SlideShare ist ein Scribd-Unternehmen logo
1 von 1
Downloaden Sie, um offline zu lesen
BecA-ILRI
                                     Bioinformatics Platform
   What is Bioinformatics?

   Bioinformatics is a rapidly developing branch of Information Technology that seeks to exploit the wealth of genome and
   expressed sequence tag (EST) data that has been generated in the last decade. Bioinformatics offers tremendous opportunities
   and has great potential to underpin biotechnological solutions to agricultural development constraints.

   In short, bioinformatics is the key to understanding the molecule of life, DNA

   DNA - Information flow in the molecule of life

                                                         AT GATTAT G G A CA CTTCTTT G
                                                         AAAAATAAT GAT G G A G CTTTA
                                                         G AA G CT GATAACAAAAATTAT
                                                         CAA GATTATAAA G CT G A G C CT
                                                  Gene   G ATAAAACAA G C G AT GTATTA
                                                         G AT GTTACTAAATATAATTCA
                                                         GT G GTA G ATT GTT G C CATAAA
                                                         AATTATTCAACATTTACATCT
                                                         G AAT G GTATATTAAT GAAA G A
                                                         AAATATAAT GAT GTTC CA G AA
                                                         G G A C CAAAAAAT GATTAT G G
                                                         ACA CTTCTTT GAAAAATAAT G
                                                         AT G G A G CTTTA GAA G CT GAT
                                                         AACAAAAATTATCAA G ATT
           Cell        Chromosome       DNA              DNA sequence                           Protein           Livestock, crops, microorganisms

              Impact of Bioinformatics                                                           BecA-ILRI Bioinformatics Platform
                                                                                                   for eastern and central Africa
Bioinformatics is the application of information technology and
computer science to the field of molecular biology. Its primary
                                                                                         The BecA-ILRI Bioinformatics Platform provides
application has been in genomics involving large-scale DNA
sequencing. Some areas that have been significantly
                                                                                         advanced computational capabilities in bioinformatics to
influenced include:                                                                      all BecA-ILRI scientists and provide training in all aspects
                                                                                         of bioinformatics.
    Crop improvement
    •Nutritional enhancement                                                             The platform provides:
    •Insect pest resistance                                                               access to major sequence databases (USA, EU, etc…)
    •Molecular breeding                                                                   access to specialized hardware and sophisticated
    •Drought tolerance                                                                   commercial and academic software
                                                                                          sophisticated data analysis capabilities
                    Vaccine and diagnostics                                               access to High performance computing services and
                     Livestock diseases                                                  grids (CGIAR, EU, USA, etc …)
                     Human diseases

    Microbial biotechnology                                                                                              Research Institutes
    Design microorganisms for:                                                                                              Universities
     Cleaning up waste
     Alternative energy

                                                                                         European Molecular Biology Network                Web interface
                                                                                         EMBRACE Network of Excellence
Current Projects using Bioinformatics platform                                           e-Infrastructure (EELA, GEANT, EGEE)
                                                                                                                                           Direct access

                                                                                         Advanced Research Institutes (EU, USA)                 Broadband
                                                                                                                                                  Internet
Crop improvement                                                                                           Broadband
 Biotechnology applications to combat Cassava Brown Streak                                                   Internet
Disease
 Development of genetic fingerprints for groundnut and pigeon
pea
 Fine mapping of Striga resistance in sorghum
 Marker assisted breeding for drought resistance in sorghum

Vaccines and diagnostics                                                                                                 Direct access
 Integrated response system for emerging infectious diseases in                                                          Web services
East Africa
 East Coast fever recombinant vaccine development                                                                          Broadband
 Contagious bovine pleuropneumonia (CBPP) diagnostic and                                                                     Internet
vaccine development                                                                       CGIAR – HPC Grid
 Development of new diagnostic assays and epidemiological                                 ILRI – Kenya (64 CPUs)                              BecA-ILRI
surveillance of viral pathogens of livestock in Africa                                    IRRI – Philippines (16 CPUs)                      Bioinformatics
 Bioinformatics capacity building                                                         ICRISAT – India (8CPUs)                              platform
                                                                                          CIP – Peru (8 CPUs)




                                                                                                                                           ILRI
                                                                                                                               INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE

Weitere ähnliche Inhalte

Was ist angesagt?

Was ist angesagt? (6)

Session 5: Decision making for eradication and quarantine zones
Session 5: Decision making for eradication and quarantine zonesSession 5: Decision making for eradication and quarantine zones
Session 5: Decision making for eradication and quarantine zones
 
ImmunoCellular Company presentation
ImmunoCellular Company presentationImmunoCellular Company presentation
ImmunoCellular Company presentation
 
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
Session 2: Genome-Informed Diagnostics - In-field Detection of Bacterial Plan...
 
Virus and viroid testing of solanaceous and cucurbit seed shipments to Australia
Virus and viroid testing of solanaceous and cucurbit seed shipments to AustraliaVirus and viroid testing of solanaceous and cucurbit seed shipments to Australia
Virus and viroid testing of solanaceous and cucurbit seed shipments to Australia
 
Session 2: Next generation national fruit fly diagnostics and handbook
Session 2: Next generation national fruit fly diagnostics and handbookSession 2: Next generation national fruit fly diagnostics and handbook
Session 2: Next generation national fruit fly diagnostics and handbook
 
Next generation national fruit fly diagnostics and handbook
Next generation national fruit fly diagnostics and handbookNext generation national fruit fly diagnostics and handbook
Next generation national fruit fly diagnostics and handbook
 

Ähnlich wie BeCA-ILRI Bioinformatics Platform

Ähnlich wie BeCA-ILRI Bioinformatics Platform (20)

BecA Hub/ILRI Bioinformatics Platform
BecA Hub/ILRI Bioinformatics PlatformBecA Hub/ILRI Bioinformatics Platform
BecA Hub/ILRI Bioinformatics Platform
 
Animal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningAnimal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep Learning
 
Modern biotechnology Dr Nataporn Chanvarasuth
Modern biotechnology  Dr Nataporn ChanvarasuthModern biotechnology  Dr Nataporn Chanvarasuth
Modern biotechnology Dr Nataporn Chanvarasuth
 
20121120 sf-india
20121120 sf-india20121120 sf-india
20121120 sf-india
 
BecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsBecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platforms
 
Bioinformatics, its application main
Bioinformatics, its application mainBioinformatics, its application main
Bioinformatics, its application main
 
Bioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformaticsBioinformatica 29-09-2011-t1-bioinformatics
Bioinformatica 29-09-2011-t1-bioinformatics
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology Keynote
 
Bioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureBioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and Future
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08
 
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
Artificial Intelligence In Agriculture: Crop Disease Detection And Monitoring...
 
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
 
AI to track plant diseases_S.Srinivasnaik.pdf
AI to track plant diseases_S.Srinivasnaik.pdfAI to track plant diseases_S.Srinivasnaik.pdf
AI to track plant diseases_S.Srinivasnaik.pdf
 
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNINGRICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
RICE LEAF DISEASES CLASSIFICATION USING CNN WITH TRANSFER LEARNING
 
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
IRJET - Research on Traceability of Agricultural Product based Mostly on Net ...
 
Genome sequencing in food and agriculture
Genome sequencing in food and agricultureGenome sequencing in food and agriculture
Genome sequencing in food and agriculture
 
Compute for Cancer - Isaiah Blackburn
Compute for Cancer - Isaiah BlackburnCompute for Cancer - Isaiah Blackburn
Compute for Cancer - Isaiah Blackburn
 
Applications of information technology in agriculture ws ns for environmental...
Applications of information technology in agriculture ws ns for environmental...Applications of information technology in agriculture ws ns for environmental...
Applications of information technology in agriculture ws ns for environmental...
 
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
 
Day 2 (Lecture 4): Machine Learning Applications in Health Care
Day 2 (Lecture 4): Machine Learning Applications in Health CareDay 2 (Lecture 4): Machine Learning Applications in Health Care
Day 2 (Lecture 4): Machine Learning Applications in Health Care
 

Mehr von ILRI

Mehr von ILRI (20)

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne disease
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countries
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMIC
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern Africa
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the field
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in Uganda
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwa
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogs
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformation
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
 

Kürzlich hochgeladen

Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
panagenda
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
Joaquim Jorge
 

Kürzlich hochgeladen (20)

🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
GenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdfGenAI Risks & Security Meetup 01052024.pdf
GenAI Risks & Security Meetup 01052024.pdf
 
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemkeProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
 
Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)A Domino Admins Adventures (Engage 2024)
A Domino Admins Adventures (Engage 2024)
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)
 

BeCA-ILRI Bioinformatics Platform

  • 1. BecA-ILRI Bioinformatics Platform What is Bioinformatics? Bioinformatics is a rapidly developing branch of Information Technology that seeks to exploit the wealth of genome and expressed sequence tag (EST) data that has been generated in the last decade. Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural development constraints. In short, bioinformatics is the key to understanding the molecule of life, DNA DNA - Information flow in the molecule of life AT GATTAT G G A CA CTTCTTT G AAAAATAAT GAT G G A G CTTTA G AA G CT GATAACAAAAATTAT CAA GATTATAAA G CT G A G C CT Gene G ATAAAACAA G C G AT GTATTA G AT GTTACTAAATATAATTCA GT G GTA G ATT GTT G C CATAAA AATTATTCAACATTTACATCT G AAT G GTATATTAAT GAAA G A AAATATAAT GAT GTTC CA G AA G G A C CAAAAAAT GATTAT G G ACA CTTCTTT GAAAAATAAT G AT G G A G CTTTA GAA G CT GAT AACAAAAATTATCAA G ATT Cell Chromosome DNA DNA sequence Protein Livestock, crops, microorganisms Impact of Bioinformatics BecA-ILRI Bioinformatics Platform for eastern and central Africa Bioinformatics is the application of information technology and computer science to the field of molecular biology. Its primary The BecA-ILRI Bioinformatics Platform provides application has been in genomics involving large-scale DNA sequencing. Some areas that have been significantly advanced computational capabilities in bioinformatics to influenced include: all BecA-ILRI scientists and provide training in all aspects of bioinformatics. Crop improvement •Nutritional enhancement The platform provides: •Insect pest resistance access to major sequence databases (USA, EU, etc…) •Molecular breeding access to specialized hardware and sophisticated •Drought tolerance commercial and academic software sophisticated data analysis capabilities Vaccine and diagnostics access to High performance computing services and Livestock diseases grids (CGIAR, EU, USA, etc …) Human diseases Microbial biotechnology Research Institutes Design microorganisms for: Universities Cleaning up waste Alternative energy European Molecular Biology Network Web interface EMBRACE Network of Excellence Current Projects using Bioinformatics platform e-Infrastructure (EELA, GEANT, EGEE) Direct access Advanced Research Institutes (EU, USA) Broadband Internet Crop improvement Broadband Biotechnology applications to combat Cassava Brown Streak Internet Disease Development of genetic fingerprints for groundnut and pigeon pea Fine mapping of Striga resistance in sorghum Marker assisted breeding for drought resistance in sorghum Vaccines and diagnostics Direct access Integrated response system for emerging infectious diseases in Web services East Africa East Coast fever recombinant vaccine development Broadband Contagious bovine pleuropneumonia (CBPP) diagnostic and Internet vaccine development CGIAR – HPC Grid Development of new diagnostic assays and epidemiological ILRI – Kenya (64 CPUs) BecA-ILRI surveillance of viral pathogens of livestock in Africa IRRI – Philippines (16 CPUs) Bioinformatics Bioinformatics capacity building ICRISAT – India (8CPUs) platform CIP – Peru (8 CPUs) ILRI INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE