DNA Barcoding allows us to identify any species from its DNA

1. DNA Barcoding and
Undergraduate Science
A Case Study

2. ACGAGTCGGTAGCTGCCCTCTGACTGCA
TCGAATTGCTCCCCTACTACGTGCTATA
TGCGCTTACGATCGTACGAAGATTTAT
AGAATGCTGCTAGCTGCTCCCTTATTCG
ATAACTAGCTCGATTATAGCTACGATG
Organism is sampled DNA is extracted “Barcode” amplified
Sequenced DNA is compared with a barcode database
How DNA barcoding works

3. 7/31/2014 3
Major database for DNA Barcode data is BOLD

4. DNA Barcoding-Why Do it?
•Species are vanishing quickly-barcoding allows non-experts
to identify species without needing to be a trained taxonomist
and in a short period of time
•Allows us to document all species in an ecosystem relatively
quickly, helps with conservation efforts
•Is now being used to test the labelling on food products and
to aid quarantine efforts to stop the trade in endangered
species
31/07/2014 4

5. DNA barcoding is engaging in the
classroom, and directs curiosity to
opportunities for practical inquiry…

6. 7/31/2014 6
Education and DNA Barcode projects in the USA
2 MAJOR PROJECTS,
2 Different approaches
1. Urban Barcode Project: small
groups of high students matched
with a mentor, devise project,
compete for a prize. Projects
derive data from species and food
products in NYC urban area

7. 7/31/2014 7
2. Coastal Marine Biolabs are
leading a student-centered
campaign, Barcoding Life’s
Matrix, to generate reference
barcodes for fish and
invertebrate species that provide
vital signs of marine ecosystem
health. Student groups attend a
residential camp, and assist
scientists in collection, DNA
extraction, PCR and data analysis
of species in an area of Southern
California
Education and DNA Barcode projects in the USA

8. 31 July 2014 8
Outline of Holmesglen Projects
Students doing Diploma of Laboratory Technology (2 years).
leads to jobs as lab techs or research assistants, or students
go on to higher degrees.
Ages ~19-45.
Carried out over 8 weeks. Printed project booklet given out to
each student.
Assessed by presentation at departmental seminar and
printed report in scientific report format

9. Outline of Holmesglen Projects .
Holmesglen has incorporated elements of both the USA projects
2012 our projects similar to the NYC Urban Barcode Project.
2013 students spent an extended period in a remote area making
collections, project more similar to CMB
2014………….??
31/07/2014 9

10. Week 1. Brainstorming Session
Decide on a question they would like to answer and draw
up a plan for how to do this. (eg what chillie species are
grown and sold in Melbourne, what species can be found
in a rainforest area in the Rubicon state forest?)
They should also develop a hypothesis (eg that you will
find a variety of species labeled as “flake”. flake is a
generic name for shark in Australia.)
31/07/2014 10

11. Weeks 2-4 Sample Collection, Genomic DNA Extraction, PCR
Students visiting
markets or out in field
Take pics of samples
and record other data
with DNA Barcode
app for iPad and
iPhone (Android app
in pipeline)
11

12. 7/31/2014 12
RLC and Rubicon State Forest

13. 7/31/2014 13
RLC and Rubicon State Forest

14. Week 5. Analysis of
Sequencing Data
Then put forward and reverse
trace sequences into DNA
subway (part of the Urban
Barcode Project
Or
Student Data Portal of BOLD
(SDP) The SDP has a very
intuitive interface, and has extra
features which from an educator’s
point of view are very useful,
such as the ability to monitor
student groups easily, to accept
or reject data, and to record
which students did which work31/07/2014 14

15. Week 6. Input Data to Atlas of Living Australia and BOLD
Our students inputted
plant species data into the
Atlas, which has links with
the international site,
Barcode of Life Database (
BOLD).
Fish sample data was
inputted directly to BOLD
through the SPD
This data is real
scientific data
31/07/2014 15

16. 7/31/2014 16

17. Week 8. Seminar Presentations
Final seminar: Invite other staff and students, people
from outside school
My students complained that the audience wasn’t big
enough!
31/07/2014 17

18. Holmesglen Barcoding
Website
31/07/2014 18

19. Educational Benefits!
•Student engagement, motivation
•Learning to do real science
•Resume building
•Using a range of skills (PBL) (chemistry, maths)
•Independence, problem solving
31/07/2014 19