SlideShare ist ein Scribd-Unternehmen logo
1 von 43
Slides available
www.bioinformatics.be




                        12 Maart 2013
Lab for Bioinformatics and
         computational genomics
     10 “genome hackers”
   mostly engineers (statistics)




           42 scientists
 technicians, geneticists, clinicians




          >100 people
      hardware engineers,
mathematicians, molecular biologists
Can bioinformatics bridge the gap ?
The genome is just the start …
250 different cell types

                 Epigenetic (meta)information = stem cells
Cellular programming

               Epigenetic (meta)information = stem cells
Defining Epigenetics
               Genome

                              DNA       Reversible changes in gene
                                         expression/function
                                        Without changes in DNA
                         Chromatin       sequence
             Epigenome                  Can be inherited from
                                         precursor cells
       Gene Expression                  Allows to integrate intrinsic
                                         with environmental signals
 Phenotype
                                         (including diet)
DNA Methylation Differentiates Totipotent Embryonic
Stem Cells from Unipotent Adult Stem Cells




                                       Alex Meissner, Henry Stewart Talks
Reprogramming the DNA methylome




                                  Paula Vertino, Henry Stewart Talks
Transgenerational inheritence
The epigenome
is actionable
The epigenome
is actionable
Epigenetic Changes are
Important in Causing Cancer
             GENETIC                     EPIGENETIC


      Example:                                         Example:
      Replication errors                               Chromatin modification errors
                           X X
       Altered                                              Altered
       DNA sequence                                         chromatin structure
                                 Oncogenesis
         Altered                                       Altered levels of
         DNA/mRNA/proteins                             mRNA/proteins



                                               Tumor
Example of Methylation
vs Mutation: Colon & Breast Cancer




                                                      Dx

                                                     CDx


              Methylated              Mutated

                                                Source: Schuebel et al 2007
     76-100   51-75    21-50   1-20
MGMT Biology
O6 Methyl-Guanine
Methyl Transferase
Essential DNA Repair Enzyme

Removes alkyl groups from damaged guanine
bases

Healthy individual:
     - MGMT is an essential DNA repair enzyme
     Loss of MGMT activity makes individuals susceptible
     to DNA damage and prone to tumor development

Glioblastoma patient on alkylator chemotherapy:
     - Patients with MGMT promoter methylation show
     have longer PFS and OS with the use of alkylating
     agents as chemotherapy
MGMT Promoter
Methylation Predicts
Benefit form DNA-Alkylating Chemotherapy
  Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma
  patients show benefit for patients with MGMT promoter methylation

            Median Overall Survival

                                      21.7 months
                                         plus
                                      temozolomide

              12.7 months
                                      radiotherapy

               radiotherapy

                                                               Adapted from Hegi et al.
                                                               NEJM 2005
                                                               352(10):1036-8.
             Non-Methylated            Methylated              Study with 207 patients
              MGMT Gene                MGMT Gene
Profiling the Epigenome

  # markers




              Discovery



                          Verification

                                         Validation



                                                  # samples
Genome-wide methylation
by methylation sensitive restriction enzymes
Genome-wide methylation
by probes
Profiling the Epigenome
By next gen sequencing

  # markers




              Discovery



                          Verification

                                         Validation



                                                  # samples
MBD_Seq

Condensed Chromatin      DNA Sheared



                                       Immobilized
                                       Methyl Binding Domain
           DNA Sheared
MBD_Seq

                  Immobilized
                  Methyl binding domain




          MgCl2




                  Next Gen Sequencing
                  GA Illumina: 100 million reads
Kit Comparison       0.25




                                    ●




                                ●
                     0.20




                                        ●
 Fraction of reads

                     0.15




                                            ●
                     0.10




                                                ●
                     0.05




                                                    ●




                                                        ●


                                                            ●

                                                                ●
                                                                    ●
                                                                        ●
                     0.00




                                                                            ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●   ●




                            0                                       10                                      20                                      30                                      40                                      50

                                                                                                            Number of CG's



                                                                                                                                                                                                                                                                25
MBD_Seq
MGMT = dual core
Profiling the epigenome
…. by next generation sequencing
  # markers


 1-2 million
                       MBD_Seq
 methylation
   cores
               Discovery




                                   # samples
Bock et al, Nature, 2012
Bock et al. Nature 2012




28
29
Data integration
Correlation tracks

expression                            expression



             Corr =-1                       Corr = 1




                        methylation                    methylation




                                                                     30
Correlation track
in GBM @ MGMT




                    +1




                    -1

                         31
Next_next
miRNA, (l)ncRNA, CIS/TRANS splicing, SV, fusion loci ,
bidirectional promoters ?

RNA_seq: sequence RNA molecules Next Gen Platform

Total RNA_seq: all RNA molecules (normalisation procedure)

Directional Total RNA_seq: before amplification use different
5’ and 3’ adaptors

Integrated Directional Total RNA_seq: Combine with other
datasets eg. enrichment sequencing data, visualise and query
in genome browser


                                                                32
Direction RNAseq
bidirectional promoters




                          33
Profiling the Epigenome
…. by next generation sequencing

  # markers


                      MBD_Seq


              Discovery

                                          454_BT_Seq
                           Verification

                                                       Validation



                                                                # samples
Where is the mC ?

GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT

    25%     50%     25%
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT

    25%               50%            25%
GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT


GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT

    Dense methylated needed for transcriptional silencing
    Are there alleles with all three positions methylated ?
Deep Sequencing


                  unmethylated alleles




                  methylated alleles     less methylation




                                         more methylation


GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT
Deep MGMT
Heterogenic complexity
Conclusion
Combination of different sequencing
techniques is emerging as best practice
Bioinformatics is challenging
Methods for normalisation under
construction
Reference databases are generated
Data visualization and integration is key

                                            41
Slides available
www.bioinformatics.be




              4th December 2012
              Johns Hopkins
              Bloomberg
              School of Public Health
biobix
    wvcrieki



biobix.be
bioinformatics.be
                43

Weitere ähnliche Inhalte

Was ist angesagt?

SITE DIRECTED MUTAGENESIS.HARIS
SITE DIRECTED MUTAGENESIS.HARISSITE DIRECTED MUTAGENESIS.HARIS
SITE DIRECTED MUTAGENESIS.HARISHARIS.P
 
Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...
Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...
Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...Laurence Dawkins-Hall
 
Wp adna epi_tectmethyl2
Wp adna epi_tectmethyl2Wp adna epi_tectmethyl2
Wp adna epi_tectmethyl2Elsa von Licy
 
Introduction to High Resolution Melt Analysis
Introduction to High Resolution Melt AnalysisIntroduction to High Resolution Melt Analysis
Introduction to High Resolution Melt AnalysisAmerican Biotechnologist
 

Was ist angesagt? (9)

Site directed mutagenesis by pcr
Site directed mutagenesis by pcrSite directed mutagenesis by pcr
Site directed mutagenesis by pcr
 
SITE DIRECTED MUTAGENESIS.HARIS
SITE DIRECTED MUTAGENESIS.HARISSITE DIRECTED MUTAGENESIS.HARIS
SITE DIRECTED MUTAGENESIS.HARIS
 
Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...
Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...
Lab talk 060809 radioligand assay to validate in slico predicted rel inhibito...
 
SCoT and RAPD
SCoT and RAPDSCoT and RAPD
SCoT and RAPD
 
Wp adna epi_tectmethyl2
Wp adna epi_tectmethyl2Wp adna epi_tectmethyl2
Wp adna epi_tectmethyl2
 
High resolution melting(hrm)
High resolution melting(hrm)High resolution melting(hrm)
High resolution melting(hrm)
 
PCR
PCRPCR
PCR
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
Introduction to High Resolution Melt Analysis
Introduction to High Resolution Melt AnalysisIntroduction to High Resolution Melt Analysis
Introduction to High Resolution Melt Analysis
 

Andere mochten auch

2012 12 02_epigenetic_profiling_environmental_health_sciences
2012 12 02_epigenetic_profiling_environmental_health_sciences2012 12 02_epigenetic_profiling_environmental_health_sciences
2012 12 02_epigenetic_profiling_environmental_health_sciencesProf. Wim Van Criekinge
 
2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vwebProf. Wim Van Criekinge
 
Bioinformatics t7-proteinstructure v2014
Bioinformatics t7-proteinstructure v2014Bioinformatics t7-proteinstructure v2014
Bioinformatics t7-proteinstructure v2014Prof. Wim Van Criekinge
 
Bioinformatica 10-11-2011-t5-database searching
Bioinformatica 10-11-2011-t5-database searchingBioinformatica 10-11-2011-t5-database searching
Bioinformatica 10-11-2011-t5-database searchingProf. Wim Van Criekinge
 
Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...
Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...
Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...Fundación Ramón Areces
 
2015 bioinformatics alignments_wim_vancriekinge
2015 bioinformatics alignments_wim_vancriekinge2015 bioinformatics alignments_wim_vancriekinge
2015 bioinformatics alignments_wim_vancriekingeProf. Wim Van Criekinge
 
Bioinformatics t9-t10-biocheminformatics v2014
Bioinformatics t9-t10-biocheminformatics v2014Bioinformatics t9-t10-biocheminformatics v2014
Bioinformatics t9-t10-biocheminformatics v2014Prof. Wim Van Criekinge
 
2015 bioinformatics go_hmm_wim_vancriekinge
2015 bioinformatics go_hmm_wim_vancriekinge2015 bioinformatics go_hmm_wim_vancriekinge
2015 bioinformatics go_hmm_wim_vancriekingeProf. Wim Van Criekinge
 

Andere mochten auch (20)

Bioinformatica t7-protein structure
Bioinformatica t7-protein structureBioinformatica t7-protein structure
Bioinformatica t7-protein structure
 
NXTGNT kick off
NXTGNT kick offNXTGNT kick off
NXTGNT kick off
 
2015 bioinformatics bio_python_part3
2015 bioinformatics bio_python_part32015 bioinformatics bio_python_part3
2015 bioinformatics bio_python_part3
 
2012 12 02_epigenetic_profiling_environmental_health_sciences
2012 12 02_epigenetic_profiling_environmental_health_sciences2012 12 02_epigenetic_profiling_environmental_health_sciences
2012 12 02_epigenetic_profiling_environmental_health_sciences
 
Bioinformatics life sciences_v2015
Bioinformatics life sciences_v2015Bioinformatics life sciences_v2015
Bioinformatics life sciences_v2015
 
2015 bioinformatics wim_vancriekinge
2015 bioinformatics wim_vancriekinge2015 bioinformatics wim_vancriekinge
2015 bioinformatics wim_vancriekinge
 
2015 bioinformatics bio_python_partii
2015 bioinformatics bio_python_partii2015 bioinformatics bio_python_partii
2015 bioinformatics bio_python_partii
 
2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
 
Bioinformatics t7-proteinstructure v2014
Bioinformatics t7-proteinstructure v2014Bioinformatics t7-proteinstructure v2014
Bioinformatics t7-proteinstructure v2014
 
Bioinformatica 10-11-2011-t5-database searching
Bioinformatica 10-11-2011-t5-database searchingBioinformatica 10-11-2011-t5-database searching
Bioinformatica 10-11-2011-t5-database searching
 
Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...
Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...
Jose María Ordovás-El impacto de las ciencias ómicas en la nutrición, la medi...
 
Thesis2014
Thesis2014Thesis2014
Thesis2014
 
2012 12 12_adam_v_final
2012 12 12_adam_v_final2012 12 12_adam_v_final
2012 12 12_adam_v_final
 
2015 bioinformatics bio_python
2015 bioinformatics bio_python2015 bioinformatics bio_python
2015 bioinformatics bio_python
 
2015 bioinformatics alignments_wim_vancriekinge
2015 bioinformatics alignments_wim_vancriekinge2015 bioinformatics alignments_wim_vancriekinge
2015 bioinformatics alignments_wim_vancriekinge
 
Mini symposium
Mini symposiumMini symposium
Mini symposium
 
Bioinformatics t9-t10-biocheminformatics v2014
Bioinformatics t9-t10-biocheminformatics v2014Bioinformatics t9-t10-biocheminformatics v2014
Bioinformatics t9-t10-biocheminformatics v2014
 
Bioinformatics v2014 wim_vancriekinge
Bioinformatics v2014 wim_vancriekingeBioinformatics v2014 wim_vancriekinge
Bioinformatics v2014 wim_vancriekinge
 
Bioinformatica p1-perl-introduction
Bioinformatica p1-perl-introductionBioinformatica p1-perl-introduction
Bioinformatica p1-perl-introduction
 
2015 bioinformatics go_hmm_wim_vancriekinge
2015 bioinformatics go_hmm_wim_vancriekinge2015 bioinformatics go_hmm_wim_vancriekinge
2015 bioinformatics go_hmm_wim_vancriekinge
 

Ähnlich wie 2013 03 12_epigenetic_profiling

Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
Van criekinge next_generation_epigenetic_profling_vvumc_uploadedVan criekinge next_generation_epigenetic_profling_vvumc_uploaded
Van criekinge next_generation_epigenetic_profling_vvumc_uploadedProf. Wim Van Criekinge
 
Van criekinge next_generation_epigenetic_profling_vuppsala
Van criekinge next_generation_epigenetic_profling_vuppsalaVan criekinge next_generation_epigenetic_profling_vuppsala
Van criekinge next_generation_epigenetic_profling_vuppsalaProf. Wim Van Criekinge
 
Van criekinge next_generation_epigenetic_profling_vlille
Van criekinge next_generation_epigenetic_profling_vlilleVan criekinge next_generation_epigenetic_profling_vlille
Van criekinge next_generation_epigenetic_profling_vlilleProf. Wim Van Criekinge
 
2015 07 09__epigenetic_profiling_environmental_health_sciences_v42
2015 07 09__epigenetic_profiling_environmental_health_sciences_v422015 07 09__epigenetic_profiling_environmental_health_sciences_v42
2015 07 09__epigenetic_profiling_environmental_health_sciences_v42Prof. Wim Van Criekinge
 
Dna methylation field guide 20130806
Dna methylation field guide 20130806Dna methylation field guide 20130806
Dna methylation field guide 20130806abizarl
 
Michael Buschmann_Nanomedecine
Michael Buschmann_NanomedecineMichael Buschmann_Nanomedecine
Michael Buschmann_NanomedecineNe3LS_Network
 
4.15 w13 final presentation
4.15  w13 final presentation4.15  w13 final presentation
4.15 w13 final presentationBYUiGem
 

Ähnlich wie 2013 03 12_epigenetic_profiling (11)

2014 11 03_bioinformatics_case_studies
2014 11 03_bioinformatics_case_studies2014 11 03_bioinformatics_case_studies
2014 11 03_bioinformatics_case_studies
 
Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
Van criekinge next_generation_epigenetic_profling_vvumc_uploadedVan criekinge next_generation_epigenetic_profling_vvumc_uploaded
Van criekinge next_generation_epigenetic_profling_vvumc_uploaded
 
Van criekinge next_generation_epigenetic_profling_vuppsala
Van criekinge next_generation_epigenetic_profling_vuppsalaVan criekinge next_generation_epigenetic_profling_vuppsala
Van criekinge next_generation_epigenetic_profling_vuppsala
 
Van criekinge next_generation_epigenetic_profling_vlille
Van criekinge next_generation_epigenetic_profling_vlilleVan criekinge next_generation_epigenetic_profling_vlille
Van criekinge next_generation_epigenetic_profling_vlille
 
2015 07 09__epigenetic_profiling_environmental_health_sciences_v42
2015 07 09__epigenetic_profiling_environmental_health_sciences_v422015 07 09__epigenetic_profiling_environmental_health_sciences_v42
2015 07 09__epigenetic_profiling_environmental_health_sciences_v42
 
Dna methylation field guide 20130806
Dna methylation field guide 20130806Dna methylation field guide 20130806
Dna methylation field guide 20130806
 
Microarray
MicroarrayMicroarray
Microarray
 
Dna technology 1
Dna technology 1Dna technology 1
Dna technology 1
 
Pp adna epi_tect
Pp adna epi_tectPp adna epi_tect
Pp adna epi_tect
 
Michael Buschmann_Nanomedecine
Michael Buschmann_NanomedecineMichael Buschmann_Nanomedecine
Michael Buschmann_Nanomedecine
 
4.15 w13 final presentation
4.15  w13 final presentation4.15  w13 final presentation
4.15 w13 final presentation
 

Mehr von Prof. Wim Van Criekinge

2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_upload2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_uploadProf. Wim Van Criekinge
 
2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_upload2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_uploadProf. Wim Van Criekinge
 
2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_upload2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_uploadProf. Wim Van Criekinge
 
2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_upload2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_uploadProf. Wim Van Criekinge
 
2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_upload2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_uploadProf. Wim Van Criekinge
 
Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]Prof. Wim Van Criekinge
 
2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_upload2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_uploadProf. Wim Van Criekinge
 
2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_upload2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_uploadProf. Wim Van Criekinge
 
2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_upload2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_uploadProf. Wim Van Criekinge
 

Mehr von Prof. Wim Van Criekinge (20)

2020 02 11_biological_databases_part1
2020 02 11_biological_databases_part12020 02 11_biological_databases_part1
2020 02 11_biological_databases_part1
 
2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_upload2019 03 05_biological_databases_part5_v_upload
2019 03 05_biological_databases_part5_v_upload
 
2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_upload2019 03 05_biological_databases_part4_v_upload
2019 03 05_biological_databases_part4_v_upload
 
2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_upload2019 03 05_biological_databases_part3_v_upload
2019 03 05_biological_databases_part3_v_upload
 
2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_upload2019 02 21_biological_databases_part2_v_upload
2019 02 21_biological_databases_part2_v_upload
 
2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_upload2019 02 12_biological_databases_part1_v_upload
2019 02 12_biological_databases_part1_v_upload
 
P7 2018 biopython3
P7 2018 biopython3P7 2018 biopython3
P7 2018 biopython3
 
P6 2018 biopython2b
P6 2018 biopython2bP6 2018 biopython2b
P6 2018 biopython2b
 
P4 2018 io_functions
P4 2018 io_functionsP4 2018 io_functions
P4 2018 io_functions
 
P3 2018 python_regexes
P3 2018 python_regexesP3 2018 python_regexes
P3 2018 python_regexes
 
T1 2018 bioinformatics
T1 2018 bioinformaticsT1 2018 bioinformatics
T1 2018 bioinformatics
 
P1 2018 python
P1 2018 pythonP1 2018 python
P1 2018 python
 
Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]Bio ontologies and semantic technologies[2]
Bio ontologies and semantic technologies[2]
 
2018 05 08_biological_databases_no_sql
2018 05 08_biological_databases_no_sql2018 05 08_biological_databases_no_sql
2018 05 08_biological_databases_no_sql
 
2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_upload2018 03 27_biological_databases_part4_v_upload
2018 03 27_biological_databases_part4_v_upload
 
2018 03 20_biological_databases_part3
2018 03 20_biological_databases_part32018 03 20_biological_databases_part3
2018 03 20_biological_databases_part3
 
2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_upload2018 02 20_biological_databases_part2_v_upload
2018 02 20_biological_databases_part2_v_upload
 
2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_upload2018 02 20_biological_databases_part1_v_upload
2018 02 20_biological_databases_part1_v_upload
 
P7 2017 biopython3
P7 2017 biopython3P7 2017 biopython3
P7 2017 biopython3
 
P6 2017 biopython2
P6 2017 biopython2P6 2017 biopython2
P6 2017 biopython2
 

Kürzlich hochgeladen

Google Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptxGoogle Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptxDr. Sarita Anand
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.pptRamjanShidvankar
 
How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17Celine George
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfagholdier
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Jisc
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptxMaritesTamaniVerdade
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfPoh-Sun Goh
 
Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Association for Project Management
 
Vishram Singh - Textbook of Anatomy Upper Limb and Thorax.. Volume 1 (1).pdf
Vishram Singh - Textbook of Anatomy  Upper Limb and Thorax.. Volume 1 (1).pdfVishram Singh - Textbook of Anatomy  Upper Limb and Thorax.. Volume 1 (1).pdf
Vishram Singh - Textbook of Anatomy Upper Limb and Thorax.. Volume 1 (1).pdfssuserdda66b
 
Dyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptxDyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptxcallscotland1987
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentationcamerronhm
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 
General Principles of Intellectual Property: Concepts of Intellectual Proper...
General Principles of Intellectual Property: Concepts of Intellectual  Proper...General Principles of Intellectual Property: Concepts of Intellectual  Proper...
General Principles of Intellectual Property: Concepts of Intellectual Proper...Poonam Aher Patil
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxDenish Jangid
 
Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsKarakKing
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxVishalSingh1417
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxAreebaZafar22
 

Kürzlich hochgeladen (20)

Google Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptxGoogle Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptx
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdf
 
Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024
 
Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...
 
Vishram Singh - Textbook of Anatomy Upper Limb and Thorax.. Volume 1 (1).pdf
Vishram Singh - Textbook of Anatomy  Upper Limb and Thorax.. Volume 1 (1).pdfVishram Singh - Textbook of Anatomy  Upper Limb and Thorax.. Volume 1 (1).pdf
Vishram Singh - Textbook of Anatomy Upper Limb and Thorax.. Volume 1 (1).pdf
 
Dyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptxDyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptx
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentation
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
General Principles of Intellectual Property: Concepts of Intellectual Proper...
General Principles of Intellectual Property: Concepts of Intellectual  Proper...General Principles of Intellectual Property: Concepts of Intellectual  Proper...
General Principles of Intellectual Property: Concepts of Intellectual Proper...
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptxBasic Civil Engineering first year Notes- Chapter 4 Building.pptx
Basic Civil Engineering first year Notes- Chapter 4 Building.pptx
 
Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functions
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptx
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 

2013 03 12_epigenetic_profiling

Hinweis der Redaktion

  1. Here, we define epigenetics and depict the relationship between the genome and the epigenome The genome is hereditary information encoded in the DNA and the epigenome is the way cells express the encoded information 1 The epigenome is a ‘bridge’ between genotype and phenotype (epigenetics governs genotype and phenotype) Epigenetic information is included in the genome of a cell but is not encoded by the DNA 1,2 Epigenetic information may be inherited from precursor cells 1 Epigenetic changes affect chromosome structure to alter gene expression 1,2 References Goldberg AD et al. Cell 2007;128:635–8. Bernstein BE et al. Cell 2007;128:669–81.
  2. There is growing evidence that epigenetic modifications are also crucial to the onset and progression of cancer 1 On the right of the slide, we see that changes in gene expression due to chromatin modifications (e.g. histone acetylation, DNA methylation) lead to altered levels of mRNA and proteins Altered levels of proteins involved in cell growth and death can lead to deregulated cell proliferation and survival, resulting in cancer 2 Examples: Silencing of p15 tumor suppressor gene expression 3 Aberrant expression of IGF2 4 Silencing of ER- α gene expression 3 References Bolden JE et al. Nat Rev Drug Discov 2006;5:769–84. Miranda E et al. Br J Cancer 2006;95:1101–7. Esteller M. N Engl J Med 2008;358:1148 – 59. Feinberg AP. Nature 2007;447:433–40.