Dimensionality Reduction of Genomic Variation with Big Data Genomics ADAM & Spark MLLib/ML & SparkR
•
5 gefällt mir•1,030 views
(Seattle Spark Meetup- Machine Learning Roundtable. October 16, 2015
Empfohlen
Weitere ähnliche Inhalte
Kürzlich hochgeladen
Kürzlich hochgeladen (20)
Empfohlen
Empfohlen (20)
Dimensionality Reduction of Genomic Variation with Big Data Genomics ADAM & Spark MLLib/ML & SparkR
- 1. Dimensionality Reduction of Genomic Variation with Big Data Genomics ADAM & Spark MLLib/ML & SparkR Deborah Siegel Northwest Genomics Center UW Center for Mendelian Genomics twitter: @dsiegel coauthoring a book on data analysis in SparkR with Amanda Casari Seattle Spark Meetup October 16, 2015
- 2. xkcd
- 3. Reference Genome ! ! Humans have 2 copies of most of our chromosomes, thus we have two alleles for each position of our genome. ! ! ! AATCATGTGTGGCTACTTACTGTCACT ! ! AATCATGTGTGGCTACTTACTGTCACT AATCATGTGTAGCTACTTACTGTCACT ! ! ! We will represent our data with Manhattan distance: for each person in our sample, how many alternate alleles are present in their genotype for that position. ! homozygous ref allele GG heterozygous GA homozygous alt allele AA GG {0} GA {1} AA {2} Representation
- 4. Motivation Manolio et al. Finding the missing heritability of complex diseases. Nature. 2009 Oct 8 Used with permission
- 5. John Novembre, Toby Johnson, Katarzyna Bryc, Zoltán Kutalik, Adam R. Boyko, Adam Auton, Amit Indap, Karen S. King, Sven Bergmann, Matthew R. Nelson, Matthew Stephens, Carlos D. Bustamante (2008). Genes mirror geography within Europe Nature DOI: 10.1038/nature07331 Used with Permission Motivation Genes Mirror Geography within Europe
- 6. ℝ3,000,000,000 ℝ50,818,468 ℝ 493,782 ℝ1838 ℝ2 ! Genomic Positions chr22 biallelic snp variants with complete data in our sample common variants in our sample dimension reduced Data 1000 genomes project publicly available on AWSData Feature Space
- 8. vcf file Filter - Complete data Filter - CommonVariants create RDD[Row] with sample ID and ordered array of alt allele counts Filter - Populations Case Class of SampleVariants parquet file of genotype objects MLVectorAssembler Spark ML create DataFrame df to rdd create schema Spark/ADAM ML fit PCA (model) ML transform (projection) write to parquet on hdfs SparkR read parquet from hdfs to local data.frame plot PC1 & PC2 workflow MLVectorSlicer convert vector slices to strings rdd to df
- 10. ! Also: Northwest Genomics Center Amanda Casari Frank Nothaft & Big Data Genomics http://bdgenomics.org/ Neil Ferguson for his excellent blog post - http://bdgenomics.org/blog/ 2015/07/10/genomic-analysis-using-adam/ ! Thank You! Call to Action: Talk with folks in development community about PCA on Spark, and SparkR