Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
G6PD Deficiency in Malaysia: the current situation - Narazah Mohd Yusoff
1. www.humanvariomeproject.org/GG2020
G6PD deficiency in Malaysia – the current
situation
Prof Dr Narazah Mohd Yusoff, MBBS, PhD
narazah@usm.my; narazah@yahoo.com.
Universiti Sains Malaysia, MALAYSIA
Areas of interest: G6PD deficiency and Southeast Asia ovalocytosis
(SAO)
3. www.humanvariomeproject.org/GG2020
Glucose-6-phosphate
dehydrogenase (G6PD) deficiency
G6PD deficiency is an X-linked hereditary genetic defect; females may
be affected
Caused by mutations in the G6PD gene
Protein variants with different levels of enzymatic activity
Associated with a wide range of biochemical and clinical phenotypes
Heterozygosity and hemizygosity - associated with approximately 50%
protection against severe Plasmodium falciparum malaria
5. www.humanvariomeproject.org/GG2020
1 Background & Epidemiology
Incidence/prevalence of G6PD deficiency & What is known
about the disease burden in Malaysia?
Molecular studies in Kelantan,
Penang and Selangor
• Frequency distribution
• General population 3.4%
• Male 5.3%
• Female 1.05%
• Malays
• Male 4.6%
• Female 1.3%
• Chinese
• Male 7.2%
• Female 0.7%
• Indians
• Male 2.7%
• Female 0.7%
• Negrito (Orang Asli)
• Male 11%
• Female 7%
(Ainoon, Yu et al. 2003)
6. www.humanvariomeproject.org/GG2020
National Screening
Is there any central reporting of cases?
Ministry of Health facilities and university hospitals
Is there any national coordination?
Yes
Is there a national screening service for G6PD
screening?
All general government and private hospitals in
the country provide screening services
Primary health care delivery – is G6PD screening
included?
Screening pre-natal: None. Abortion of affected
babies are not practised due to religious issues
Premarital: No.
New born: since 1980s
G6PD – commonest cause of neonatal jaundice (NNJ) in
Malaysia (33%)
Nation wide neonatal screening began in 19801
All infants must have a G6PD screening done on cord
blood2 (Ministry of Health Malaysia, 1999)
The results of G6PD screening must be known before
discharge and special management is indicated for
those infants found deficient3
Molecular screening is advised if found deficient
1Amini, Ismail et al. 2011; 2Ministry of Health Malaysia, 1999, 20003
8. www.humanvariomeproject.org/GG2020
2 Current progress in the country
[If presenting third-party data, please add this sentence: Data kindly provided by XXX]
[Please, indicate the status quo in your country; choose one of the levels in the table below]
A Countries where services are well established with a national system for prevention and control
B Countries where some elements of a national control program exist but it is not available to all; more effort is needed in
areas like:
i. Improving access to services
ii. Raising awareness among families and patients, health professionals and community in general
iii. Establishing national centres of excellence/expertise to provide advice, measure progress
iv. Ensuring that savings from disease prevention are returned back to expand and improve services
C Countries where expertise in diagnosis, treatment, management and prevention exist but is not part of a sustainable
national control program
D Countries where services are limited or not available
9. www.humanvariomeproject.org/GG2020
3 National Registry For G6PD deficiency
Is there a national registry for G6PD deficiency?
• Yes
• Ministry of Health (MOH) for clinical data, USM and UKM for
mutation database
Who is responsible for it?
• Director General for MOH
• UKM and USM – researchers involved
Who pays for it?
• Government and research funds
• Ministry of Higher Education
Who has access to the registry and how is access regulated?
• Clinicians (permission required for access)
10. www.humanvariomeproject.org/GG2020
Molecular basis of
G6PD in Malays
There were 9 mutations were G-to-A
nucleotide changes at nucleotide 871 of the
G6PD gene (G871A), corresponding to G6PD
Viangchan, G6PD Mediterranean (C563T),
G6PD Vanua Lava (T383C), G6PD Coimbra
(C592T), G6PD Kaiping (G1388A), G6PD Orissa
(C131G), G6PD Mahidol (G487A), G6PD Canton
(G1376T), and G6PD Chatham (G1003A)
Results: Our results document heterogeneous
mutations of the G6PD gene in the Malays in
Malaysia.
Narazah Mohd Yusoff , Taku Shirakawa , Kaoru Nishiyama,
Selamah Ghazali et. al; 2002
G6PD in Malaysia
10
Molecular characterisation reveals
86% of mutations
11. www.humanvariomeproject.org/GG2020
To determine the prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency
among staff and students of a university community in USM as well as to identify
molecular genetics by determination of G6PD mutations.
Results: Out of the 87 subjects (80 were Malay, 2 were Chinese, 1 was Indian and 4 were
others). The total prevalence of G6PD deficiency among the subjects was 4.59 % (4/87),
all of whom were Malay males. One of the deficient subjects had G6PD Viangchan, while
the other three were G6PD Mahidol (487 G>A).
Conclusion: The finding of this study demonstrate that the most common mutation
among AMDI staff and students is Mahidol (487G>A), followed by mutation Viangchan
(871G>A).
G6PD among AMDI staffs
Ahmed M Sulaiman, Sultan AM Saghir2, Faisal M Al-
Hassan, Narazah M Yusoff, Abdel-Hamid A Zaki. 2013
11
Molecular basis of G6PD among staffs and
students in USM
12. www.humanvariomeproject.org/GG2020
G6PD mutations in MalaysiaG6PD variant Nucleotide change Malay (%)1,4 Chinese (%)2,4,5 Indian (%)3 Orang Asli (%)5
Viangchan 871 G>A 37.2 0.8 12
Mediterranean 563 C>T 26.7 40
Mahidol 487 G>A 15.1 1.6
Canton 1376 G>T 4.7 42.3-50.0
Coimbra 592 C>T 3.5 4
Vanua Lava 383 T>C 3.5
Kaiping 1388 G>A 2.3 34.2-39.4 20
Union 1360 C>T 2.3 0.8
Orissa 131 C>G 1.2
Chatham 1003 G>A 2.3 0.8
Andalus 1361 G>A 1.2
Gaohe 95A>G - 5.2- 7.0
Mahidol-like 1024C>T - 1.5-2.2
Quing Yuang 392G>T 0.8
Namoru 208T>C 20
Combine 1401T>C with IVS
11 nt93T>C
1311T>C
with 1455-13T>C
1 64-83.3
Uncharacterised 7 20
1Ainoon, Yu et al. 2003, 2Ainoon, Joyce et al. 1999; 3Wang, Luo et al. 2008; 4Yusoff, Shirakawa et al. 2002; 5Amini, Ismail et al. 2011; 6Ainoon, Boo et al. 2004
13. www.humanvariomeproject.org/GG2020
4 Databases – collecting and sharing variant information
Polymorphism
Database
Genotype &
Phenotype Database
Clinical Database
• Not available yet
• Data collection is on
going
• Not available yet
• Data collection is on
going
Not available yet
Data collection is on
going
14. www.humanvariomeproject.org/GG2020
•Sources of funding available in Malaysia
- From academic institutions and national government funding.
-1)Research University grant, 2)Ministry of Science, Technology
and Innovation 3) Ministry of Education Malaysia
Technical assistance –training and equipment available in
Malaysia
-Each institution conduct their own training and have their own
equipments for haematological diagnosis and molecular
diagnosis (e.g,DNA analysis)
Research:- any national research projects exist
that are directed to G6PD deficiency?
-Yes, at least two of the academic institutions (UKM,
USM) are involved. The key areas of research are
clinical, public health and molecular
Any international research project / collaboration exist?
- Yes, 1) Department of Biohealth Science, Kobe Univ. Graduate School of Medicine, Japan
2) Dept. of Health, Cambodia, etc.
5 National resources - availability
15. www.humanvariomeproject.org/GG2020
In relation to
treatment and
prevention:-
Treatment:
Counselling/
prevention
services
Other issues
-All treatments are now available (Blood transfusion –
voluntary and not directed, no replacement,
-etc.)
- Genetic counselling to patients & families ?- available but still
inadequate
- Prenatal diagnosis?- None
- Carrier detection ? – Available but there still a challenge
with screening in Malaysia (female heterozygotes)
- Premarital counselling? - not routinely available
Inadequacy of genetic counseling skills among Malaysian
health care workers
6 6. Problems/Constraints/Challenges
16. www.humanvariomeproject.org/GG2020
Challenges
Determination of
mechanism of
pathogenesis of NNJ in
G6PD deficiency
Development of yet simpler
and more accurate kits for
determination of G6PD
levels that can be used in
developing countries
Rapid methods for
sequencing genes,
including G6PD, at low cost
*Philip J Mason, Jose M Batista, Florida Gilsanz
2007
17. www.humanvariomeproject.org/GG2020
7 Recommendations/Plans
What our country wants to get out of GG2020 by 2020
Mutation analysis to be available in all facilities
Genotype & Phenotype Database
Personalised treatment
Do you have any suggestions for funding/support?
??
Any recommendation for joint research?
G6PD deficiency and SAO
Association with diseases e.g. cardiovascular, dengue fever (modifiers)
19. www.humanvariomeproject.org/GG2020
In the interest of global health - G6PD deficiency
We now have the
means to protect
G6PD deficient
individuals from
exposure to fava
beans and to
iatrogenic risks
How G6PD protects
against malaria –
not fully
understood
If known, we might
be able to mimic
the mechanism to
protect others
Lucio Luzzatto, Caterina Nannelli, Rosario Naotaro,
2016
The road is still
long…………………………
From the table one may be appreciate that the clinically important G6PD variants not only demonstrate a characteristic geographical distribution, they also show a clear racial segregation.
Those strikethrough accession numbers are from the reference sequence (NM_001042351.2) for G6PD transcript variant 2 instead of the reference mRNA transcript variant one.
1401T>C site is determined by introducing a BclI site by PCR amplification with one of the primer as AAGACGTCCAGGATGAGGTGATCA .
The 20% uncharacterised may have rs1050757 variation which has the potential functional effect on the down regulation of mRNA and consequently G6PD deficiency.