Outlines and exemplified how bioinformatics is particularily well to facilitate the discovery of oligonucleotide drugs. One hour talk I gave a Aalborg University in 2010.

1. Therapeutic antagonism of microRNAs
Bioinformatics in the
development and
understanding of
oligonucleotide drugs
Morten Lindow
Group leader, Bioinformatics
Santaris Pharma A/S
Aalborg University November 2010

2. Most drugs work on proteins

3. CGCUGUGAGGUG Chemically simple
GUA 1D
…GGGCGACACUCCACCAUGAAU……Fewer cellular compartments
|||||||||||||||
Easy to develop regulator
translation
Chemically diverse
3D
Many types of interactions with ligands
Diverse cellular compartments
Hard to develop regulator

4. Enzyme-directing oligonucleotides
ASOs siRNA miRNA
RNAseH RISC
RISC

5. Designing oligos as RNA regulators
Intelligent design Natural selection
(oligoinformatics)
ASOs siRNAs miRNAs
TargetSurveyor.pl Lindow et al.,
PLoS Comput Biol. 2007
Plant genomes have
7/10 have IC50<5nM
>2000 genomic pre-miR
Conserved across species
structures with
Minimal off-targets
complementarity to
…
mRNA. Just waiting for
the right niche to show up.

6. CGCUGUGAGGUGGUA
|||||||||||||||
CCCCCUGAUGGGGGCGACACUCCACCAUGAAUCACUC
• Vast compound libraries
• Combinatorial chemistry
TargetSurveyor.pl
~2 years
~2 months
• High through put screening on Automated oligosynthesis
primary target
• Specificity screen on related qPCR
receptors
• Tolerability screen
Lead optimization 23 optimized leads
2 in pre-clinical dev
2 in phase 1
1 in phase 2
Clinical development

7. Both Nature and Business make
use of oligonucleotides

8. LNA-antimiR – miravirsen
- an oligo to regulate an oligo
8 LNA,
7 DNA
miravirsen
miR-122
RISC
Inhibits expression

9. Wienholds et al, Science (2005)

10. Antagonism of miR-122 leads to
reduced plasma cholesterol
Single i.v. injection of Three i.v. injections of miravirsen
miravirsen in mice in African green monkeys
Elmen&Lindow et al, Nature 2008
Esau et al, Cell Metab 2006

11. miR-122 and hepatitis C virus
HCV is a single stranded RNA virus
HCV genome resembles an mRNA
170 million infected worldwide
Current treatment often ineffective and
with serious side effects
2x miR-122 binding
sites in 5‟NTR Viral replication
Jopling et al, Science 2005
Elmen&Lindow et al., Nature 2008

12. HCV is the target indication for
miravirsen

13. ? Can miravirsen reduce HCV-load in vivo?
? Can HCV mutate to escape miravirsen treatment?
? What is the physiological role of miR-122?
? Does miravirsen have any off-targets?

14. miravirsen reduces HCV in
chimpanzees
Lanford et al, Science 2010

15. Can HCV mutate to escape
miravirsen treatment?
Direct-acting small molecule inhibitor LNA-antimiR targeting the host factor
of viral RNA polymerase miR-122
Rebound during Rebound 2 weeks after
treatment end of treatment
Period of treatment
Cooper et al, J Hepat, 2009 Lanford et al, Science 2010

16. Deep sequencing of virus from
treated animals
HCV specific primers to amplify miR-122 binding region
454 deep sequencing
73,000 to 214,000 reads at 4 time points
Does frequency of variants change?

17. No evidence of viral escape from
miravirsen!

18. Antagonism of miR-122:
Effects on gene expression
What is the physiological role of miR-122?
Are miR-122 targets upregulated after miravirsen
treatment? Can this be used as an efficacy
endpoint?
Is there a non-sequence specific effect of treatment
with LNA-oligos?
Is there a sequence specific effect of treatmentwith
miravirsen? (off-target effect on mRNAs?)

19. Distance between transcriptomes
5 fat mice treated with miravirsen
5 fat mice treated with 2 mismatch control
5 fat mice treated with saline
Data from Elmen & Lindow et al, Nature 2008

20. Are miR-122 targets upregulated
after miravirsen treatment?
miR-122
RISC
Inhibits expression
On the level of the individual gene only a few targets are significantly upregulated
(n=5) and only with about 25%

21. Sequence and expression analysis
combined yields a miR-signature
Expression analysis Sequence analysis
antimiR
mRNA changes
All ~20 000 genes
Control
predicted
miR-122 targets
for each gene:
log2(antimiR/control)
0 means no change

22. miR-signature is an efficacy endpoint
Null-hypothesis:
Are the distributions of
background and
14503 predicted targets
mRNAs with identical?
no site
Test:
Density
two-sided Kolmogorov-
Smirnov
879 mRNA
with
p=6.60E-27
miR-122 site
0 0
Response to miravirsen treatment
log2(miravirsen/saline)

23. Microarray data from four different experiments
Model Liver Northern Serum cholesterol levels
Monkey
Normal diet
Monkey
High-fat diet
Mouse
Normal diet
Mouse
High-fat diet

24. On gene level: only little consistency
between mice and primates

25. Pathway level changes
Unbiased pathway analysis
6% 0 1( & 1 (
1& - 2 "+
$ ( /# & 2 * #
'& ' 1) !"$ ') #*+ ./#%' ( /' /45" 0
# & % - ) 0 " .3 ( 0 &
%% "
( ( ,( (1 2
# ! - %
. (
" # *+))))))))))))4 '4 +
-%( )))))+ 5 (
##," ))))))( 4+
&(%$ )))))))))))))-%$
0 '4 " )))))))))))) # * "
% +)))))) & " $
. $+#$
(+ )%
8 $ %
9 . &
5 - # < , +* %
- $ .1
./0)2
" . %#," ) : *
8 ) -%( % ,
3 4&
+ 56
( %
&
, *% $
.+$ %
( )%
# &
.
%
,
!"$
#
%&
. (
.(+ ),, *%
$+ ).+
8 :
9 ( - $ . ),
./ 1 $
0 * +
- $. )
./ 1
0 7
; *5 ( ,
"& . '%
)/ 3 *##, &
* 1 -% 6
+ )
'/$ % %,
!"$
#
%& !"$
#
%&
'%,
() $
%*
+
'%,
() $
%*
+
monkey mouse

26. Pathways responding consistently
across diets and species

27. Cholesterol synthesis enzymes are
downregulated across diets and species
Hagedorn, et. al, unpublished

28. Systems biology successfully
explains pharmacology!

29. Off-target effects?
miR
RISC Yes, the antimiR binds and
derepress targets of the miR
antimiR
Direct effect on (partially)
complementary targets?

30. cells or animals
treated with oligo
or siRNA
1. Calculate fold
change in the
concentration of
each mRNA
Untreated or
mock treated
animals
2. Rank mRNAs by fold change
up in treated down in treated
3. Sequence analysis: Mark presence of all „words‟ of length k
4. Test if a word is over/under represented in one end of the ranked list
Sylamer, Enright lab, 2009

31. 6 nt words 7 nt words
Sites complementary
to miR-122
Noise level
Sites complementary
to oligo
Obad et al., Nature Genetics, in press

32. No evidence of direct regulation of
mRNAs by LNA-antimiRs!

33. miravirsen is in clinical trials
★Preclinical tox: “SPC3649 (miravirsen) was tolerated at doses that far
exceed those intended for human clinical use”
★Phase Ia study completed: Single dose, dose-escalationin healthy
volunteers
★Phase Ib completed: Multiple ascending doses in healthy volunteers
★Phase II ongoing: Hepatitis C patients

34. Phase 1a. Dose dependent reduction of plasma
cholesterol in humans

35. Summary
 Bioinformatics: Sequence analysis facilitates
oligonucleotide drug development
 Design of specific, potent and tolerable oligonucleotide drugs
 Methods for expression data analysis on efficacy and specificity
 Systems biology: miR-122 coordinates expression level of
cholesterol biosynthesis enzymes
 HCV-treatment: Miravirsen appears to be a promising new
HCV treatment
 First time a microRNA is a drug target
 No escape mutants in treated chimpanzees
 Awaiting phase II data

36. Acknowledgements
Santaris microRNA research group
Sakari Kauppinen
Susanna Obad
Joacim Elmen
Santaris Bioinformatics group
Andreas Petri
Lena Hansson (now Intomics)
Elfar Torarinson (sysadm consult)
Peter Hagedorn (post doc, now at LEOPharma)
Center for biological sequence analysis, DTU
Henrik Bjørn Nielsen

37. More…..
 mirmaid.org microRNA information for computers, open
source API to miR data resources
 bio-geeks.com, blog with other geeks about bioinformatics
 RNA.dk – homepage for new big project about Enabling RNA
Therapeutics
 oligoinformatics.org, New. Specialized blog on oligos and
informatics
 Student project inquiries: mol@santaris.com