1. Ghosh Lab University of Arizona Department of Chemistry Cloning 101: A Primer

5. All of the important information in one place! pDRAW32 Plasmid maps: pDRAW32

7. Design of the Gene Example, the gene we want: G C D R A S P Y C G We got this from phage display: ggctgcgacagggcgagcccgtactgcggt G C D R A S P Y C G Phage sequence Final sequence for the gene of interest: ggctgcgacagggcgagcccgtactgcggt taa G C D R A S P Y C G * Add a stop codon If you are cloning out of a known plasmid, just use the sequence that you have

9. http://www. bioinformatics .org/sms2/rev_trans.html http://www.entelechon.com/index.php?id=tools/backtranslation&lang=eng or preferably… What if we don’t have the DNA sequence? Design from scratch! (don’t forget about codon usage )

16. Design of the Insert 71 ATGGGCAGCAGCCATCACCATCATCACCAC M G S S H H H H H H SacI AscI SbfI SalI BamHI EcoRI EcoICRI PstI AccI HindIII 101 AGCCA GGATCC GAATTCGAGCTCGGCGCGC CTGCAG GTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A The gene we want: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * BamHI PstI AGCCA GGATCC GAATTCGAGCTCGGCGCGC CTGCAG GTCGACAAGCTTGC S Q D P N S S S A R L Q V D K L A G C D R A S P Y C G * ggctgcgacagggcgagcccgtactgcggttaa AGCCA GGATCC G ggctgcgacagggcgagcccgtactgcggttaa CTGCAG GTCGACAA Be aware of the amber stop codon: TAG Multiple cloning site

17. Design of the Insert Always check and re-check your sequence! ATGGGCAGCA GCCATCACCA TCATCACCAC AGCCA GGATCC G ggctgcgacagggcgagcccgtactgcggttaa CTGCAG GTCGACAA atgggcagcagccatcaccatcatcaccacagcca ggatcc g ggctgcgacagggcgagc M G S S H H H H H H S Q D P G C D R A S ccgtactgcggttaa ctgcag gtcgacaa P Y C G - L Q V D Everything looks good: in frame the whole way! Translate the whole gene

18. The wrong way to do it: AGCCA GGATCC ggctgcgacagggcgagcccgtactgcggttaa CTGCAG GTCGACAAGCTT atgggcagcagccatcaccatcatcaccacagcca ggatcc ggctgcgacagggcgagcc M G S S H H H H H H S Q D P A A T G R A cgtactgcggttaactgcaggtcgacaagctt R T A V N C R S T S Frame shifted = garbage! Design of the Insert The gene is just inserted after the restriction site, which is out of frame with the plasmid-encoded start-codon/His-tag **Some plasmids, for whatever reason, have restriction sites out of frame with the translated gene**

26. Cloning Out an Existing Gene In the example mentioned previously, we would normally use full length overlapping primers, but let’s look at the more common case of having a preexisting gene: gccagcca ggatcc g ggctgcgacagggcgagcccgtactgcggttaa ctgcag gtcgacgc S Q D P G C D R A S P Y C G - L Q V D tgcggcccagccggccatgggctgcgacagggcgagcccgtactgcggtggaggcggtgctgcagcgc A A Q P A M G C D R A S P Y C G G G G A A A Preexisting gene: Goal gene: + Overlap Extra sequence from gene design gccagccaggatccgggctgcgacagg ccgtactgcggttaactgcaggtcgacgc Forward Primer: Design of Reverse Primer:

27. gccagccaggatccgggctgcgacagggcgagcccgtactgcggttaactgcaggtcgacgc S Q D P G C D R A S P Y C G - L Q V D Ordering Primers Forward primer to order: gccagccaggatccg ggctgcgacagg Reverse primer to order: GCGTCGACCTGCAGTTAACCGCAGTACGG Design of Reverse Primer: ccgtactgcggt taactgcaggtcgacgc & http://www.idtdna.com/Home/Home. aspx Now we can order the primers:

28. Vectors and Bacteria Strains An important thing to think about before you start cloning: What vectors/E Coli should I use? pET-Duet pRSF-Duet pCANTAB-5E pMAL pQE-30 Vector BL-21: Protease deficient, stable to toxic proteins, and contains the T7 RNA polymerase gene T7 lac promoter (An E. Coli strain with phage T7 RNA polymerase is necessary) Plac promoter Ptac promoter XL1-Blue: mostly good for DNA isolation/phage display M15(pREP4): tighter regulation of the lac suppressor T5 promoter E Coli strains we use Promoter

29. mRNA lac Expression Regulation lac site Promoter RBS ATG- your gene lac repressor lac site Promoter RBS ATG- your gene RNA polymerase X IPTG (or lactose, etc) IPTG lac site Promoter RBS ATG- your gene Transcription