* 0.964 0.970* 0.923* 0.980* 0.956 0.950 0.909
23 0.817* 0.954 0.815* 0.971* 0.971* 0.941* 0.974* 0.854* 0.905* 0.962 0.970* 0.954* 0.976* 0.953 0.950 0.955
24 0.833* 0.991 0.834* 0.994* 0.939* 0.961* 0.979* 0.868* 0.989* 0.988 0.982* 0.975* 0.991* 0.989 0.990 0.989

41
Table 4: continues
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
25 0.608* 0.501 0.623* 0.663* 0.631* 0.682 0.673* 0.631* 0.721* 0.493 0.740* 0.744* 0.668* 0.502 0.405 0.498
26 0.681 1.000 0.716 1.000 0.970 0.941 0.982 0.762 0.987 0.987 0.969 0.953 0.992 1.000 1.000 1.000
27 0.844* 0.998 0.843* 0.999* 0.983* 0.966 0.988* 0.879* 0.993* 0.995* 0.985* 0.976* 0.995* 0.997 0.997 0.997
28 0.699* 0.724 0.738* 0.693* 0.840* 0.674 0.839* 0.757* 0.822* 0.723* 0.839* 0.828* 0.816* 0.743 0.712 0.713
29 0.712 1.000 0.742 1.000 0.986 0.904 0.990 0.795 0.987 0.986 0.976 0.956 0.992 1.000 1.000 1.000
30 0.690 1.000 0.711 1.000 0.970 0.941 0.960 0.750 0.988 0.987 0.970 0.958 0.992 1.000 1.000 1.000
31 0.718 1.000 0.726 1.000 0.986 0.940 0.990 0.778 0.978 0.987 0.976 0.954 0.992 1.000 1.000 1.000
32 0.786* 0.876 0.804* 0.953 0.958* 0.926 0.958* 0.839* 0.953* 0.931 0.950* 0.939* 0.964* 0.913 0.907 0.907
33 0.848* 0.981 0.856* 0.991* 0.985* 0.958 0.987* 0.895* 0.986* 0.985 0.981* 0.970* 0.990* 0.987 0.986 0.986

42
Table 4: continues
17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33
17 -
18 0.986 -
19 0.982* 0.986* -
20 0.900* 0.963* 0.964* -
21 0.982* 0.986* 0.915* 0.964* -
22 0.954 0.977* 0.974* 0.943* 0.975* -
23 0.955 0.967* 0.971* 0.946* 0.971* 0.952* -
24 0.986* 0.990* 0.975* 0.966* 0.974* 0.977* 0.973* -
25 0.547* 0.680* 0.680* 0.665* 0.673* 0.665* 0.706* 0.630* -
26 0.970 0.992 0.974 0.944 0.975 0.952 0.953 0.979 0.381 -
27 0.992* 0.995* 0.985* 0.970* 0.985* 0.983* 0.979* 0.986* 0.691* 0.970 -
28 0.386 0.812* 0.835* 0.654* 0.835* 0.778* 0.804* 0.841* 0.572* 0.726 0.851* -
29 0.944 0.992 0.985 0.907 0.985 0.951 0.950 0.990 0.430 1.000 0.998 0.533 -
30 0.969 0.992 0.935 0.944 0.935 0.952 0.951 0.979 0.363 1.000 0.996 0.713 1.000 -
31 0.969 0.991 0.985 0.941 0.985 0.953 0.905 0.990 0.493 1.000 0.997 0.710 1.000 1.000 -
32 0.921 0.953* 0.951* 0.926* 0.954* 0.927 0.930* 0.959* 0.626* 0.898 0.964* 0.767* 0.892 1.000 0.896 -
33 0.980* 0.988* 0.983* 0.963* 0.984* 0.974* 0.970* 0.987* 0.728* 0.984 0.991* 0.830* 0.984 0.984 0.985 0.739* -
1) Suurberg (Olifantsnek Pass), 2) Garden Castle Nature Reserve, 3) Nocu, 4) Ngome Forest (Ntandeka Wilderness), 5) Ongoya Forest Nature Reserve, 6) Cathedral Peak Nature Reserve, 7) Vernon
Crookes Nature Reserve, 8) Baziya, 9) Buffelskloof Nature Reserve, 10) Mariepskop Forest, 11) Ixopo (Qunu Falls) 12) Katberg, 13) Graskop, 14) Jenca Valley, 15) Injasuthi Nature Reserve, 16)
Kleinemonde River, 17) Oliviershoek Pass, 18) Graaff-Reinet, 19) Oribi Gorge Nature Reserve, 20) Monks Cowl Nature Reserve, 21) Port Saint Johns, 22) Kap River Nature Reserve, 23) Uitsoek
Forest Plantation, 24) Entumeni Forest Nature Reserve, 25) Nkandla Forest Nature Reserve, 26) Pigeon Valley Nature Reserve, 7) Krantzkloof Nature Reserve, 28) Royal Natal Nature Reserve, 29)
Karkloof Falls, 30) Umkomaas, 31) Mount Shiba Nature Reserve, 32) Highmoor Nature Reserve and 33) Kamberg Nature Reserve.

Systematics of a widespread velvet worm species, Opisthopatus cinctipes (Arthropoda: Onychophora)
43
Base composition analysis showed that the sequences were comparable to 16S rRNA sequences from
other invertebrates. The 16S rRNA like the COI and 12S rRNA loci was also A and T rich. Similar results
have been reported for other invertebrates (Mardulyn and Whitfield, 1999; Bond et al., 2001; Bond and
Sierwald, 2002; Bond and Stockman, 2008). A chi squared (χ2) test showed no significant variation in
base composition among sequences (χ2 = 56.27; df = 195; p > 0.05).
All two analytical methods (BI and MP analysis) produced tree topologies that were nearly identical. The
combined reduced mtDNA data (COI, 12S rRNA, and 16S rRNA) set yielded a tree topology that was
congruent with and corroborated the main clades evident from the analysis of the total evidence data set
(COI and 12S rRNA); hence, we only discuss the MP tree topology. A total of 494 parsimony informative
sites were retrieved for the MP analysis and yielded a total of 11 trees, with a tree length of 2303 steps.
The Consistency Index (CI) was 0.36 whilst the Retention Index (RI) was 0.57. The monophyly of
Opisthopatus (Fig. 4) was well supported (100% / 1.00 pP). Within O. cinctipes, most sampled localities
were retrieved as monophyletic lineages with good support, but the species as a whole was paraphyletic
with respect to O. roseus and O. herbertorum. Although deeper nodal relationships were poorly
supported, the phylogeny revealed at least nine distinct clades within O. cinctipes that were statistically
well supported (> 70% / > 0.95 pP). As previously observed on the Bayesian tree topology of the
combined COI and 12S rRNA data, a number of clades that were in close geographic proximity were
retrieved as genealogically distinct. The clade comprising specimens from northern Drakensberg
localities (Karkloof Falls, Injasuthi Nature Reserve, Oliviershoek Pass, Ngome Forest Nature Reserve,
Royal Natal Nature Reserve, Cathedral Peak Nature Reserve and Monks Cowl Nature Reserve) was
again retrieved as genealogically distinct from the southern Drakensberg specimens with good statistical
support (100% / 1.00 pP). Specimens from the southern Drakensberg localities (Kamberg Nature
Reserve and Highmoor Nature Reserve) formed a clade that was retrieved with O. herbertorum nested
amongst these specimens with good statistical support (100% / 1.00 pP). The latter clade was retrieved
as sister to a specimen from Garden Castle Nature Reserve.
Similarly, in the Eastern Cape coast and interior we retrieved three genetically distinct clades identical to
those retrieved on the COI and 12S rRNA Bayesian tree topology. The first clade from the Eastern Cape
coast and interior comprised specimens from Suurberg, Kap River Nature Reserve, Katberg, and
Kleinemonde River with good statistical support (75% / 1.00 pP). The second clade comprised a
specimen from Graaff-Reneit (< 70% / 1.00 pP) that was retrieved as related to specimens from Uitsoek
Forest Plantation, Buffelskloof Nature Reserve, and Mount Shiba Nature Reserve in Mpumalanga
(North eastern Drakensberg) with poor support for the relationship between the two clades.

44
Graaff-Reinet
UitsoekForest
Buffelskloof NR
Mount Shiba NR
Baziya
Nocu
JencaValley
O.roseus
Ixopo
PortSaintJohns
OribiGorge NR
Umkomaas
VernonCrookes NR
Krantzkloof NR
PigeonValley
EntumeniForest NR
Ongoya Forest NR
MonksCowlNR
CathedralPeak NR
Royal Natal NR
OliviershoekPass
Karkloof Falls
NgomeForest NR
NkandlaForest NR
Graskop
MariepskopForest
O. herbetorum
Highmoor NR
KambergNR
GardenCastleNR
Suurberg
KleinemondeRiver
KapRiver NR
Katberg
M. inae
M. blainvillei
50changes
100/ 1.00
100 / 1.00
75/ 1.00
75/NS
100 /1.00
100 / 1.00
90/ 1.00
100/ 1.00
97/ 1.0073/0.98
NS/0.98
100 / 1.00
100/ 1.00
100/ 1.00
100/ 1.00
100 / 1.00
NS / 1.00
Eastern Cape
Eastern Cape
Eastern Cape
Mpumalanga
Mpumalanga
KwaZulu-Natal
KwaZulu-Natal
-
KwaZulu-Natal
(IOCB)
KwaZulu-Natal
KwaZulu-Natal
NS/ 1.00
KwaZulu-Natal
Injasuthi
100 / 1.00
Figure 4. Combined MP topology (COI, 12S rRNA and 16S rRNA mtDNA) for Opisthopatus. Bootstrap
values and posterior probabilities in the range (> 70% / > 0.95 pP) are shown and considered
statistically well supported. NS above nodes denotes clades that are not statistically supported.

45
The latter specimens from Mpumalanga formed a statistically well supported clade (100% / 1.00 pP).
The third clade from the Eastern Cape which comprised specimens from Jenca Valley, Nocu and Baziya
was also retrieved with good statistical support (100% / 1.00 pP) and was retrieved on the MP tree
topology linked to a clade that comprised O. roseus and a specimen from Ixopo. There was no statistical
support for both the relationship between O. roseus and the specimen from Ixopo and the relationship
between the latter clade and the former clades. In contrast, on the Bayesian tree topology the latter
clade was related to a specimen from Ixopo whilst O. roseus was distinct and basal to a clade
comprising the specimens from the southern Drakensberg. Clade three was also retrieved as related to
a clade comprising specimens from localities within the KwaZulu-Natal IOCB (Ongoya Forest Reserve,
Entumeni Forest Nature Reserve, Krantzkloof Nature Reserve, Pigeon Valley Nature Reserve, Vernon
Crookes Nature Reserve, Port Saint Johns, Oribi Gorge Nature Reserve and Umkomaas), that was
retrieved with good statistical support (100% / 1.00 pP). Within this clade the three distinct subclades
that were retrieved on the COI and 12S rRNA Bayesian tree topology were also observed, each with
strong statistical support (100% / 1.00 pP). A clade comprising specimens from Nkandla Nature
Reserve (KwaZulu-Natal), Graskop and Mariepskop Forest (Mpumalanga) was retrieved with good
statistical support (90% / 1.00 pP). Sister relationship between specimens from Graskop and
Mariepskop Forest was statistically well supported (100% / 1.00 pP).
3.4: Nuclear marker data (nDNA).
Ten nDNA loci were tested and these are listed in Table 5. While most of these primer pairs gave a
positive PCR product, they failed to sequence. Most primer sets tested were designed for Australian
Onychophora species (Brower and DeSalle, 1998; Rockman et al., 2001; Colgan et al., 2008; Sands et
al., 2009). The Australian and South African velvet worm species are phylogenetically highly divergent
limiting cross amplification of primer pairs. A partial fragment of the 18S rRNA locus could be
consistently amplified for single representatives of sampled localities. Hence, it was decided to
exclusively focus on this locus as a DNA marker.
3.4.1: 18S rRNA data analysis
A 700 base pair (bp) fragment of the 18S rRNA locus was successfully amplified and sequenced for 36
specimens. This included 33 Opisthopatus cinctipes specimens from 33 localities, one O. roseus and
the two outgroup species of Metaperipatus. It was not possible to amplify this locus for O. herbertorum
due to the poor quality of the DNA extracted from the allotype hence this data were coded as absent
from the analysis. Sequences will be deposited in GENBANK at the termination of this study.

46
Table 5: List of primer sets that were tested in this study
Primer Forward primer Reverse primer Reference
PCR
result
Amplification
quality
Sequencing
product
EPt17 AATTTGAAATCTCTTTTCTACTTCTTCC TTCATATCGGCATTGTTTTCC (Sands et al., 2009) + Multiple bands Poor
FTz intron GTGAGGCTGCTGGAAAAATTC CAAATCCGTTGTCTGTAAATATG (Sands et al., 2009) + Single bands Poor
Wingless AGCTTCCCGAGTGTTAGTGG ACTICGCRCACCARTGGAATGTRCA (Brower and DeSalle,1998) + Multiple bands Poor
Histone ATGGCTCGTACCAAGCAGACVGC ATATCCTTRGGCATRATRGTGAC (Colgan et al., 2008) + Multiple bands Poor
28S ACCCGCTGAATTTAAGCAT TCCGTGTTTCAAGACGG (Hassouna et al., 1984) + Multiple bands Poor
P18L2 GCTTTTGCTCACAAATTATTTGTAAGC ATCCATGCYAATCTCCCACCTCC (Sands et al., 2009) + Multiple bands Poor
P31L2 CCAAGGCATGGACAATGT GCCGGTAGTCGCAATAAC (Sands et al., 2009) + Multiple bands Poor
18S GCGAAAGCATTTGCCAAGAA GCATCACAGACCTGTTATTGC (Giribet et al., 1996) + Single bands Good
ARK1 GCGTTACCAATGAGCGTGTTG AGAACTTGGACTCTGGCGTTGG (Crandall, 2006) + Did not work No product
5.8S CTCRTGGGTCGATGAAGAMC GTTCTTCATCGACCCAYGAG (Lessa and Applebaum, 1993) + Did not work No product

47
There were hypervariable loop regions in the data set that were problematic during alignment hence we
excluded them from the analysis thus we used a 590bp fragment of the amplified gene locus for the
analysis. The selected substitution model for the 18S rRNA analysis using the AIC criterion was GTR+G
(-lnL = 4086.86; AIC = 8191.73), G was 0.47. The rate matrix was R(a) [A-C] = 0.42, R(b) [A-G] = 2.09,
R(c) [A-T] = 0.59, R(d) [C-G] = 1.28, R(e) [C-T] = 2.72 and R(f) [G-T] = 1.00. The base frequency was A
= 20.65%, C = 25.27%, G = 27.84%, and T = 26.25%. The 18S rRNA locus was G and T rich. Similar
high G contents have been observed for other arthropods (Daniels et al., 2006; Wowor et al., 2009) and
other velvet worm species such as the Peripatopsis (Daniels et al., 2009). A chi squared (χ2) test
showed no significant variation in base composition among sequences (χ2 = 85.15; df = 105; p > 0.05).
Tree topologies obtained from BI and MP analysis were congruent and the same clades retrieved from
the analysis of mtDNA were evident. In this regard, the MP tree topology is presented and discussed. A
total of 311 characters were constant within the data set whilst 200 parsimony informative sites were
retrieved for the MP analysis and yielded a total of six trees, with a tree length of 646 steps. CI was 0.66
whilst RI was 0.78. Opisthopatus was retrieved as monophyletic (Fig. 5) with good statistical support
(100% / 1.00 pP). The tree topology was characterized by short internal branches with poor nodal
support and short terminal branches with good statistical support. Deeper node relationships were
retrieved with poor statistical support.
In the Eastern Cape, three distinct clades were retrieved with two of these clades being statistically well
supported. A clade from the Eastern Cape comprising specimens from Katberg, Kap River,
Kleinemonde River and Suurberg was retrieved as basal to a clade comprising specimens from the rest
of the localities sampled in this study with good statistical support (74% / 1.00 pP). The KwaZulu-Natal
(IOCB) clade was retrieved with good statistical support (97% / 1.00 pP) and was comprised of two
subclades as previously observed on the mtDNA topologies (Fig. 3 and Fig. 4). The first subclade
comprised specimens from Vernon Crookes Nature Reserve, Port Saint Johns, Oribi Gorge Nature
Reserve and Umkomaas, whilst the second subclade contained specimens from Ongoya Forest
Reserve, Entumeni Forest Nature Reserve, Krantzkloof Nature Reserve and Pigeon Valley Nature
Reserve. Both subclades had good statistical support (100% / 1.00 pP and 97% / 1.00 Pp respectively).
Basal to the KwaZulu-Natal (IOCB) clade was a clade comprising specimens from the Eastern Cape
(Jenca, Nocu and Baziya). Two distinct distantly related clades from the Drakensberg Mountains were
also observed. These clades comprised specimens from the northern and southern Drakensberg
Mountain regions. The northern Drakensberg clade (Karkloof Falls, Injasuthi Nature Reserve,
Oliviershoek Pass, Ngome Forest Nature Reserve, Royal Natal Nature Reserve, Cathedral Peak Nature

48
Graaff-Reinet
Vernon Crookes NR
OribiGorge NR
Port Saint Johns
Umkomaas
Krantzkloof NR
Pigeon Valley NR
Ongoya Forest NR
Entumeni Forest NR
Nkandla Forest NR
Baziya
Nocu
Jenca
Ixopo
Kamberg NR
Highmoor NR
Garden Castle NR
O. roseus
Uitsoek Forest
Buffelskloof NR
Mt Sheba NR
Injasuthi NR
Cathedral Peak NR
Oliviershoek Pass
Royal Natal NR
Monks Cowl NR
Karkloof Falls
Ngome Forest NR
Mariepskop Forest
Graskop
Suurberg
Kap River NR
Kleinemonde River
Katberg
M.inae
M. blainvillei
10 changes
100 / 1.00
100 / 1.00
74 / 1.00
99 / 1.00
72 / 0.98
100 / 1.00
NS / 0.99
88 / 1.00
100 / 1.00
89 / 0.99
94 / 1.00
96 / 1.00
100 / 1.00
97 / 1.00
96 / 1.00
98 / 1.00
Eastern Cape
Eastern Cape
Eastern Cape
Mpumalanga
KwaZulu-Natal
KwaZulu-Natal
Mpumalanga
KwaZulu-Natal-
KwaZulu-Natal
IOCB
Figure 5. 18S rRNA MP topology for Opisthopatus. Bootstrap values and posterior probabilities in the
range (> 70% / > 0.95 pP) are shown and considered statistically well supported. NS above nodes
denotes clades that are not statistically supported.

49
Reserve and Monks Cowl Nature Reserve) was retrieved with good statistical support on the BI
topology (0.99 pP) whilst there was no support for southern Drakensberg clade (Kamberg Nature
Reserve, Garden Castle Nature Reserve and Highmoor Nature Reserve). Opisthopatus roseus was
retrieved as basal to the southern Drakensberg clade with no statistical support. A clade comprising
specimens from Mpumalanga in the North eastern Drakensberg (Buffelskloof Nature Reserve, Uitsoek
Forest Plantation and Mount Shiba Nature Reserve) was retrieved as closely related to the clade
comprising specimens from southern Drakensberg localities with no statistical support. The northern
Drakensberg clade was sister to a clade comprising specimens from Karkloof Falls and Ngome Forest
Nature Reserve in the North east of KwaZulu-Natal (72% / 0.98 pP). Basal to this clade was the clade
consisting of specimens from Graskop and Mariepskop Forest in Mpumalanga (99% / 1.00 pP).
Generally, similar patterns of relationships as evident on the mtDNA topology were retrieved with a
number of clades that were in close geographic proximity being retrieved as genealogically distinct.
3.4.2: Combined mtDNA and nDNA data analysis
Bayesian Inference (BI), Maximum Parsimony (MP) and Maximum Likelihood (ML) analysis were
conducted on the reduced mtDNA and nDNA data set using a single representative sample per locality
for all four loci (COI, 12S rRNA, 16S rRNA and 18S rRNA). We excluded highly variable loop regions
that could not be aligned with confidence for the 12S rRNA, 16S rRNA and 18S rRNA gene regions. The
combined sequence data yielded a total of 1894bp. For the ML analysis the substitution model selected
for the combined COI, 12S rRNA, 16S rRNA and 18S rRNA using the AIC criterion was TIM+I+G (-lnL =
18248.75; AIC = 36513.49). I was 0.31 and G was 0.70. The rate matrix was R(a) [A-C] = 1.00, R(b) [A-
G] = 5.39, R(c) [A-T] = 3.27, R(d) [C-G] = 3.27, R(e) [C-T] = 7.05 and R(f) [G-T] = 1.00. For BI the
substitution model for COI and 12S rRNA was recalculated using a single sample per locality (results
not shown).
All three analytical methods (BI, MP and ML analysis) yielded near identical tree topologies. The
combined DNA data set yielded a phylogeny that was congruent with and corroborated the main pattern
of clades evident from the analysis of the individual gene regions; hence, we only discuss the MP tree
topology. A total of 731 parsimony informative sites were retrieved for the MP analysis. A single tree
was retrieved, with a tree length of 3331 steps. CI was 0.40 and RI was 0.62. Opisthopatus was
retrieved as a monophyletic lineage (Fig. 6) with good statistical support (100% (MP) / 1.00pP (BI) /
100% (ML)). The O. cinctipes species complex was paraphyletic with respect to O. roseus and O.
herbertorum. These two species were nested amongst O. cinctipes clades. The total evidence tree
topology substantiated the presence of multiple independent lineages nested within O. cinctipes that
correspond with geographically isolated forest patches (Fig. 7).

50
O. roseus
O. herbetorum
Vernon Crookes NR
Oribi Gorge NR
Port Saint Johns
Umkomaas
Ongoya Forest NR
Entumeni Forest NR
Krantzkloof NR
Pigeon Valley
Jenca Valley
Nocu
Baziya
Ixopo
Graaff - Reinet
Graskop
Mariepskop Forest
Nkandla Forest NR
Highmoor NR
Kamberg NR
Garden Castle NR
Uitsoek Forest
Buffelskloof NR
Mount Shiba NR
Cathedral Peak NR
Monks Cowl NR
Injasuthi NR
Oliviershoek Pass
Royal Natal NR
NgomeForest NR
Karkloof Falls
Suurberg
Kleinemonde River
Kap River NR
Katberg
M. inae
M. blainvillei
50 changes
Mpumalanga
KwaZulu-Natal
Eastern Cape
Eastern Cape CLADE 6
Eastern Cape
KwaZulu- Natal
IOCB
KwaZulu-Natal
Mpumalanga
KwaZulu-Natal (southern Drakensberg)
KwaZulu-Natal
KwaZulu-Natal
100 / 1.00
100 / 1.00
100 / 1.00
100 / 1.00
100 / 1.00
100 / 1.00
100 / 1.00
100 / 1.00
100 / 1.00
96 / 1.00
99 / 1.00
98 / NS
88 / 1.00
100 / 1.00
83 / 1.00
95 / 1.00
83 / 0.99
76 / 1.00
99 / 1.00
NS / 1.00
100 / 1.00
100 / 1.00
87 / 0.99
100 / 1.00
MP / BI
ML
NS
CLADE 1
CLADE 2
CLADE 3
CLADE 4
CLADE 5
CLADE 9
CLADE 8
CLADE 7
Figure 6. Total evidence (COI, 12S rRNA, 16S rRNA and 18S rRNA) MP topology for Opisthopatus.
Bootstrap values and posterior probabilities in the range (> 70% / > 0.95 pP) are shown. NS above
nodes denotes poor support. The asterisk sign on each node represents > 70% bootstrap support on
the ML tree topology.

Kunak2010MSc[1][1]

Empfohlen

Empfohlen

Weitere ähnliche Inhalte

Andere mochten auch

Andere mochten auch (17)

Ähnlich wie Kunak2010MSc[1][1]

Ähnlich wie Kunak2010MSc[1][1] (20)

Kunak2010MSc[1][1]