The State of Rhode Island publishes its budget and the various support.docx

•Als DOCX, PDF herunterladen•

0 gefällt mir•2 views

The document provides instructions to access the State of Rhode Island's budget website and answer questions about the budget office's duties, the governmental functions and their budget allocations, major revenue sources and percentages, the accounting basis used, four categories of program performance measures and how they are used, and what was learned from reviewing the most recent RI budget.

Bildung

The State of Rhode Island publishes its budget and the various supporting information at
www.budget.state.ri.us/index.htm which you should access and then answer the following:
A. What are the duties of the budget office? (Hint: Use the About Us link.)
B. What are the six governmental functions listed in the budget? For the most recent year,
calculate the percentage of the total budget allocated to each function.
C. What are the major sources of Rhode Island's revenues? Calculate the percentage which each
category represents of the total revenues.
D. What is the accounting basis used in the preparation of the budget? (Hint: Use the Primer link
and scroll down until you see the Budget Basis section.)
E. The budget mentions four categories of program performance measures. List them, and briefly
describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program
Performance Measures section.)
F. What did you learn from reviewing the most recent budget of the State of Rhode Island?
Solution
E. The budget mentions four categories of program performance measures. List them, and briefly
describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program
Performance Measures section.)

Weitere ähnliche Inhalte

Ähnlich wie The State of Rhode Island publishes its budget and the various support.docx

Unit VI Project Topic Part I This assignment is the first of a three-part process. Parts II and III will be completed in Units VII and VIII respectively. Using your favorite search engine, select a local government budget that has not filed a petition for bankruptcy. Evaluate the past three years of the selected government’s distribution of income. Develop an analysis including the following:  Evaluate trends of revenue sources and balances (funds, surpluses, deficits) and how they impact the government’s budget .  Evaluate ethical practices of financial policy on taxes, fees, and charges.  Assess internal/external opportunities and challenges of revenue sources. Your report should consist of no less than two pages, and all sources utilized should be cited and referenced using APA style. Please ensure that you include a cover page and reference page. Remember that the cover page and reference page are not included in the page expectation. Unit VII Project Topic Part II Multi-year Budget Evaluation This assignment is the second of a three-part process. Part III will be completed in Unit VIII. Using the selected government budget from Part I in the previous unit, evaluate the past three years’ allocation of private and public goods. Develop an analysis including the following:  Evaluate goals and priorities of the local government goods and services.  Assess internal and external challenges for providing goods and services.  Evaluate budget stabilization measures.  Provide recommendations. Your report should consist of no less than two pages, and all sources utilized should be cited and referenced using APA style. Please ensure that you include a cover page and reference page. Remember that the cover page and reference page are not included in the page expectation. Unit VIII Project Topic Part III Prepare a report in which you cover the following information about the multi-year budget evaluation:  trends of revenue sources and balances (funds, surpluses, deficits);  an assessment of internal/external opportunities and challenges of revenue sources;  goals and priorities of the local government goods and services;  an assessment of internal and external challenges for providing goods and services;  an evaluation of budget stabilization measures; and  an analysis of financial policy trends toward alternative taxes. Your report should consist of no less than three pages, and all sources utilized should be cited and referenced using APA style. Please ensure that you include a cover page and reference page. Remember that the cover page and reference page are not included in the page expectation. ...

Unit VI Project TopicPart IThis assignment is the firs.docx

rajahchelsey

Acc 410 wk 2 quiz 1 ch. 1

fascinating_heart

1) Accounting: A. processes data into reports and communicates the data to decision makers. B. is often called the language of business. C. measures business activities. D. is all of the above. 2) Assets include cash, land, and accounts payable. True False 3) A prepaid expense is an asset. True False 4) The primary objective of financial reporting is to provide information A. on the cash flows of the company. B. to the federal government. C. useful for making investment and credit decisions. D. about the profitability of the enterprise. 5) Each transaction has either an equal effect on both the left - and right- sides of the accounting equation, or an offsetting effect (both positive and negative) on the same side of the equation. True False 6) During February, assets increased by $ 87,000 and liabilities increased by $ 31,000. Stockholders' equity must have A. increased by $ 56,000. B. decreased by $ 56,000. C. increased by $ 118,000. D. decreased by $ 118,000 7) Thompson Instruments had retained earnings of $ 340,000 at December 31, 2015. Net income for 2016 totaled $ 185,000, and dividends for 2016 were $ 85,000. How much retained earnings should Thompson report at December 31, 2016? A. $ 425,000 B. $ 340,000 C. $ 525,000 D. $ 440,000 8) Purchasing a laptop computer on account will A. increase total assets. B. have no effect on stockholders' equity. C. increase total liabilities. D. All of the listed choices are correct. 9) Performing a service on account will A. increase total assets. B. increase stockholders' equity. C. increase total liabilities. D. accomplish both a and b. 10) Receiving cash from a customer on account will A. decrease liabilities. B. have no effect on total assets. C. increase stockholders' equity. D. increase total assets. 11) Which of the following is not an asset account? A. Salary Expense B. Common Stock C. Service Revenue D. None of the listed accounts is an asset. 12) The journal entry to record the purchase of supplies on account A. debits Supplies Expense and credits Supplies. B. credits Supplies and debits Cash. C. credits Supplies and debits Accounts Payable. D. debits Supplies and credits Accounts Payable. 13) On January 1 of the current year, Bambi Company paid $ 1,500 in rent to cover six months (January long dash June). Bambi recorded this transaction as follows: Journal Entry Date Accounts Debit Credit Jan 1 Prepaid Rent 1,500 Cash 1,500 Bambi adjusts the accounts at the end of each month. Based on these facts, the adjusting entry at the end of January should include A. a debit to Prepaid Rent for $ 1,250. B. a credit to Prepaid Rent for $ 250. C. a debit to Prepaid Rent for $ 250. D. a credit to Prepaid Rent for $ 1,250. 14) On January 1 of the current year, Bamber Company paid $ 1,500 in rent to cover six months (January - June). Bamber recorded this transaction as follows: Journal Entry Date Accounts Debit Credit Jan 1 Prepaid Rent 1,500 Cash 1,5.

1) AccountingA. processes data into reports and communicates t.docx

oswald1horne84988

Appendix A HSM/220 Version 3 1 Associate Level Material Appendix A Final Project Overview and Timeline Final Project Overview You are the executive director of an established not-for-profit, community-based organization provider that offers high-quality educational, vocational, and training services to various segments of the local population. In response to the increasing dropout rate of high school students in the local community and a worsening financial situation at the local school district, the organization is considering the opportunity to offer basic skills and vocational training programs in the community. The purpose of this new program is to equip high school dropouts with necessary skills needed to gain potential employment opportunities. As an executive director, justify the reasoning behind this new program and develop a complete launch plan, including a budget and consideration of environmental factors. You must determine how data will be used to support the new program and consider human resources issues affecting this new program. The organization has these issues to consider: · The local economy situation is depressed due to steady job losses resulting from employers relocating to other cities and communities that offer better economic incentives to employers. As a result, local property taxes that support funding of high school programs have declined singifantly in recent years. The reduction has caused the local school district to lose significant financial resources to retain good teachers or fill vacant teachers’ positions. · In the last two years the high school dropout rate had climbed to 15% from 5%. The local school district along with state agencies decided to sponsor and fund new training and vocational programs for high school dropouts in order to provide these high school dropouts with necessary skills needed to gain potential employment opportunities. The total funding available for this program is $1,600,000. · The projected number of eligible high school dropout students in year one: 1,000 · The projected number of eligible high school dropout students in year two and thereafter: 2,000 · This organization needs to plan for the recruitment and hiring of experienced trainers and other highly skilled technical staff to start the proposed programs. The tight financial resources available makes finding qualified personnel a challenge. Also, after hiring the appropriate staff, it is critical for the executive director to think proactively in order to motivate the staff and use an appropriate appraisal and reward system. · If the organization decides to provide these comprehensive training programs, the following financial data must be considered: Operating Expenses: Per Year Rent $125,000 Utilities $100,000 Office supplies $25,000 Equipment/lease $50,000 Transportation and travel $100,000 Outside consultants $100,000 Overhead costs $100,000 Personnel expenses: Annu.

Appendix AHSM220 Version 31Associate Level MaterialAppe.docx

rossskuddershamus

Presented by Corinne Wilson The Mayor’s budget for the City of San Diego is likely to be released on or around April 15, 2013. Join us April 4 to learn how to read a city budget. In this workshop you will learn: *how to identify key tables *how to read a city budget *budget terms and concepts This workshop is put on by the Community Budget Alliance (CBA). The alliance is concerned that city resources be allotted equitably to neglected neighborhoods, and that city residents have early, meaningful opportunities to participate in designing the budget. CBA consists of more than 40 organizations in San Diego. For more info visit: http://onlinecpi.org/event/how-to-read-the-budget-workshop/

How to Read a City Budget (4 - 4 -13)

Center On Policy Initiatives

Tools for spending review in Japan and the use of key performance indicators ...

OECD Governance

Complete the multiple choice questions in Exercise 12-15, p. 510: 1-10 PLEASE USE APA GUIDELINES TITLE IT: MULTIPLE CHOICE ASSIGNMENT 12-15 Multiple Choice. Choose the best answer. 1. Budgets of government entities: Are integrated with the financial accounting system. Enable governments to demonstrate compliance with laws and to communicate performance effectiveness. Are adopted by governments after required public hearings. All of the above. 2. Which of the following statements regarding budgets of not-for-profit organizations is true? Not-for-profit organization budgets are legal documents reflecting plans for spending resources. A not-for-profit entity may choose to prepare a budget to demonstrate accountability to its resource providers, such as donors and grantors. The budgeting approaches used for governments generally cannot be used by not-for-profit entities. All of the above statements are true. 3. Page 511Which of the following steps would not usually be part of the budgeting process? Heads of operating departments prepare budget requests. The chief executive (mayor or city manager, as appropriate) formally adopts the budget, thus giving it the force of law. One or more public budget hearings are held. Budget officer and other central administrators review and make adjustments to departmental requests. 4. The budgeting principle in generally accepted accounting principles (GAAP) for state and local governments states that: The accounting system should provide the basis for appropriate budgetary control. Budgetary comparison schedules should be presented as required supplementary information for the General Fund and each major special revenue fund that has a legally adopted budget. Annual budgets should be adopted by each government. All of the above. 5. The budgetary comparisons required of state and local governments under GASB standards: Can be presented as a schedule within required supplementary information (RSI) or as a statement in the basic financial statements. Must be a schedule included as part of RSI. Continues to be a statement included in the basic financial statements. Is no longer required. 6. An approach to budgeting that requires the very existence of each program and the amount of resources requested to be allocated to that program to be justified each year is called: Incremental budgeting. Zero-based budgeting. Performance budgeting. Planning-programming-budgeting. 7. Which of the following does not represent a performance measurement group under the balanced scorecard? Customer. Internal business processes. Economy and efficiency. Learning and growth. 8. Governments that choose to report service efforts and accomplishments (SEA): Must adhere to GASB SEA gui.

Complete the multiple choice questions in Exercise 12-15, p. 510.docx

sheenaat5wa

DATA EXERCISE #1 Format of the Project: The Data Exercise must be posted to the LEO Student Assignments as a Attachments are limited to a maximum two files in doc, docx., xls. xlsx., or rtf. formats. OTHER FORMATS ARE NOT ACCEPTABLE, will not be reviewed or graded. Please note that hand-written and scanned works, pdf. files, jpg. files, as well as files posted in google drive, will not be accepted or graded. The paper should be written in APA style Research Paper format. Please note that Use of APA Citation Methodology is required for all parts of the assignment Written projects must be: 1. typed, double-spaced, in 12-point Times New Roman or Arial font, with margins no wider than one inch 2. have footnotes or endnotes, with correct citations 3. have a bibliography of sources used 4. include, for each entry, the author, title, city and state of publisher, publisher's name, year, and page numbers 5. prepared using word processing software (Microsoft Word preferred), in a manner similar to the preparation of a written assignment for classroom submission Data exercise #1 Assignment Consists of four parts Part 1: Expenditures Approach to Calculating GDP (weight 25% of the assignment grade) Complete the following exercise Visit the Bureau of Economic Analysis website at www.bea.gov. From the drop-down menu under “Data”, click on “by Economics Account”. Then click on “National”, “Gross Domestic Product, and “Full Release and Tables”. Use tables 3A (Gross Domestic Product and Related Measures) and 3B (Real Gross Domestic Product and Related Measures). a) Create the table that contains the following information for the last quarter. You need this information from both tables. Omit the intermediate lines found in Tables 3A and 3B on the web site. Gross domestic product Personal consumption expenditures Gross private domestic investment Net exports of goods and services Government consumption expenditures and gross investment 1. b) Calculate the percentage (the proportion) of each category in nominal GDP and in real GDP. Using Nominal GDP: [Personal consumption expenditures / Nominal GDP]*100% [Gross private domestic investment / Nominal GDP]*100% [Net exports of goods and services / Nominal GDP]*100% [Government consumption expenditures and gross investment/ Nominal GDP]*100% And using Real GDP: [Personal consumption expenditures / Real GDP]*100% [Gross private domestic investment / Real]*100% [Net exports of goods and services / Real GDP]*100% [Government consumption expenditures and gross investment/ Real GDP]*100% Present the information that you received in 1 (a) and 1 (b) as a table(s) in your project. 2. Write a report (2 pages double - spaced), which contains an analysis of the results you received. In this report consider, but do not be limited to the following: 1. Why was the nominal GDP greater than the real GDP? By how much? 2. GDP is composed of a number of categories. What category makes up the largest portion of GDP? What category m.

DATA EXERCISE #1Format of the ProjectThe Data Exercise must b.docx

whittemorelucilla

The budget making process _entry points

Rachna Shanbog

Financial Statements Project – ACG203 – Summer 2019 1 Instructions: A. Locate Annual report - Search your company’s website under investor relations to locate the latest annual report published to shareholders. B. Reference the annual report page number when you take information from the annual report in your discussions. There is no need to reference the financial statement page numbers for you calculations. Only reference for your discussion. C. Read Chapter 13– Financial statement analysis – Most of Chapter 13 will be covered throughout the semester while covering the other chapters in the text; therefore, there will be limited in-class coverage of Chapter 13. Use Chapter 13 as a resource when answering questions. D. Copy the questions below - Use the electronic copy of this assignment from Blackboard as the starting WORD document. Insert your answers under each question. Answer the questions completely and show the details of all calculations in your report. When you use financial information from the annual report or the 10-K report, include the page number as a reference. E. Team Update Form - Meet as a team to pick a team name, choose a team leader, set team rules and guidelines, and to set up regular meetings. Turn in this information when the Team update is due. F. Team effort required - Completion of this project must be a team effort! The finished project must ‘flow’. It is not acceptable to have each member to complete one portion of the project, and then put the pieces together to hand it in. Points will be taken of if this is done! G. Peer evaluation form must be completed by each team member and uploaded before the due date. · You must evaluate yourself and your team members. · IF YOU DO NOT HAND IN YOUR EVALUATION, YOUR GRADE WILL BE REDUCED BY 20%!! · Your individual grade may differ from the project grade based on these evaluations. H. The following deadlines apply: Final due date for the project is the last day of summer class Summary of deliverables: · Project report – uploaded to Bb and will be analyzed by Turnitin for plagiarism. · Team evaluation form – uploaded to Bb Questions to be answered: Management Discussion & Analysis section and Miscellaneous (15 points) 1. Review the annual report contents and identify the page numbers for the following sections: a. Management Discussion and Analysis b. Financial Statements and Supplementary data c. Any other sections that is of interest to you. Indicate why it is of interest to you. 2. Read the Management Discussion and Analysis. Describe the major products and/or service the company provides to its customers. Based on what you read, do you get a positive or negative impression about company performance and what the company is doing to grow in the future? Be sure to specifically discuss management perspectives in order to support your impression. 3. Locate the financial statements, and a few pages after the financial statements, the Report of Independent .

Financial Statements Project – ACG203 – Summer 20191Instruct.docx

ericn8

Budgeting Structure and Process.pptx

Jo Balucanag - Bitonio

Budget Proposal For Miami-Dade County For Fiscal Year 2018/19 Introduction This paper reviews the budget proposal for Miami-Dade County for fiscal year 2018/19, the budget process, sources of revenue and expenditure. Overview And Budget Process. Miami-Dade County is one of the counties in the USA and contains 13 districts. Miami-Dade County has a population of 2.71M people with a median age of 39.9 and a median household income of $45,935. Between 2015 and 2016 the population of Miami-Dade County grew from 2.69M to 2.71M, a 0.74% increase, and its median household income grew from $43,786 to $45,935, a 4.91% increase. The legislative and the governing body of the county is the Board of commission elected into office by the registered voters in a non-partisan election. One county commissioner is elected from each county for the term of four years each; the county chatter normally sets the salaries for each commissioner. The Commissioners elect a Chairperson, who then appoints the Chairperson, Vice-Chairperson, and members of all committees. The Miami-Dade County commissioners normally plays a lot of roles which includes; reviews and adopts comprehensive development land use plans for the County, licenses and regulates taxis, transportation network entities, sets policy regarding public transportation systems, regulates utilities, adopts and enforces building codes, establishes zoning controls and establishes policy relating to public health, safety services and facilities, recreational and cultural facilities, housing and social services programs, and other services. The BCC normally sets the tax rates and approve the county budget every financial year. Each year, the commission sets the property tax millage rates and approves the County’s budget, which determines The expenditures and revenues are necessary to operate all County services, and enacts the County's strategic plan. The County Commission Board may override a Mayoral veto at its next regularly scheduled meeting by a two-thirds vote of those present. The Miami-Date county citizens do not directly play a role in the budget process, but the BCC normally represents them by making policies and advocate them at all levels of government. The Miami-Dade FY 2018/2019 annual budget began on 1st August 2018 and ended 30th June 2019. The budget process takes place in several stages which are a formulation, approval implementation, and audit. Documents essential to the budget process include the budget circular, the budget review, outlook paper, the county fiscal strategy paper, and the county budget estimates. The county has a budget performance analysis which is conducted by each department of the county, and it’s done through the analysis of the outcomes and results. The budget does not include the forecast for future years or prior years. The budget document gives detailed information on sources of revenue and expenditures. The budget report posted in the county’s websites gives inform.

Budget Proposal For Miami-Dade County For Fiscal Year 201819I.docx

curwenmichaela

Country Analysis Project: Part C With the countries you analyzed for Parts A and B, please answer the questions below and turn in to Canvas by Saturday, August 17th, 2019 by 11:59EST. PLEASE NOTE: The countries you choose for Part A will be the countries you refer to through Parts A, B, and C. If, for some reason, information is not available for your country at the websites cited by a particular question, please choose another country to answer that question, and NOTIFY ME and MAKE NOTE in the Project of the CHANGE. This Project is worth 70 points. I will run the submissions through an anti-plagiarism software. Failure to reference the websites or any other research will result in a grade reduction of 8 points in your project score. Please include the tables provided by the websites! Failure to do so will result in half the points being subtracted from your grade. Last but not least, please place your name as a header in the file. This makes it easier for me to grade and causes less confusion for you in the future. Failure to do this may result in points (-5) being subtracted from your grade. Economy (20 points) Using the two countries from Part A, go to globaledge.msu.edu You may also go to cia.gov Factbook pages to research your countries. Please make sure you include tables from your research for each country. 1. Describe the Economy. a. Describe the economy (using the CIA Factbook) for Country 1 (5 points) and provide table for the following economic indicators: (5 points) i. Current Account Balance ii. Inflation iii. Manufacturing Value Added iv. GDP Growth v. GDP per capita, PPP b. Describe the economy (using the CIA Factbook) for Country 2 (5 points) and provide table for the following economic indicators: (5 points) i. Current Account Balance ii. Inflation iii. Manufacturing Value Added iv. GDP Growth v. GDP per capita, PPP Infrastructure (20 points) 2. For each country, look up the following Infrastructure determinants – http://globaledge.msu.edu/ https://www.cia.gov/library/publications/the-world-factbook/ https://www.cia.gov/library/publications/the-world-factbook/ a. mobile cellular subscriptions; b. Roads, total network; c. Rail lines; d. Transport; and e. Internet Users. Do not just supply this information in the form of tables, also explain why infrastructure is important to FDI. a. Country 1 – why is infrastructure important (5 points) and indicators tables and or graphs (5 points) b. Country 2 why is infrastructure important (5 points) and indicators tables and or graphs (5 points) HINT: In order to properly compare these numbers, you may want to scale these numbers per capital - divide each infrastructure indicator by population. The population is on the CIA Factbook. Investment Potential (30 points) 3. Overall, what is your group’s informed opinion as to how receptive your countries are to FDI? a. Which country, of the pair,.

Country Analysis Project Part C With the countries you a.docx

bobbywlane695641

Budget making process in india

Ekalavvya

City Of Schertz Pp

Harry Whitney

Budget preparation

Nazia Goraya

Session Six: Performance Budgeting For Sub National Entities, China, Meeting ...

OECDtax

Tools for spending review in Japan and Key performance indicator utilisation ...

OECD Governance

Government And Not-For-Profit Accounting Concepts And Practices 7th Edition G...

NathanielsIs

Budget Committee Presentation

Brett Deaton

Ähnlich wie The State of Rhode Island publishes its budget and the various support.docx (20)

Unit VI Project TopicPart IThis assignment is the firs.docx

Acc 410 wk 2 quiz 1 ch. 1

1) AccountingA. processes data into reports and communicates t.docx

Appendix AHSM220 Version 31Associate Level MaterialAppe.docx

How to Read a City Budget (4 - 4 -13)

Tools for spending review in Japan and the use of key performance indicators ...

Complete the multiple choice questions in Exercise 12-15, p. 510.docx

DATA EXERCISE #1Format of the ProjectThe Data Exercise must b.docx

The budget making process _entry points

Financial Statements Project – ACG203 – Summer 20191Instruct.docx

Budgeting Structure and Process.pptx

Budget Proposal For Miami-Dade County For Fiscal Year 201819I.docx

Country Analysis Project Part C With the countries you a.docx

Budget making process in india

City Of Schertz Pp

Budget preparation

Session Six: Performance Budgeting For Sub National Entities, China, Meeting ...

Tools for spending review in Japan and Key performance indicator utilisation ...

Government And Not-For-Profit Accounting Concepts And Practices 7th Edition G...

Budget Committee Presentation

Mehr von helenc18

The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m. Solution given P = 3.8*10^26 W r = 5.8*10^10 m A = 5 m^2 Intensity of radiation at the surface of the Mercury, I = Power/Area = P/(4*pi*r^2) = 3.8*10^26/(4*pi*(5.8*10^10)^2) = 8989 W/m^2 Radiation pressure on completely oborbing surface, P = I/c = 8989/(3*10^8) = 2.996*10^-5 N so, Force due to radiation, F = P*A = 2.996*10^-5*5 = 1.50*10^-4 N <<<<<<<<-------Answer .

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

helenc18

The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction. Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Solution 1) Land: fair value $75,000 cash:paid + $17,000 New parcel = $92,000 2) New parcel = $92,000 Gain on exchnage = $43,500 cash = $17,000 land = $31,500 3) New parcel = $48,500 cash = $17,000 land = $31,500 .

The Tinsley Company exchanged land that it had been holding for future.docx

helenc18

The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain. Solution The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies. According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit. This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can\'t take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can\'t be cheated. .

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

helenc18

The sound strikes the cantina walls and bounces off at the same angle as it struck in a process known as _____. A. reflection B. refraction C. constructive interference D. destructive interference 14. Sound Waves Choose One â€¢ 5 points Obi Wan hears the destruction of a planet and all of its people through \'the force\'. These sounds are only in his head and are not carried through space, since space has no _____ through which sound could transmit. electromagnetic wave electrons magnetic field medium 15. The Doppler Effect Choose One â€¢ 5 points However, had it been a real sound, the sound\'s pitch would have been increased by the Doppler Effect, since the Falcon was moving _____ the source of the sound. perpendicular to away from towards at the same speed as bounced wave 2 Angle of Reflection Angle of Incidence Incident wave A single direction of the Sound Wave from Greedo\'s Blaster Solution 1) Reflection . Reflection is the change in direction of a wavefront at an interface between two different media so that the wave front returns into the medium from which it originated. 2) Medium Sound waves require matter to transmit them, unlike light waves. 3) Towards The Doppler Effect tells us that as an object moves toward the source of sound, the pitch the object feels will increase; when the object moves away, the pitch decreases. In order for the pitch to increase, the falcon must be moving towards the source of sound. .

The sound strikes the cantina walls and bounces off at the same angle.docx

helenc18

The six platforms below are initially at rest in deep space. The indicated forces act on the platforms at endpoints, quarter-points, or midpoints. All forces have the same magnitude. heir Rank these platforms on the basis of the torque that acts on them, measured about their CM. Let the counterclockwise direction be positive and rank positive torques as larger than negative torques. Largest 1. 2.3.4.5. 6. Smallest The ranking cannot be determined based on the information provided. Explain the reason for your ranking: Solution B > E > C = F > A > D let F is the magnitude of force and L is the total length. A) TA = -F*(L/4) - F*(L/4) = -F*L/2 B) TB = F*(L/2) + F*(L/2) = F*L C) TC = F*(L/4) + F*(L/4) = F*L/2 D) TD = F*(L/2) - F*(L/4) + F0 = F*L/4 E) TE = F*(L/2) + F*(L/2) - F*(L/4) = (3/4)*F*L F) TE = F*(L/2) + F*(L/2) - F*(L/4) - F*(L/4) = F*L/2 .

The six platforms below are initially at rest in deep space- The indic.docx

helenc18

The rise of various digital communication methods in the past decade has greatly changed the field of public relations. What new and emerging technologies do you think will continue to change the PR field? How do you anticipate the PR field changing in response to those technologies? Explain your answer carefully, citing specific examples of technology or real-life examples from the news. Solution PR is basically a method to built and maintain relationsship with different stake holders of an organization. Stake holders are investors,employees,customers,suppliers, regulating agencies , government and society at large.This happens through constat interaction and communication with the concerned people . In the modern times , communication has become very easy with the availability of smart phones and internet.One can communicate/send mails to thousands of people at the click of a mouse.Unlike in traditional way of sending hard copy mailers which takes lot of time to be delivered, emails can reach the receipiant in fraction of a second. Further one doesn\'t have to physically go to a person to chat or talk. He can do that through video conferencing sitting at his home/office through skype or he can also do text based chate in sites like facebook,gmail,yahoo messenger etc .

The rise of various digital communication methods in the past decade h.docx

helenc18

The reason that the increase in population growth in the 19th and 20th centuries did not lead to famine as Thomas Malthus predicted was because wars kept the population in check there was diminishing marginal product of labor increases in technology and capital raised labor productivity people learned to eat less worldwide population didn\'t actually grow Solution 3. increases in technology and capital raised labor productivity .

The reason that the increase in population growth in the 19th and 20th.docx

helenc18

The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain. Solution The payment of cash dividends to shareholders is classified as a financing activity. FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders. In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section. Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity. Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise). Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders. Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section. NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity. .

The sale of stock and the sale of bonds are reported as financing acti.docx

helenc18

Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves. Solution Following factors influence the precipitation volumetric analysis. 1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation. 2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions. 3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate. 4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph. 5. Temperature is directly proportional to the precipitation. 6. Foreign elements present decrease the stability of product as they can show coprecipitation. 4. .

Precipitation volumetric analysis involves formation reactions of solu.docx

helenc18

POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand Solution Answer - Similarties - Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine. both have a phosphate groups in their nucleotides. Difference - DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone. DNA contain thymine, while RNA contain uracil. complementary strand - PAIR ATÂ Â ;GC........write pair TACTAACTGTAACTCCTAGGTA .

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

helenc18

Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.) Solution Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have, .

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

helenc18

Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review. Q2. Write a biography paragraph about the scientist: Ohm. Solution Name : George Simon Ohm. He is a German Physicist. Total Life : March 16 th 1789 to July 6 th 1854. ( 65 years 3 months and 20 days ) Studies : he studied the subjects are Maths , Physics , Chemistry , Philosophy. he is a doctorate from Erlangen University. ( October 25 th 1811 ) Teaching carrier : He worked as a Teacher and Professor in various Posistions and in various places. Invention : Ohm\'s Law. V = i R V = voltage i = current R = resistance Famous Law which will be useful in the total electricity concepts. Awards : Copley Medal in the year of 1841. and Scintific career. Area of interests : Physics Especially in Electric fields. .

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

helenc18

please write carefully and explain clearly. Thank you. Solution Ksp of CoCO3 = 1*10^-10 CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq) s s Ksp = [Co^2+][CO3^2-] Ksp = s*s Ksp = s^2 1*10^-10 = s^2 s^2 = 1*10^-10 s = 1*10^-5 mole/L molar mass of CoCO3 = 118.94g/mole solubility of cobalt(II) carbonate = 1*10^-5 mole/L = 1*10^-5 mole/L * 118.94g/mole = 1.1894*10^-3g/L = 1.1894mg/L The solubility of CoCO3 = 1.1894mg/L .

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

helenc18

Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority Solution 1.Waste Prevention:Waste prevention also called â€œsource reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane 2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils. 3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion. .

Prioritize the three themes of integrated solid waste management- 1^st.docx

helenc18

present synchronized savage code while (1) { getServingFromPot (); eat (); } present synchronized cook code here while (1) { refillPot (); } Solution servings = 0 mutex = Semaphore(1) emptyPot = Semaphore(0) fullPot = Semaphore(0) <Cook> while true: emptyPot.wait() putServingsInPot(M) fullPot.signal() <Savage> while true: mutex.wait() if servings == 0: emptyPot.signal() fullPot.wait() servings = M servings -= 1 getServingFromPot() mutex.signal() eat() .

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

helenc18

Prepare general journal entries to record the following transactions for the Harris Company. (The company uses the balance sheet approach for recording bad debts expense.) 2010 Dec. 31 Recorded Bad Debts Expense, $800 2011 Jan. 3 Wrote off Jalâ€™s account as uncollectible, $60 Mar. 4 Wrote off Hallâ€™s account as uncollectible, $75 Jul. 5 Recovered $45 from Hall Aug. 19 Wrote off M. Wilsonâ€™s account as uncollectible, $100 Nov. 7 Recovered $25 from Jal Solution (1) Dec 31, 2010 DR Bad Debt Expense $800 Accounts Receivable $800 (To record bad debt expense) (2) Jan 3, 2011 DR Allowance for uncollectible receivable $60 Accounts receivable $60 (To record write-off of Jal\'s account as uncollectible) (3) Mar 4, 2011 DR Allowance for uncollectible receivable $75 Accounts receivable $75 (To record write-off of Hall\'s account as uncollectible) (4) Jul 5, 2011 DR Cash $45 Bad debt recovered (Income) $45 (To record partial recovery of bad debt from Hall) (5) Aug 19, 2011 DR Allowance for uncollectible receivable $100 Accounts receivable $100 (To record write-off of M. Wilson\'s account as uncollectible) (6) Nov 7, 2011 DR Cash $25 Bad debt recovered (Income) $25 (To record partial recovery of bad debt from Jal) .

Prepare general journal entries to record the following transactions f.docx

helenc18

Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)? Solution Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc. Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively. Different technological specifications important to be implemented in a website design are mentioned below: Technological specification varies on the basis of website or system being designed. .

Prepare functional specifications for the company-'s use of the Web an.docx

helenc18

Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting. Solution Reason One The increasing use of Internet of Thing In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws. Since these devices werenâ€™t originally registered on network, they may not have enough cybersecurity protections. so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization. Reason 2 The Breaches are a financial burden Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization. Reason 3 the real threats are insider threats The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes. Reason 4 Without cybersecurity the reputation of the organization is at risk. If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization .

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

helenc18

Mehr von helenc18 (18)