2. Mini-Summary
•The history of the earth is divided
into geological time periods
• These are defined by characteristic
flora and fauna
•Large-scale changes in biodiversity
were triggered by slow and rapid
environmental change
Pg
K
-Pg
(KT)
T
r-J
P-T
r
Late
D
O
-S
Today
3. SBC174/SBS110 Week 3
A. Proximate vs Ultimate?
B. Fossilization & learning from Fossils.
C. DNA & learning from DNA.
4. Why is X? Why does ?
Two types of answer:
Proximate explanations: mechanisms responsible for the trait.
(generally within the lifetime of an organism)
Ultimate explanations: fitness consequences of the trait.
(generally over many generations)
5. Some examples
•Why do waxwings migrate South in winter?
•Proximate: a mechanism in their brains senses days are
getting shorter/colder
•Ultimate: Those migrating South have been better at
surviving the winter.
•Why do human babies cry?
•Proximate explanations: cold? hunger? wants attention?
high level of a stress hormone? neural signal for pain?
•Ultimate: babies that don’t cry when they need help are less
likely to survive.
6.
7. SBC174/SBS110 Week 3
A. Proximate vs Ultimate?
B. Fossilization & learning from Fossils.
C. DNA & learning from DNA.
8. Fossils & Fossilization
1. How fossilization works. Some examples of fossils.
2. Dating fossils.
3. What we can learn from fossils?
y . wurm {@} qmul . ac .uk
9. Geological context
Three broad classes of rock:
•Sedimentary rocks: formed by particles
(mineral or organic) gradually settling out of solution,
then compacting to form rock
•Igneous rocks: formed by the cooling of magma
•Metamorphic rocks: modification of existing
rocks under high pressure and heat
10. Fossils: only in sedimentary rocks (deposited on oceanic
shorelines, lake beds, flood plains...)
Weathering or erosion can expose the older layers
12. Fossil formation at
Sterkfontein
Limestone deposits were laid
down 2.5 billion years ago when
the area was a shallow sea.
Caves eventually form below the
surface.
‘Pot holes’ form between the
surface and the caves.
Debris, including animals, fall in!
Compaction and cementing with
water and limestone produces
“Breccia”.
17. Why are fossils rare?
•Fossils don’t form often:
•Predators, scavengers, insects consume corpses
•Bacteria and fungi decompose remains
•Even faster in tropics (acid soil, warm, humid...)
•Best locations for fossil formation:
•arid deserts, deep water (with low O2), cold
•Fossils can be lost:
•mountains: lots of erosion
•Metamorphosis and subduction of rocks destroys fossils
•Most are still buried rather than exposed at the surface
26. The earliest Eutherian Mammal?
Lower Cretaceous of China, 125 Mya
Eomaia scansoria
Ji et al., (2002) Nature
416, 816-822
A climbing mammal from
a lake shore environment
28. Dinosaur footprint
•At the time, this footprint of a dinosaur pressed into soft mud and
became preserved in the now hardened rock. Can inform us on
locomotion.
29. Fossilized tracks at
Laetoli (Tanzania)
Footprints preserved in
volcanic ash from: 3 hominids
(Australopithecus afarensis)
Numerous other mammals
30. Fossil Ichthyosaur giving birth
•Such special preservations can inform us about the reproductive
pattern in this species (live birth) .
35. Fossils & Fossilization
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?
36. Dating methods
• Absolute - the item itself is dated
• Relative - strata above (younger) and below (older)
are dated and the item expressed relative to these
Best method depends on context & age.
39. Stratigraphy
As sediment collects, deeper layers are compacted by the ones
above until they harden and become rock.
Deeper Fossils are older than those above.
Thus positions within the rock layers gives fossils a chronological age.
40. Index (Zone) Fossils
•Here, Locality 3 has no layer B (wasn’t formed or eroded).
•Index fossils: diagnostic fossil species that help dating new finds
41.
42. Fossils & Fossilization
1. How fossilization happens & some examples.
2. Dating fossils
3. What we can learn from fossils?
43. What can we learn?
Fossils can sometimes directly or indirectly tell us a great
deal about the behavior of an organism, or its lifestyle
44. Interpreting fossils
•Careful interpretation: helps make sense of fossilized remains
•Analysis of hard parts can tell something about soft anatomy (e.g
where muscles are (.e.g muscle scars).
•Geology: --> environment (freshwater/marine/swamp))
•Infer from living organisms & relatives.
45. Hallucigenia sparsa (Cambrian Period)
From the Burgess Shale (Canada). Example of a soft bodied
animal fossil, also very old!
48. …or do they? (discovered fossilised melanosomes)
Colors don’t fossilize...
49.
50. Fossils - Summary
• Fossils form in sedimentary rock
• Fossilization is a rare process
• Usually, only the hard parts like bone, teeth, exoskeletons and shells
are preserved
• Fossils of different ages occur in different strata, and “index fossils” can
be used to cross-reference between different geographic locations
•Careful interpretation is required.
51. SBC174/SBS110 Week 3
A. Proximate vs Ultimate?
B. Fossilization & learning from Fossils.
C. DNA & learning from DNA.
52. DNA in evolution
•Species relationships previously based on:
•bone structures
•morphologies
•development
•behavior
•ecological niche
•....
1. DNA sequences change
2. Evolutionary relationships
3.Current evolutionary contexts
DNA holds lots of additional information:
53. 1. DNA sequences change
DNA mutations occur all the time.
Reasons:
•mistakes in DNA replication or recombination
•mutagens (radiation, chemicals)
•viruses
•transposons
Inherited: only if in germ line.
Not inherited from soma.
54. Types of mutations
•Small: replacement, insertion, deletion. E.g.:
•Big: inversions, duplications, deletions
original: TGCAGATAGAGAGAGAGAGAGAGCAGAT
new : TGCAGATAGAGAGAGAGAGCAGAT
Polymerase slippage
in satellite
original: GATTACAGATTACA
new : GATTACATATTACA
Point mutation
Mutations are the source of genetic, inheritable variation
55. What happens to a mutation?
•Most point mutations are neutral: no effect.
•Some are very deleterious;
See population genetics lectures & practical
•--> selection eliminates or fixes them
•--> Genetic drift, hitchhiking... (--> elimination or fixation)
Some increase fitness.
Eg. antennapedia (hox gene) mutation:
56. 2. DNA clarifies evolutionary
relationships between species
Human: GATTACA
Peacock: GATTGCA
Amoeba: GGCTCCA
Human
Peacock
Amoeba
See practical!
58. Molecular clock
•Basic hypothesis: more differences - more time has passed
•Allows relative timing
•Allows “absolute timing”
•But:
•rate of differentiation differs:
• between lineages
•between contexts
• small amounts of data: unreliable
Time
Geneticchange
62. •Can be ambiguous if not enough information.
An issue with sequence
phylogenies
•Whole genome sequencing is now dirt cheap! No longer a problem!
(for establishing relationships in past 200-400 million years...)
•Used to be expensive.
•Mitochondrial gene vs. nuclear gene. Several genes?
70. Ancient DNA: below 2km of icecriterion
many pu
abundanc
as is typ
efficiently
low-leve
due to D
Appr
the John
signed to
tion and
the order
genus Sa
sistent w
more tha
Arctic en
plant div
ilar to t
which co
ceae), pu
sales), an
by confir
Glacier s
trol, show
ably reco
In co
sample, t
that coul
Fig. 1. Sample location and core schematics. (A) Map showing the locations of the Dye 3 (65°11'N,
45°50'W) and GRIP (72°34'N, 37°37'W) drilling sites and the Kap København Formation (82°22'N,
REPORTS
71. Their presence indicates a northern boreal for-
est ecosystem rather than today’s Arctic environ-
ment. The other groups identified, including
Asteraceae, Fabaceae, and Poaceae, are mainly
Table 1. Plant and insect taxa obtained from the JEG and Dye 3 silty ice
samples. For each taxon (assigned to order, family, or genus level), the
genetic markers (rbcL, trnL, or COI), the number of clone sequences
supporting the identification, and the probability support (in percentage)
are shown. Sequences have been deposited in GenBank under accession
numbers EF588917 to EF588969, except for seven sequences less than 50
bp in size that are shown below. Their taxon identifications are indicated
by symbols.
Order Marker Clones Support (%) Family Marker Clones Support (%) Genus Marker Clones Support (%)
JEG sample
Rosales rbcL 3 90–99
Malpighiales rbcL
trnL
2
5
99–100
99–100
Salicaceae rbcL
trnL
2
4
99–100
100
Saxifragales rbcL 3 92–94 Saxifragaceae rbcL 2 92 Saxifraga rbcL 2 91
Dye 3 sample
Coniferales rbcL
trnL
44
27
97–100
100
Pinaceae* rbcL
trnL
20
25
100
100
Picea
Pinus†
rbcL
trnL
20
17
99–100
90–99
Taxaceae‡ rbcL
trnL
23
2
91–98
100
Poales§ rbcL
trnL
67
17
99–100
97–100
Poaceae§ rbcL
trnL
67
13
99–100
100
Asterales rbcL
trnL
18
27
90–100
100
Asteraceae rbcL
trnL
2
27
91
100
Fabales rbcL
trnL
10
3
99–100
99
Fabaceae rbcL
trnL
10
3
99–100
99
Fagales rbcL
trnL
10
12
95–99
100
Betulaceae rbcL
trnL
8
11
93–97
98–100
Alnus rbcL
trnL
7
9
91–95
98–100
Lepidoptera COI 12 97–99
*Env_2, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAAGATAGGAAGGG. Env_3, trnL ATCCGGTTCATGAAGACAATGTTTCTTCTCCTAATATAGGAAGGG. Env_4, trnL ATCCGGTTCATGAGGACAATGTTTCTTCTCCTAATA-
TAGGAAGGG. †Env_5, trnL CCCTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. Env_6, trnL TTTCCTATCTTAGGAGAAGAAACATTGTCTTCATGAACCGGAT. ‡Env_1, trnL ATCCGTATTATAG-
GAACAATAATTTTATTTTCTAGAAAAGG. §Env_7, trnL CTTTTCCTTTGTATTCTAGTTCGAGAATCCCTTCTCAAAACACGGAT.
surface (m.b.s.)] indicating the depth of the cores and the positions of the Dye 3, GRIP, and JEG
samples analyzed for DNA, DNA/amino acid racemization/luminescence (underlined), and 10
Be/36
Cl
(italic). The control GRIP samples are not shown. The lengths (in meters) of the silty sections are
also shown.
6 JULY 2007 VOL 317 SCIENCE www.sciencemag.org12
Ancient Biomolecules from
Deep Ice Cores Reveal a Forested
Southern Greenland
Eske Willerslev,1
* Enrico Cappellini,2
Wouter Boomsma,3
Rasmus Nielsen,4
Martin B. Hebsgaard,1
Tina B. Brand,1
Michael Hofreiter,5
Michael Bunce,6,7
Hendrik N. Poinar,7
Dorthe Dahl-Jensen,8
Sigfus Johnsen,8
Jørgen Peder Steffensen,8
Ole Bennike,9
Jean-Luc Schwenninger,10
Roger Nathan,10
Simon Armitage,11
Cees-Jan de Hoog,12
Vasily Alfimov,13
Marcus Christl,13
Juerg Beer,14
Raimund Muscheler,15
Joel Barker,16
Martin Sharp,16
Kirsty E. H. Penkman,2
James Haile,17
Pierre Taberlet,18
M. Thomas P. Gilbert,1
Antonella Casoli,19
Elisa Campani,19
Matthew J. Collins2
It is difficult to obtain fossil data from the 10% of Earth’s terrestrial surface that is covered by thick
glaciers and ice sheets, and hence, knowledge of the paleoenvironments of these regions has
remained limited. We show that DNA and amino acids from buried organisms can be recovered
from the basal sections of deep ice cores, enabling reconstructions of past flora and fauna. We
show that high-altitude southern Greenland, currently lying below more than 2 kilometers of ice,
was inhabited by a diverse array of conifer trees and insects within the past million years. The
results provide direct evidence in support of a forested southern Greenland and suggest that many
deep ice cores may contain genetic records of paleoenvironments in their basal sections.
T
he environmental histories of high-latitude
regions such as Greenland and Antarctica
are poorly understood because much of
the fossil evidence is hidden below kilometer-
thick ice sheets (1–3). We test the idea that the
basal sections of deep ice cores can act as
archives for ancient biomolecules.
The samples studied come from the basal
impurity-rich (silty) ice sections of the 2-km-
long Dye 3 core from south-central Greenland
(4), the 3-km-long Greenland Ice Core Project
(GRIP) core from the summit of the Greenland
ice sheet (5), and the Late Holocene John Evans
Glacier on Ellesmere Island, Nunavut, northern
Canada (Fig. 1). The last-mentioned sample was
included as a control to test for potential exotic
DNA because the glacier has recently overridden
a land surface with a known vegetation cover
(6). As an additional test for long-distance
atmospheric dispersal of DNA, we included
face of the froze
control for pote
have entered the
cracks or during
Polymerase chain
the plasmid DNA
tracts of the outer
interior, confirmi
had not penetrate
Using PCR, w
short amplicons
the chloroplast D
trnL intron from
from the Dye 3 a
samples. From D
amplicons of inv
subunit I (COI) m
Attempts to repr
the GRIP silty ice
Formation sedime
results are consis
mization data d
vation of biomol
Evans Glacier s
because these sa
younger (John E
sample (Fig. 1A,
DNA from the fiv
and Pleistocene i
samples from the
(volumes: 100 g
the samples studi
of vertebrate mtD
A previous stu
parisons of short
sequences by me
ment Search Tool
tion likely (15).
1
Centre for Ancient Genetics, University of Copenhagen,
Denmark. 2
BioArch, Departments of Biology and Archaeology,
University of York, UK. 3
Bioinformatics Centre, University of
Copenhagen, Denmark. 4
Centre for Comparative Genomics,
University of Copenhagen, Denmark. 5
Max Planck Institute for
Evolutionary Anthropology, Germany. 6
Murdoch University Willerslev 2007
Spruce
Pine
Birch
Legumes
Butterflies
Daisies/Sunflower
Grasses
73. Molecular evolution analysis:
•Earliest placental mammals (ie. eutherians)
•body mass >1kg; lifespan >25years
Genomic Evidence for Large, Long-Lived Ancestors to
Placental Mammals
J. Romiguier,1
V. Ranwez,1,2
E.J.P. Douzery,1
and N. Galtier*,1
1
CNRS, Universite´ Montpellier 2, UMR 5554, ISEM, Montpellier, France
2
Montpellier SupAgro, UMR 1334, AGAP, Montpellier, France
*Corresponding author: E-mail: nicolas.galtier@univ-montp2.fr.
Associate editor: Naruya Saitou
Abstract
It is widely assumed that our mammalian ancestors, which lived in the Cretaceous era, were tiny animals that su
asteroid impacts in shelters and evolved into modern forms after dinosaurs went extinct, 65 Ma. The small size of m
mammalian fossils essentially supports this view. Paleontology, however, is not conclusive regarding the ance
mammals, because Cretaceous and Paleocene fossils are not easily linked to modern lineages. Here, we use full-ge
estimate the longevity and body mass of early placental mammals. Analyzing 36 fully sequenced mammalian
reconstruct two aspects of the ancestral genome dynamics, namely GC-content evolution and nonsynonymous o
ous rate ratio. Linking these molecular evolutionary processes to life-history traits in modern species, we estim
placental mammals had a life span above 25 years and a body mass above 1kg. This is similar to current primates, c
or carnivores, but markedly different from mice or shrews, challenging the dominant view about mammali
evolution. Our results imply that long-lived mammals existed in the Cretaceous era and were the most successfu
opening new perspectives about the conditions for survival to the Cretaceous–Tertiary crisis.
Key words: phylogeny, GC-content, dN/dS ratio, GC-biased gene conversion, placentalia, fossils.
Mol Biol Evol 2013
ie. very different from
“mouse-like”
Eomaia scansoria
What common ancestor of placental mammals radiated
after K-T (Cretaceous-Palogene) extinction?
76. Independent
colonization events
less than 10,000
years ago
in Saltwater:
in Freshwater:
The freshwater populations, despite their younger age, ar
divergent both from the oceanic ancestral populations and
each other, consistent with our supposition that they rep
independent colonizations from the ancestral oceanic popu
These results are remarkably similar to results obtained pre
from some of these same populations using a small num
microsatellite and mtDNA markers [55]. This combinat
large amounts of genetic variation and overall low-to-mo
differentiation between populations, coupled with recent and
phenotypic evolution in the freshwater populations, prese
ideal situation for identifying genomic regions that have resp
to various kinds of natural selection.
Patterns of genetic diversity distributed across the
genome
To assess genome-wide patterns we examined mean nuc
diversity (p) and heterozygosity (H) using a Gaussian
smoothing function across each linkage group (Figure 4 and
S1). Although the overall mean diversity and heterozygosity
are 0.00336 and 0.00187, respectively, values vary widely
the genome. Nucleotide diversity within genomic regions
from 0.0003 to over 0.01, whereas heterozygosity values
from 0.0001 to 0.0083. This variation in diversity acro
genome provides important clues to the evolutionary pr
that are maintaining genetic diversity. For example,
expected (p) and observed (H) heterozygosity largely corre
they differ at a few genomic regions (e.g., on Linkage Grou
Genomic regions that exhibit significantly (p,1025
) low le
diversity and heterozygosity (e.g. on LG II and V, Fig
and Figure S1) may be the result of low mutation
low recombination rate, purifying or positive selection
consistent across populations, or some combination of
[9,36,105–107].
F
S
F
F
S
S = Saltwater
F = Freshwater
Bill Cresko et al;
Different amounts of
armor plating
77. RAD = Restriction-site Associated DNA sequencing
each locus sequenced
5–10 times per fish.
Bill Cresko et al;
The freshwater populations, despite their younger age, are more
divergent both from the oceanic ancestral populations and from
each other, consistent with our supposition that they represent
independent colonizations from the ancestral oceanic population.
These results are remarkably similar to results obtained previously
from some of these same populations using a small number of
microsatellite and mtDNA markers [55]. This combination of
large amounts of genetic variation and overall low-to-moderate
differentiation between populations, coupled with recent and rapid
phenotypic evolution in the freshwater populations, presents an
ideal situation for identifying genomic regions that have responded
to various kinds of natural selection.
Patterns of genetic diversity distributed across the
genome
To assess genome-wide patterns we examined mean nucleotide
diversity (p) and heterozygosity (H) using a Gaussian kernel
smoothing function across each linkage group (Figure 4 and Figure
S1). Although the overall mean diversity and heterozygosity values
are 0.00336 and 0.00187, respectively, values vary widely across
the genome. Nucleotide diversity within genomic regions ranges
from 0.0003 to over 0.01, whereas heterozygosity values range
from 0.0001 to 0.0083. This variation in diversity across the
genome provides important clues to the evolutionary processes
that are maintaining genetic diversity. For example, while
expected (p) and observed (H) heterozygosity largely correspond,
they differ at a few genomic regions (e.g., on Linkage Group XI).
Genomic regions that exhibit significantly (p,1025
) low levels of
diversity and heterozygosity (e.g. on LG II and V, Figure 4
and Figure S1) may be the result of low mutation rate,
low recombination rate, purifying or positive selection that is
consistent across populations, or some combination of factors
[9,36,105–107].
In contrast, other genomic regions, such as those on LG III and
XIII (Figure 4), show very high levels of both diversity and
Figure 1. Location of oceanic and freshwater populations
examined. Threespine stickleback were sampled from three freshwa-
Population Genomics in Stickleback
F
S
F
F
S
S = Saltwater
F = Freshwater
20 fish per population
45,789 loci genotyped
78. Differentiation between populations (FST)
Saltwater
vs.
Saltwater
Population Genomics i
Freshwater
vs.
Freshwater
Figure 6. Genome-wide differentiation among populations. FST across the genome, with colored bars indicating significa
(p#1025
, blue; p#1027
, red) and reduced (p#1025
, green) values. Vertical gray shading indicates boundaries of the linkage groups and
scaffolds, and gold shading indicates the nine peaks of substantial population differentiation discussed in the text. (A) FST between the
populations (RS and RB; note that no regions of FST are significantly elevated or reduced). (B,C,D) Differentiation of each single freshwate
from the two oceanic populations, shown as the mean of the two pairwise comparisons (with RS and RB): (B) BP, (C) BL, (D) ML. Colored
plot represent regions where both pairwise comparisons exceeded the corresponding significance threshold. (E) Overall population d
between the oceanic and freshwater populations. (F) Differentiation among the three freshwater populations (BP, BL, ML).
doi:10.1371/journal.pgen.1000862.g006
PLoS Genetics | www.plosgenetics.org 8 February 2010 | Volume 6 | Issue 2
Freshwater
vs.
Saltwater
FST bewteen 2 populations: 0 = populations have same alleles in similar frequencies
1 = populations have completely different alleles
Bill Cresko et al; David Kingsley et al
79. Nine identified regions
• Identified regions include:
• 31 that likely to affect morphology or osmoregulation
• some previously identified via crosses; most new
• E.g. EDA gene.
• “rare” recessive allele (found in 1-5% of ocean individuals)
• the “rare” allele went to fixation in all freshwater
populations (ie. all individuals homozygous for the
rare allele)
80. Little fire ant Wasmannia
DNA identifies family relationships
Fournier et al 2005
82. reproduction (that is, by ameiotic parthenogenesis). In 33 of th
nests, all queens (n ¼ 135) and gynes (n ¼ 9) cohabiting in the s
nest shared an identical genotype at each of the 11 loci (Table 1
Fig. 1). The single exception was nest B-12, in which queens diff
at 1 of the 11 loci: four queens were heterozygous at Waur-2
and the remaining three queens were homozygous for one of
two alleles. This variation probably reflects a mutation or recom
nation event in one queen followed by clonal reproduction wi
the nest. The history of this genetic change could be reconstru
from the genotypes of queens collected in neighbouring nests (Fi
and 2). Nine queens from two neighbouring nests (B-11 and B
had the same genotype as the four heterozygous queens for lo
Waur-2164, indicating that the mutation or recombination e
probably was from a heterozygote to a homozygote queen. The t
homozygote queens from nest B-12 had a unique genotype in
population, which further supports this interpretation.
A comparison between nests supports the view of restricted fem
gene flow, with budding being the main mode of colony format
Within three of the five sites of collection (A, C and D) all queens
the same genotype at the 11 loci (Fig. 2). In one of the two other
(B), all queens from 8 of the 17 nests also had an identical genot
whereas in the other site (E) the queen genotypes were different in
three nests sampled. Taken together, these data indicate that que
belonging to the same lineage of clonally produced individ
frequently head closely located nests. Moreover, genetic diffe
tiation between sites was very strong, with a single occurrenc
genotypes shared between sites (the eight queens of nest E-3
genotypes identical to the most common genotype found at site
showing that gene flow by females is extremely restricted.
In stark contrast to reproductive females, the genotypic anal
revealed that workers are produced by normal sexual reproduc
(Table 1). Over all 31 queenright nests, each of the 248 genoty
workers had, at seven or more loci, one allele that was absen
queens of their nest. Moreover, the 232 workers from the 29 nes
which the sperm in the queen’s spermathecae was successf
Figure 2 | Neighbour-joining dendrogram of the genetic (allele-shared)
distances between queens (Q), gynes (G) and male sperms (M) collected
mate with their brothers inside the nest, and yet maintain
heterozygosity in the queen and worker castes over an
unlimited number of generations.
Surprisingly, the heterozygosity level of new queens is
completely independent of the genealogical link between
the mother queen and her mate in this species, as there
is no mixing of the paternal and maternal lineages. By
two other ant sp
hovia emeryi [2
study, it is like
also translates
sib mating on t
estingly, W. aur
studies have s
derive from a
characterized b
single male ge
and a single ma
is also compati
a single mated
Interestingly
lay male eggs th
least two poten
being clonally p
genome could
[21]. Indeed, o
one parental ge
as the parasito
the waterfrog h
lenta [33,34], a
Formica [35,36
paternal genom
one. The altern
lay anucleated
fertilized [37].
which eggs will
gynes workers males
queen mate
Figure 2. Clonal reproduction in queens and males. The
figure summarizes the reproduction system of P. longicornis
in the study population. Maternal (light) and paternal
(dark) chromosomes are displayed. Contribution to the
genome of the offspring is indicated by arrows (dashed
arrow represents the mother laying haploid eggs with no
actual contribution to the genome).
2680 M. Pearcy et al. Sib mating without inbreeding
on Jrspb.royalsocietypublishing.orgDownloaded from
83. Species-interactions via DNA
sequencing
Screening mammal
biodiversity using
DNA from leeches
Ida Bærholm Schnell1,2,†,
Philip Francis Thomsen2,†,
Nicholas Wilkinson3,
Morten Rasmussen2,
Lars R.D. Jensen1, Eske Willerslev2,
Mads F. Bertelsen1,
and M. Thomas P. Gilbert2,*
With nearly one quarter of mammalian
species threatened, an accurate
description of their distribution and
conservation status is needed [1].
Correspondences in the medical leech (Hirudo medicinalis)
viruses remain detectable in the blood
meal for up to 27 weeks, indicating viral
nucleic acid survival [4,5]. To examine
whether PCR amplifiable mammalian
DNA persists in ingested blood, we
fed 26 medical leeches (Hirudo spp.)
freshly drawn goat (Capra hircus)
blood (Supplemental information) then
sequentially killed them over 141 days.
Following extraction of total DNA, a
goat-specific quantitative PCR assay
demonstrated mitochondrial DNA
(mtDNA) survival in all leeches, thus
persistence of goat DNA, for at least
4 months (Figure 1A; Supplemental
information).
We subsequently applied the
method to monitor terrestrial
mammal biodiversity in a challenging
environment. Haemadipsa spp. leeches
were collected in a densely forested
biotope in the Central Annamite region
ow
w
to
n
n in
on.
x
586.
s
al
.
Magazine
R263
Figure 1. Monitoring mammals with leeches.
(A) Survival of mtDNA in goat blood ingested by Hirudo medicinalis over time, relative to fres
drawn sample (100%, ca. 2.4E+09 mtDNA copies/gram blood). Mitochondrial DNA remain
detectable in all fed leeches, with a minimum observed level at 1.6E+04 mtDNA/gram blo
ingested. The line shows a simple exponential decay model, p < 0.001, R2 = 0.43 (Supplemen
information). (B) Vietnamese field site location and examples of mammals identified in Ha