SlideShare ist ein Scribd-Unternehmen logo
1 von 24
M K REDDY
GROUP LEADER
CROP IMPROVEMENT GROUP
INTERNATIONAL CENTRE FOR GENETIC ENGINEERING AND BIOTECHNOLOGY
Editing rice-genome with CRISPR/Cas9:
To improve agronomic traits for increased crop productivity
One can edit any genome by expressing Cas9 Protein and gRNA
Maize
Ubiquitin
Promoter
Cas9
NOS
terminator
Rice U6
Promoter sgRNA Terminator
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformation vector
Agrobacterium mediated
Rice transformation & regeneration
Cas9 & sgRNA expressing
Transgenic rice plants were identified
Targeted genome edited
rice plants were identified
Transgenic component free
genome edited rice lines generated
Through sequence analysis
Through Molecular analysis
Segregating out the
transgenic component
Cas9 and sgRNA
Through crossing, selfing
and subsequent selection
Putative transgenic rice plants generated
OsDEP1 (Os09g26999)
knockout rice line
OsTB1 (Os03g49880)
knockout rice line
OsCKX2 (Os08g0509600)
knockout rice line
OsGW2 (Os02g2914720)
knockout rice line
Non-transgenic high yielding genome edited rice lines
Background work done related to the project
1234567891011121314151617MPN
PCR Screening transgenic plants for Cas9 integration
PCRamplificationoftargetregionfromtheCas9positivetransgeneiclines
1 2 3 4 5 6 7 10 11 13 14 15168 9 12 17
Generating Cas9 and sgRNA expressing transgenic rice
Single allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines
GGCGGGCAAGGCGTCGACGCCGG
GCAAGAACAATTGAGGCACCTTGG
ControlriceplantEditedriceplant Bi-allelic DEP1 (Os09g26999) editing in rice MTU1010 cultivar
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformation vector
Agrobacterium mediated
Rice transformation & regeneration
Cas9 & sgRNA expressing
Transgenic rice plants were identified
Targeted genome edited
rice plants were identified
Transgenic component free
genome edited rice lines generated
Through sequence analysis
Through Molecular analysis
Segregating out the
transgenic component
Cas9 and sgRNA
Through crossing, selfing
and subsequent selection
Putative transgenic rice plants generated
OsDEP1 (Os09g26999)
knockout rice line
OsTB1 (Os03g49880)
knockout rice line
OsCKX2 (Os08g0509600)
knockout rice line
OsGW2 (Os02g2914720)
knockout rice line
Non-transgenic high yielding genome edited rice lines
Background work done related to the project
Bi-allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformation vector
Agrobacterium mediated
Rice transformation & regeneration
Cas9 & sgRNA expressing
Transgenic rice plants were identified
Targeted genome edited
rice plants were identified
Transgenic component free
genome edited rice lines generated
Through sequence analysis
Through Molecular analysis
Segregating out the
transgenic component
Cas9 and sgRNA
Through crossing, selfing
and subsequent selection
Putative transgenic rice plants generated
OsDEP1 (Os09g26999)
knockout rice line
OsTB1 (Os03g49880)
knockout rice line
OsCKX2 (Os08g0509600)
knockout rice line
OsGW2 (Os02g2914720)
knockout rice line
Non-transgenic high yielding genome edited rice lines
Background work done related to the project
Cytokinin Oxidase Regulates Rice spike architecture and increase he grain number
• The rice OsCKX2 differentially expresses in rice inflorescence
• Cytokinin oxidase degrades cytokine and negatively regulates the inflorescence branching
• Absence of OsCKX2 expression cytokine accumulation and increases the grain number
Ashikari et al 2005 Science: 309, 741-745
GACGTCGAGCTCTAGCACGTTGG
TWO NUCLETIDE DELEATION IN CKX2 GENE IN RICE MTU1010
MTU1010 high yielding popular rice mega-verity
Cas9 & sgRNA encoding genes
Together cloned into single
plant transformation vector
Agrobacterium mediated
Rice transformation & regeneration
Cas9 & sgRNA expressing
Transgenic rice plants were identified
Targeted genome edited
rice plants were identified
Transgenic component free
genome edited rice lines generated
Through sequence analysis
Through Molecular analysis
Segregating out the
transgenic component
Cas9 and sgRNA
Through crossing, selfing
and subsequent selection
Putative transgenic rice plants generated
OsDEP1 (Os09g26999)
knockout rice line
OsTB1 (Os03g49880)
knockout rice line
OsCKX2 (Os08g0509600)
knockout rice line
OsGW2 (Os02g2914720)
knockout rice line
Non-transgenic high yielding genome edited rice lines
Background work done related to the project
GW2 QTL for rice grain and weight encodes a RING-type E3 ubiquitin ligase
GW2 loss of function increased cell divisions in spikelet hull resulting in enhanced grain width, weight and yield
GW2: Os02g14720
PCR fragment cut with Sca1 (AGTACT) edited line will cut control won’t Cut
OsDEP1 (Os09g26999)
knockout rice line
OsTB1 (Os03g49880)
knockout rice line
RBLB
WDV ALS repair template
A P W S
96 171 548 627
122 197 574 653
Four known ALS herbicide resistance endowing mutations
Chlorsulfuron
Bensulfuron
methyl
Imazaquin
Imazapyr
Bispyribac
sodium
Pyrithiobac
sodium
Pyriminobac
A/V P/S W/L S/I
10
190
55
14
20
1
140
300
9100
25
3.7
5.3
56
13
8300
9100
56
14
2800
2900
6500
4.2
43
21
14
83
350
3300
2.4
73
6.8
10
41
200
2500
200
14000
45
10
16000
9100
13000
Arabidopsis
Rice
Viral based vectors for delivery of repair template
Rep expression cassette
Rep terPromoter
sgRNA
Introduction of of precise SNP (C to T, or G to A) mutations
without any double strand break and without HDR template
THANK YOU

Weitere ähnliche Inhalte

Was ist angesagt?

Fine QTL Mapping- A step towards Marker Assisted Selection (II)
Fine QTL Mapping- A step towards Marker Assisted Selection  (II)Fine QTL Mapping- A step towards Marker Assisted Selection  (II)
Fine QTL Mapping- A step towards Marker Assisted Selection (II)Mahesh Hampannavar
 
MAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvementMAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvementDr. Asit Prasad Dash
 
Allele mining in crop improvement
Allele mining in crop improvementAllele mining in crop improvement
Allele mining in crop improvementGAYATRI KUMAWAT
 
Genome editing tools in plants
Genome editing tools in plantsGenome editing tools in plants
Genome editing tools in plantsSAIMA BARKI
 
Tilling & eco tilling indrajay delvadiya
Tilling & eco tilling indrajay delvadiyaTilling & eco tilling indrajay delvadiya
Tilling & eco tilling indrajay delvadiyaDr. Indrajay R. Delvadiya
 
Map based gene cloning in plant.pptx
Map based gene cloning in plant.pptxMap based gene cloning in plant.pptx
Map based gene cloning in plant.pptxBanoth Madhu
 
Marker assisted backcross breeding
Marker assisted backcross breedingMarker assisted backcross breeding
Marker assisted backcross breedingAnilkumar C
 
Role of Pangenomics for crop Improvement
Role of Pangenomics for crop ImprovementRole of Pangenomics for crop Improvement
Role of Pangenomics for crop ImprovementPatelSupriya
 
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...Sanjay Kumar
 
Reverse Breeding
Reverse Breeding Reverse Breeding
Reverse Breeding ICRISAT
 
Advances in Genomics Research and Molecular Breeding in Dryland Crops through...
Advances in Genomics Research and Molecular Breeding in Dryland Crops through...Advances in Genomics Research and Molecular Breeding in Dryland Crops through...
Advances in Genomics Research and Molecular Breeding in Dryland Crops through...apaari
 
Advanced biometrical and quantitative genetics akshay
Advanced biometrical and quantitative genetics akshayAdvanced biometrical and quantitative genetics akshay
Advanced biometrical and quantitative genetics akshayAkshay Deshmukh
 

Was ist angesagt? (20)

Allele mining
Allele miningAllele mining
Allele mining
 
Genome wide association mapping
Genome wide association mappingGenome wide association mapping
Genome wide association mapping
 
Fine QTL Mapping- A step towards Marker Assisted Selection (II)
Fine QTL Mapping- A step towards Marker Assisted Selection  (II)Fine QTL Mapping- A step towards Marker Assisted Selection  (II)
Fine QTL Mapping- A step towards Marker Assisted Selection (II)
 
MAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvementMAGIC populations and its role in crop improvement
MAGIC populations and its role in crop improvement
 
Allele mining in crop improvement
Allele mining in crop improvementAllele mining in crop improvement
Allele mining in crop improvement
 
Genome editing tools in plants
Genome editing tools in plantsGenome editing tools in plants
Genome editing tools in plants
 
Tilling & eco tilling indrajay delvadiya
Tilling & eco tilling indrajay delvadiyaTilling & eco tilling indrajay delvadiya
Tilling & eco tilling indrajay delvadiya
 
Map based gene cloning in plant.pptx
Map based gene cloning in plant.pptxMap based gene cloning in plant.pptx
Map based gene cloning in plant.pptx
 
Mapping population ppt
Mapping population pptMapping population ppt
Mapping population ppt
 
Genomic selection
Genomic  selectionGenomic  selection
Genomic selection
 
Gene pyramiding
Gene pyramidingGene pyramiding
Gene pyramiding
 
Marker assisted backcross breeding
Marker assisted backcross breedingMarker assisted backcross breeding
Marker assisted backcross breeding
 
Role of Pangenomics for crop Improvement
Role of Pangenomics for crop ImprovementRole of Pangenomics for crop Improvement
Role of Pangenomics for crop Improvement
 
TILLING & ECO-TILLING
TILLING & ECO-TILLINGTILLING & ECO-TILLING
TILLING & ECO-TILLING
 
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
Reverse Breeding: a tool to create homozygous plants from the heterozygous po...
 
Magic population
Magic populationMagic population
Magic population
 
Reverse Breeding
Reverse Breeding Reverse Breeding
Reverse Breeding
 
MAGIC POPULATION
MAGIC POPULATIONMAGIC POPULATION
MAGIC POPULATION
 
Advances in Genomics Research and Molecular Breeding in Dryland Crops through...
Advances in Genomics Research and Molecular Breeding in Dryland Crops through...Advances in Genomics Research and Molecular Breeding in Dryland Crops through...
Advances in Genomics Research and Molecular Breeding in Dryland Crops through...
 
Advanced biometrical and quantitative genetics akshay
Advanced biometrical and quantitative genetics akshayAdvanced biometrical and quantitative genetics akshay
Advanced biometrical and quantitative genetics akshay
 

Ähnlich wie Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity

Characterization and Starch Properties of a Waxy Mutant in Japonica Rice Kitaake
Characterization and Starch Properties of a Waxy Mutant in Japonica Rice KitaakeCharacterization and Starch Properties of a Waxy Mutant in Japonica Rice Kitaake
Characterization and Starch Properties of a Waxy Mutant in Japonica Rice KitaakeJournal of Agriculture and Crops
 
Developing fnCas9 vector for genome editing in rice through tissue culture
Developing fnCas9 vector for genome editing in rice through tissue cultureDeveloping fnCas9 vector for genome editing in rice through tissue culture
Developing fnCas9 vector for genome editing in rice through tissue culturePranayUpadhyay9
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringSANJAY KUMAR SANADYA
 
cytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplastscytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplastsSANJAY KUMAR SANADYA
 
Biotechnological Approaches In Crop Improvement
Biotechnological Approaches  In Crop ImprovementBiotechnological Approaches  In Crop Improvement
Biotechnological Approaches In Crop ImprovementMahbubul Hassan
 
Tropical maize genome: what do we know so far and how to use that information
Tropical maize genome: what do we know so far and how to use that informationTropical maize genome: what do we know so far and how to use that information
Tropical maize genome: what do we know so far and how to use that informationCIMMYT
 
Base editing in plants
Base editing in plantsBase editing in plants
Base editing in plantsDivya S
 
CRISPR-Cas: for crop improvement
CRISPR-Cas: for crop improvementCRISPR-Cas: for crop improvement
CRISPR-Cas: for crop improvementSajid Sheikh
 
Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...
Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...
Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...CrimsonpublishersMCDA
 
Correction IARS syndrome using CRISPR/Cas9 in Japanese Black Cattle
Correction IARS syndrome using CRISPR/Cas9 in Japanese Black CattleCorrection IARS syndrome using CRISPR/Cas9 in Japanese Black Cattle
Correction IARS syndrome using CRISPR/Cas9 in Japanese Black CattleBoon Keat Ngan
 
Gene Editing for everyone
Gene Editing for everyoneGene Editing for everyone
Gene Editing for everyoneMike Jowett
 
CRISPR: Gene editing for everyone
CRISPR: Gene editing for everyoneCRISPR: Gene editing for everyone
CRISPR: Gene editing for everyoneCandy Smellie
 
CRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To WheatCRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To WheatFabio Caligaris
 

Ähnlich wie Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity (20)

Characterization and Starch Properties of a Waxy Mutant in Japonica Rice Kitaake
Characterization and Starch Properties of a Waxy Mutant in Japonica Rice KitaakeCharacterization and Starch Properties of a Waxy Mutant in Japonica Rice Kitaake
Characterization and Starch Properties of a Waxy Mutant in Japonica Rice Kitaake
 
Crispr cas9
Crispr cas9Crispr cas9
Crispr cas9
 
CRISP_ana.pptx
CRISP_ana.pptxCRISP_ana.pptx
CRISP_ana.pptx
 
Developing fnCas9 vector for genome editing in rice through tissue culture
Developing fnCas9 vector for genome editing in rice through tissue cultureDeveloping fnCas9 vector for genome editing in rice through tissue culture
Developing fnCas9 vector for genome editing in rice through tissue culture
 
Oryza sativa
Oryza sativaOryza sativa
Oryza sativa
 
CRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in riceCRISPR mediated haploid inducer stock development in rice
CRISPR mediated haploid inducer stock development in rice
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineering
 
cytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplastscytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplasts
 
Biotechnological Approaches In Crop Improvement
Biotechnological Approaches  In Crop ImprovementBiotechnological Approaches  In Crop Improvement
Biotechnological Approaches In Crop Improvement
 
Tropical maize genome: what do we know so far and how to use that information
Tropical maize genome: what do we know so far and how to use that informationTropical maize genome: what do we know so far and how to use that information
Tropical maize genome: what do we know so far and how to use that information
 
Base editing in plants
Base editing in plantsBase editing in plants
Base editing in plants
 
Bioteknologi
BioteknologiBioteknologi
Bioteknologi
 
Mohammed ayaad
Mohammed ayaadMohammed ayaad
Mohammed ayaad
 
CRISPR /Cas9
CRISPR /Cas9CRISPR /Cas9
CRISPR /Cas9
 
CRISPR-Cas: for crop improvement
CRISPR-Cas: for crop improvementCRISPR-Cas: for crop improvement
CRISPR-Cas: for crop improvement
 
Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...
Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...
Recent Milestones Achieved in Rice Genomes: Hurdles and Future Strategies by ...
 
Correction IARS syndrome using CRISPR/Cas9 in Japanese Black Cattle
Correction IARS syndrome using CRISPR/Cas9 in Japanese Black CattleCorrection IARS syndrome using CRISPR/Cas9 in Japanese Black Cattle
Correction IARS syndrome using CRISPR/Cas9 in Japanese Black Cattle
 
Gene Editing for everyone
Gene Editing for everyoneGene Editing for everyone
Gene Editing for everyone
 
CRISPR: Gene editing for everyone
CRISPR: Gene editing for everyoneCRISPR: Gene editing for everyone
CRISPR: Gene editing for everyone
 
CRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To WheatCRISPR Is On The Move: Genome Editing From Rice To Wheat
CRISPR Is On The Move: Genome Editing From Rice To Wheat
 

Mehr von apaari

Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...apaari
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...apaari
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...apaari
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...apaari
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...apaari
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...apaari
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...apaari
 
Transformation of Agricultural Innovation System, the Roleof the National Agr...
Transformation of Agricultural Innovation System, the Roleof the National Agr...Transformation of Agricultural Innovation System, the Roleof the National Agr...
Transformation of Agricultural Innovation System, the Roleof the National Agr...apaari
 
The Role of Knowledge Management in Agricultural Innovation Systems (AIS)
The Role of Knowledge Management in Agricultural Innovation Systems (AIS)The Role of Knowledge Management in Agricultural Innovation Systems (AIS)
The Role of Knowledge Management in Agricultural Innovation Systems (AIS)apaari
 
Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...
Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...
Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...apaari
 
APAARI Webinar with Universities on Capacity Development for Agricultural Inn...
APAARI Webinar with Universities on Capacity Development for Agricultural Inn...APAARI Webinar with Universities on Capacity Development for Agricultural Inn...
APAARI Webinar with Universities on Capacity Development for Agricultural Inn...apaari
 
Biosafety Assessment and Regulations of Gene Editing
Biosafety Assessment and Regulations of Gene Editing Biosafety Assessment and Regulations of Gene Editing
Biosafety Assessment and Regulations of Gene Editing apaari
 
The Regulatory Status of Genome Editing Technology in Thailand
The Regulatory Status of Genome Editing Technology in Thailand The Regulatory Status of Genome Editing Technology in Thailand
The Regulatory Status of Genome Editing Technology in Thailand apaari
 
Regulatory Status of Gene Editing: Philippines
Regulatory Status of Gene Editing: PhilippinesRegulatory Status of Gene Editing: Philippines
Regulatory Status of Gene Editing: Philippinesapaari
 
Regulatory Status of Genome Editing in Vietnam
Regulatory Status of Genome Editing in Vietnam Regulatory Status of Genome Editing in Vietnam
Regulatory Status of Genome Editing in Vietnam apaari
 
Current Status of Gene-editing Product and Relative Regulations in Taiwan
Current Status of Gene-editing Product and Relative Regulations in Taiwan Current Status of Gene-editing Product and Relative Regulations in Taiwan
Current Status of Gene-editing Product and Relative Regulations in Taiwan apaari
 
Japanese Regulatory Policy of Genome Editing Technology
Japanese Regulatory Policy of Genome Editing TechnologyJapanese Regulatory Policy of Genome Editing Technology
Japanese Regulatory Policy of Genome Editing Technologyapaari
 
Regulatory Status of Gene Editing in the Pacific SIDS
Regulatory Status of Gene Editing in the Pacific SIDSRegulatory Status of Gene Editing in the Pacific SIDS
Regulatory Status of Gene Editing in the Pacific SIDSapaari
 
Global Regulatory Status of Gene Edited Products
Global Regulatory Status of Gene Edited Products Global Regulatory Status of Gene Edited Products
Global Regulatory Status of Gene Edited Products apaari
 
Gene editing with CRISPR/Cas9: sorghum as a case study
Gene editing with CRISPR/Cas9: sorghum as a case studyGene editing with CRISPR/Cas9: sorghum as a case study
Gene editing with CRISPR/Cas9: sorghum as a case studyapaari
 

Mehr von apaari (20)

Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
 
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
Asia Pesticide Residue Mitigation through the Promotion of Biopesticides and ...
 
Transformation of Agricultural Innovation System, the Roleof the National Agr...
Transformation of Agricultural Innovation System, the Roleof the National Agr...Transformation of Agricultural Innovation System, the Roleof the National Agr...
Transformation of Agricultural Innovation System, the Roleof the National Agr...
 
The Role of Knowledge Management in Agricultural Innovation Systems (AIS)
The Role of Knowledge Management in Agricultural Innovation Systems (AIS)The Role of Knowledge Management in Agricultural Innovation Systems (AIS)
The Role of Knowledge Management in Agricultural Innovation Systems (AIS)
 
Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...
Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...
Conceptual Model on Establishing Agricultural Knowledge Sharing Network of Ir...
 
APAARI Webinar with Universities on Capacity Development for Agricultural Inn...
APAARI Webinar with Universities on Capacity Development for Agricultural Inn...APAARI Webinar with Universities on Capacity Development for Agricultural Inn...
APAARI Webinar with Universities on Capacity Development for Agricultural Inn...
 
Biosafety Assessment and Regulations of Gene Editing
Biosafety Assessment and Regulations of Gene Editing Biosafety Assessment and Regulations of Gene Editing
Biosafety Assessment and Regulations of Gene Editing
 
The Regulatory Status of Genome Editing Technology in Thailand
The Regulatory Status of Genome Editing Technology in Thailand The Regulatory Status of Genome Editing Technology in Thailand
The Regulatory Status of Genome Editing Technology in Thailand
 
Regulatory Status of Gene Editing: Philippines
Regulatory Status of Gene Editing: PhilippinesRegulatory Status of Gene Editing: Philippines
Regulatory Status of Gene Editing: Philippines
 
Regulatory Status of Genome Editing in Vietnam
Regulatory Status of Genome Editing in Vietnam Regulatory Status of Genome Editing in Vietnam
Regulatory Status of Genome Editing in Vietnam
 
Current Status of Gene-editing Product and Relative Regulations in Taiwan
Current Status of Gene-editing Product and Relative Regulations in Taiwan Current Status of Gene-editing Product and Relative Regulations in Taiwan
Current Status of Gene-editing Product and Relative Regulations in Taiwan
 
Japanese Regulatory Policy of Genome Editing Technology
Japanese Regulatory Policy of Genome Editing TechnologyJapanese Regulatory Policy of Genome Editing Technology
Japanese Regulatory Policy of Genome Editing Technology
 
Regulatory Status of Gene Editing in the Pacific SIDS
Regulatory Status of Gene Editing in the Pacific SIDSRegulatory Status of Gene Editing in the Pacific SIDS
Regulatory Status of Gene Editing in the Pacific SIDS
 
Global Regulatory Status of Gene Edited Products
Global Regulatory Status of Gene Edited Products Global Regulatory Status of Gene Edited Products
Global Regulatory Status of Gene Edited Products
 
Gene editing with CRISPR/Cas9: sorghum as a case study
Gene editing with CRISPR/Cas9: sorghum as a case studyGene editing with CRISPR/Cas9: sorghum as a case study
Gene editing with CRISPR/Cas9: sorghum as a case study
 

Kürzlich hochgeladen

call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...saminamagar
 
Angels_EDProgrammes & Services 2024.pptx
Angels_EDProgrammes & Services 2024.pptxAngels_EDProgrammes & Services 2024.pptx
Angels_EDProgrammes & Services 2024.pptxLizelle Coombs
 
call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️saminamagar
 
(多少钱)Dal毕业证国外本科学位证
(多少钱)Dal毕业证国外本科学位证(多少钱)Dal毕业证国外本科学位证
(多少钱)Dal毕业证国外本科学位证mbetknu
 
Disciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdf
Disciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdfDisciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdf
Disciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdfDeLeon9
 
history of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptxhistory of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptxhellokittymaearciaga
 
Club of Rome: Eco-nomics for an Ecological Civilization
Club of Rome: Eco-nomics for an Ecological CivilizationClub of Rome: Eco-nomics for an Ecological Civilization
Club of Rome: Eco-nomics for an Ecological CivilizationEnergy for One World
 
2024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 272024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 27JSchaus & Associates
 
How the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersHow the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersCongressional Budget Office
 
call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️saminamagar
 
Call Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls Service
Call Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls ServiceCall Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls Service
Call Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls Servicenarwatsonia7
 
call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️saminamagar
 
Panet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRILPanet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRILChristina Parmionova
 
call girls in sector 22 Gurgaon 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in sector 22 Gurgaon  🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in sector 22 Gurgaon  🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in sector 22 Gurgaon 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️saminamagar
 
call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️saminamagar
 
2023 Ecological Profile of Ilocos Norte.pdf
2023 Ecological Profile of Ilocos Norte.pdf2023 Ecological Profile of Ilocos Norte.pdf
2023 Ecological Profile of Ilocos Norte.pdfilocosnortegovph
 
Powering Britain: Can we decarbonise electricity without disadvantaging poore...
Powering Britain: Can we decarbonise electricity without disadvantaging poore...Powering Britain: Can we decarbonise electricity without disadvantaging poore...
Powering Britain: Can we decarbonise electricity without disadvantaging poore...ResolutionFoundation
 
Enhancing Indigenous Peoples' right to self-determination in the context of t...
Enhancing Indigenous Peoples' right to self-determination in the context of t...Enhancing Indigenous Peoples' right to self-determination in the context of t...
Enhancing Indigenous Peoples' right to self-determination in the context of t...Christina Parmionova
 
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdfYHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdfyalehistoricalreview
 

Kürzlich hochgeladen (20)

call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
call girls in West Patel Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service ...
 
Angels_EDProgrammes & Services 2024.pptx
Angels_EDProgrammes & Services 2024.pptxAngels_EDProgrammes & Services 2024.pptx
Angels_EDProgrammes & Services 2024.pptx
 
call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Narela DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
 
Hot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort Service
Hot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort ServiceHot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort Service
Hot Sexy call girls in Palam Vihar🔝 9953056974 🔝 escort Service
 
(多少钱)Dal毕业证国外本科学位证
(多少钱)Dal毕业证国外本科学位证(多少钱)Dal毕业证国外本科学位证
(多少钱)Dal毕业证国外本科学位证
 
Disciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdf
Disciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdfDisciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdf
Disciplines-and-Ideas-in-the-Applied-Social-Sciences-DLP-.pdf
 
history of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptxhistory of 1935 philippine constitution.pptx
history of 1935 philippine constitution.pptx
 
Club of Rome: Eco-nomics for an Ecological Civilization
Club of Rome: Eco-nomics for an Ecological CivilizationClub of Rome: Eco-nomics for an Ecological Civilization
Club of Rome: Eco-nomics for an Ecological Civilization
 
2024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 272024: The FAR, Federal Acquisition Regulations - Part 27
2024: The FAR, Federal Acquisition Regulations - Part 27
 
How the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists LawmakersHow the Congressional Budget Office Assists Lawmakers
How the Congressional Budget Office Assists Lawmakers
 
call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Tilak Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
 
Call Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls Service
Call Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls ServiceCall Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls Service
Call Girls Service AECS Layout Just Call 7001305949 Enjoy College Girls Service
 
call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Punjabi Bagh DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
 
Panet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRILPanet vs.Plastics - Earth Day 2024 - 22 APRIL
Panet vs.Plastics - Earth Day 2024 - 22 APRIL
 
call girls in sector 22 Gurgaon 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in sector 22 Gurgaon  🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in sector 22 Gurgaon  🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in sector 22 Gurgaon 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
 
call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
call girls in Kirti Nagar DELHI 🔝 >༒9540349809 🔝 genuine Escort Service 🔝✔️✔️
 
2023 Ecological Profile of Ilocos Norte.pdf
2023 Ecological Profile of Ilocos Norte.pdf2023 Ecological Profile of Ilocos Norte.pdf
2023 Ecological Profile of Ilocos Norte.pdf
 
Powering Britain: Can we decarbonise electricity without disadvantaging poore...
Powering Britain: Can we decarbonise electricity without disadvantaging poore...Powering Britain: Can we decarbonise electricity without disadvantaging poore...
Powering Britain: Can we decarbonise electricity without disadvantaging poore...
 
Enhancing Indigenous Peoples' right to self-determination in the context of t...
Enhancing Indigenous Peoples' right to self-determination in the context of t...Enhancing Indigenous Peoples' right to self-determination in the context of t...
Enhancing Indigenous Peoples' right to self-determination in the context of t...
 
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdfYHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
YHR Fall 2023 Issue (Joseph Manning Interview) (2).pdf
 

Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity

  • 1. M K REDDY GROUP LEADER CROP IMPROVEMENT GROUP INTERNATIONAL CENTRE FOR GENETIC ENGINEERING AND BIOTECHNOLOGY Editing rice-genome with CRISPR/Cas9: To improve agronomic traits for increased crop productivity
  • 2. One can edit any genome by expressing Cas9 Protein and gRNA Maize Ubiquitin Promoter Cas9 NOS terminator Rice U6 Promoter sgRNA Terminator
  • 3. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  • 4. 1234567891011121314151617MPN PCR Screening transgenic plants for Cas9 integration PCRamplificationoftargetregionfromtheCas9positivetransgeneiclines 1 2 3 4 5 6 7 10 11 13 14 15168 9 12 17 Generating Cas9 and sgRNA expressing transgenic rice
  • 5. Single allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines GGCGGGCAAGGCGTCGACGCCGG
  • 6.
  • 7. GCAAGAACAATTGAGGCACCTTGG ControlriceplantEditedriceplant Bi-allelic DEP1 (Os09g26999) editing in rice MTU1010 cultivar
  • 8.
  • 9. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  • 10.
  • 11. Bi-allelic rice TB1 (Os03g49880) locus editing in different MTU1010 edited lines
  • 12.
  • 13. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  • 14. Cytokinin Oxidase Regulates Rice spike architecture and increase he grain number • The rice OsCKX2 differentially expresses in rice inflorescence • Cytokinin oxidase degrades cytokine and negatively regulates the inflorescence branching • Absence of OsCKX2 expression cytokine accumulation and increases the grain number Ashikari et al 2005 Science: 309, 741-745
  • 15. GACGTCGAGCTCTAGCACGTTGG TWO NUCLETIDE DELEATION IN CKX2 GENE IN RICE MTU1010
  • 16.
  • 17. MTU1010 high yielding popular rice mega-verity Cas9 & sgRNA encoding genes Together cloned into single plant transformation vector Agrobacterium mediated Rice transformation & regeneration Cas9 & sgRNA expressing Transgenic rice plants were identified Targeted genome edited rice plants were identified Transgenic component free genome edited rice lines generated Through sequence analysis Through Molecular analysis Segregating out the transgenic component Cas9 and sgRNA Through crossing, selfing and subsequent selection Putative transgenic rice plants generated OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line OsCKX2 (Os08g0509600) knockout rice line OsGW2 (Os02g2914720) knockout rice line Non-transgenic high yielding genome edited rice lines Background work done related to the project
  • 18. GW2 QTL for rice grain and weight encodes a RING-type E3 ubiquitin ligase GW2 loss of function increased cell divisions in spikelet hull resulting in enhanced grain width, weight and yield GW2: Os02g14720
  • 19. PCR fragment cut with Sca1 (AGTACT) edited line will cut control won’t Cut
  • 20.
  • 21. OsDEP1 (Os09g26999) knockout rice line OsTB1 (Os03g49880) knockout rice line
  • 22. RBLB WDV ALS repair template A P W S 96 171 548 627 122 197 574 653 Four known ALS herbicide resistance endowing mutations Chlorsulfuron Bensulfuron methyl Imazaquin Imazapyr Bispyribac sodium Pyrithiobac sodium Pyriminobac A/V P/S W/L S/I 10 190 55 14 20 1 140 300 9100 25 3.7 5.3 56 13 8300 9100 56 14 2800 2900 6500 4.2 43 21 14 83 350 3300 2.4 73 6.8 10 41 200 2500 200 14000 45 10 16000 9100 13000 Arabidopsis Rice Viral based vectors for delivery of repair template Rep expression cassette Rep terPromoter sgRNA
  • 23. Introduction of of precise SNP (C to T, or G to A) mutations without any double strand break and without HDR template