1. Four Page Research Paper |
Research Paper, Researc
1. Step
To get started, you must first create an account on site HelpWriting.net.
The registration process is quick and simple, taking just a few moments.
During this process, you will need to provide a password and a valid email
address.
2. Step
In order to create a "Write My Paper For Me" request, simply complete the
10-minute order form. Provide the necessary instructions, preferred
sources, and deadline. If you want the writer to imitate your writing style,
attach a sample of your previous work.
3. Step
When seeking assignment writing help from HelpWriting.net, our
platform utilizes a bidding system. Review bids from our writers for your
request, choose one of them based on qualifications, order history, and
feedback, then place a deposit to start the assignment writing.
4. Step
After receiving your paper, take a few moments to ensure it meets your
expectations. If you're pleased with the result, authorize payment for the
writer. Don't forget that we provide free revisions for our writing services.
5. Step
When you opt to write an assignment online with us, you can request
multiple revisions to ensure your satisfaction. We stand by our promise to
provide original, high-quality content - if plagiarized, we offer a full
refund. Choose us confidently, knowing that your needs will be fully met.
Four Page Research Paper | Research Paper, Researc Four Page Research Paper | Research Paper, Researc
2. Negative Self-Image In Barbie Doll, By Marge Piercy
Negative self image among women has been a struggle in society for a long period of time. Social
media, magazines, and the pressures of society has caused many young girls to feel bad about
themselves because they do not look like the clothing model on the runway or the bathing suit model
on the front of a magazine. Females grow up with the pressures of having to be in shape, wearing the
best clothes, and putting on a full face of makeup for a male to find them attractive. Society has
deemed that only fit women are beautiful, and that idea has caused women to harm themselves,
develop anorexia, and feel insecure of themselves daily. Two works of literature that discuss the
struggles women face from society is Marge Piercy s poem Barbie Doll ... Show more content on
Helpwriting.net ...
When she realizes her imperfections are valuable, she has a whole new outlook on her life, which fills
her with hope and motivates her to become a better version of herself. The tone in this song reflects a
feeling of being content with one s self image because she finally wonders why [should she] waste a
second not loving who [she is] (Bedingfield 10)? This realization is what brings her out of her
depression, concerning what she looks like, to the decision of embracing her appearance because she
is beautiful no matter what society
... Get more on HelpWriting.net ...
3. Frantz Fanon In The Wretched Of The Earth
Influence on social theory from movements of decolonisation that challenged colonial rule against the
third world. One of the key thinkers of these movements was the Martinique born intellectual and
revolutionary Frantz Fanon. Frantz Fanon (1926 1961) is widely considered one of the most important
theorists of the twentieth century on race, racism, and colonialism. Fanon supported the Algerian war
of independence from French colonialism as he worked in Algeria as a psychiatrist during the war, and
he was a member of the Algerian National Liberation Front (FLN). This essay will attempt to critically
discuss Fanon s account of the development of the colonised intellectual s consciousness and the
relationship to the struggle for national liberation, ... Show more content on Helpwriting.net ...
When it comes to the colonial situation, the Marxian analysis must be slightly stretched to deal with
these realities (Fanon, The Wretched of The Earth, 1963). When he states this he is not saying that the
Marxian analysis should be abandoned, revised or ignored. He was trying to deal with realities that the
Marxist tradition often overlooked, such as the role the peasantry that is more than simply an auxiliary
to the working class, a critique of the national bourgeoisie and its relationship to the proletariat and his
rejection of a two staged theory of revolution. On these issues, Fanon may be said to be more in tune
with Marx than many of Marx s followers. After Marx published volume one of his greatest
theoretical work, he denied that he had ever developed a universal theory that is applicable to every
society on earth. He also specifically limited his delineation of the historical tendency of capitalist
accumulation to Western Europe alone and in his white writings on Russia and elsewhere, he
emphasised the possibility that these non Western underdeveloped societies could get to socialism
without having to go through capitalist industrialisation. When you look at Marx s work you find that
he is not simply adopting a formula that he extracts from his earlier work in studying Europe, and then
simply tries to put it on to the rest of the developing world
... Get more on HelpWriting.net ...
4. Summary Of Some Lessons From The Assembly Line
In Some Lessons From The Assembly Line , the author Andrew Braaksma, is identifying an
alternative to higher education. His work at the factory teaches him that people grossly underestimate
the value of their time and education. While doing this he is not dismissing the value that the
assembly/production line and factory adds to the world but instead acknowledging the privilege of
engaging in and getting the most out of a higher education.
In Some Lessons From The Assembly Line , the author is acknowledging and I agree, there are
different paths for everyone. He acknowledged in the writing the life lessons he learned in the factory
are just as valuable as the lessons in his college classes. I agree with the statement, As frustrating as
the work can be, the most stressful thing about blue collar life is knowing your job could disappear
overnight. He is acknowledging the people that make their livelihoods and depend on the factory jobs
are living with the threat that their jobs may not be there in the future. ... Show more content on
Helpwriting.net ...
Until someone has worked in a factory it is hard to imagine the dedication it takes to get up early
every morning and go to a job that you don t love. When you work on an assembly line you are
working under time and quota restraints. The second section that stuck out was the hard work that
factory workers perform, at times for long hours and is done for a much lower pay than what you
would expect. If you are putting in 12 hour days it would seem that your paycheck should reflect
... Get more on HelpWriting.net ...
5. Innovation, Entrepreneurship, And Innovation
Innovation, Entrepreneurship, and Intrapreneurship 2
INTRODUCTION
Innovation, entrepreneurship and intrapreneurship is bringing your vision, creativity to life while
building something of value that customers are willing to pay for.
Bill Aulet, managing director in the Martin Trust Center for MIT Entrepreneurship at MIT, lectures on
IDEs innovation driven enterprises , high growth potential and competitive advantage that brings new
innovations to customers world wide. (Aulet, 2013).
Tom Peters teaches the benefits of SMEs small and medium enterprises (SME), you don t have to be
in a traditional competitive market, just well understood business ideas, which have a possibility of
failure (Peters, Building a Culture of Innovation, 1999).
Entrepreneur is a chance, to start your own business, with the possibility of failure. Intrapreneurship is
given the financial support of a corporation or large company to have the freedom of innovation, be
creative at no cost.
Keywords: Business, Creative, Entrepreneurship, Innovation, Intrapreneurship
Innovation, Entrepreneurship, and Intrapreneurship 3
Risks and Benefits of Enterprises
Risks:
Small Medium Enterprises SMEs is business or organization that usually starts in a home or small
office, set of clients, depending on annual sales and funded by bank loans or
... Get more on HelpWriting.net ...
6. The Levels Of Organochlorine Pesticides ( Ocps ) And Heavy...
This study investigated the levels of organochlorine pesticides (OCPs) and heavy metal residues in
shellfish (shrimp, oyster and crab) collected from three Egyptian Governorates (Ismailia, Damietta
and Alexandria). Levels of 12 OCPs such as hexachlorocyclohexanes (HCHs), aldrin, endrin and
dichlorodiphenyltrichloroethanes (DDTs) residues were investigated. The dominant detected OCPs
were β HCH, p,p DDE and endrin. In general, contamination pattern of OCPs was in the order of other
OCPs (HCB, heptachlor, heptachlor epoxide, aldrin, endrin and γ chlordane) HCHs DDTs. Residual
concentrations of some heavy metals and trace elements were also estimated. The highest residual
levels of OCPs and heavy metals were detected in oysters collected from Damietta. The
concentrations of OCPs and heavy metals in examined shellfish, generally, were below the maximum
residual level set by United States Food and Drug Administration and FAO. Therefore, shellfish
collected from these studied sites could be considered safe for human consumption.
Keywords: Organochlorine pesticides; Heavy metals; Shellfish; Egypt Introduction Organochlorine
pesticides (OCPs) are persistent pollutants of worldwide concerns owing to their environmental
persistence, bioaccumulation and magnification ability in the food chain and potential toxicity in
humans and wildlife (Jones and de Voogt, 1999).These chemicals can enter the aquatic environment
and can be transported into the food chains and accumulated in
... Get more on HelpWriting.net ...
7. This paper scrutinizes the use of propaganda and the...
This paper scrutinizes the use of propaganda and the consequential effects during the Iraq War. It will
look at certain specific events such as George W. Bush s infamous Mission Accomplished moment, as
well as other incidents during the war that may have been a tactic to mislead the American public.
This paper will also examine the censorship used by the main news media outlets as to how it affected
the perspectives of the public. As one of the only means of getting information about a large war the
United States was part of, these news outlets, in any type of media, whether it be newspaper or the
television, could tell its audience anything, and they would have to accept it without doubt. By using
these examples from the Iraq War the ... Show more content on Helpwriting.net ...
It is vital to understand that the media did not necessarily fabricate the support for the war by the
general American public, but it was never proven and there was a lot of doubt.
The invasion of Iraq was a surprise military invasion without the official act of declaring war. This
eventually led to an occupation and the taking of President Saddam Hussein. Saddam Hussein was
tried by the new Iraq government and executed. From the start of the US occupation to years later,
little had improved in Iraq despite media portrayals and in 2008 Iraq was number five on the Failed
States Index. The 2003 Iraqi war symbolizes an international event that created a type of propaganda
varying from the media broadcasted in previous wars. It also represents a defining moment in US
history for its public relations campaigns. Even from the beginning of the war, the United States
already labeled the event as Operation Iraqi Freedom.
Other rationale for the invasion is still a majorly controversial issue. The United States official
statement was to remove a regime that developed and used weapons of mass destruction that harbored
and supported terrorists, committed outrageous human rights abuses, and defied the just demands of
the United Nations and the world (Carlyle 2004). Both the United States and the United Kingdom
stressed to their civilians that Saddam Hussein was developing weapons of mass
... Get more on HelpWriting.net ...
8. Poor People in the Bible.
1. From the book of Amos, state how the poor and needy were afflicted. (4)
In the book of Amos, the poor were treated as outcast and were discriminated against. The government
collected taxes from the poor such as rent thus fine buildings were built and pleasant vine yards were
established. Selling the righteous for money and the needy for a pair of sandals tells us a lot about the
social conditions of that time when the poor had to fight for their just rights, which were all too
frequently ignored.
2. Explain three ways in which the poor and needy are exploited in the world today. (6)
The poor are out casted and treated as an abomination because people think they don t want to better
themselves but yet they know they cannot help it. ... Show more content on Helpwriting.net ...
Mother Teresa grew famous for humbly ministering to lepers, the homeless and the poorest of the poor
in the slums of Calcutta. In 1928 Agnes Gonxha Bojaxhiu joined the Sisters of Our Lady of Lareto, a
Catholic order that did charity work in India. She took the name Sister Teresa and for 17 years taught
school in the country. In 1950 she founded the Missionaries of Charity, a new order devoted to helping
the sick and poor; the order grew to include branches in more than 100 cities around the world, and
Mother Teresa became a worldwide symbol of charity, meeting with Princess Diana and many other
public figures. In 1979 Mother Teresa was awarded the Nobel Prize for Peace, and in 1985 she was
awarded the Medal of Freedom from the United States.
The Salvation Army Founded in England by William Booth in the early 1800 s, the Salvation Army is
a Christian church. It believes the best way to evangelize the world is by meeting the physical and
spiritual needs of people, especially the poor, needy and destitute.
They hold to most of the standard Christian doctrines, but do not practice the rituals of communion or
baptism. Members of the church are required to perform charitable deeds including working in rescue
missions and soup kitchens, running second hand stores, assisting in areas of natural disasters, fire,
etc, and doing street evangelism. Members are encourage to learn a musical instrument that can
... Get more on HelpWriting.net ...
9. Essay on Animal Rights is a Cause for Vegetarianism
Animal Rights Cause for Vegetarianism
The choice of eating meat or not has been a debated issue for a continued number of years. There have
long since been two sides: the proponents and opponents of meat consumption. More and more
debates of its value and effect on the world have risen. Many claim it is wrong, while others think of it
as a needed pleasure.
Today, a greater percentage of the population eats meat. Only a few individuals seek the alternative
route. Yet, there has been a steady rise in the number of vegetarians.
Many may already know that religions all over the world have advocated a meat free diet. While a few
are lenient, the majority is steady. The reason a vegetarian diet has been preferred over meat dates
back ... Show more content on Helpwriting.net ...
Take for example this quote from the Srimad Bhagavatam 1.7.37, quot;A cruel and wretched person
who maintains his existence at the cost of others lives deserves to be killed for his own eternal well
being, otherwise he will go down by his own actions. quot;
There are many more such quotes from scriptures all over the world. Yet nowadays, there is just the
opposite of vegetarianism in compliance of these ancient texts.
quot;Although meat eating has been denied to the human form by God and his sons and daughters of
the past, people still adopt the process. quot;
Such are the statements of devout followers who adhere to a meat free diet in accordance to scriptural
texts.
Those who advocate vegetarianism profess that many people are weak of heart and so succumb to
meat eating. While those who advocate a meat oriented diet say that a meat diet is essential for a
normal and healthy life, for they provide protein.
[The Dutch chemist, Gerrit Jari Mulder, in his experiments, has proved in 1838, that protein is
biologically essential, for every living creature needs a certain amount to survive. This fact about
protein is due to the presence of amino acids, the building blocks quot; of life.]
While it is true that animals provide essential protein for the human body, scientific reports have
provided additional information that may seem to support a vegetarian viewpoint.
In his Book quot;Diet for Transcendence quot;, Steven Rosen states from other sources
... Get more on HelpWriting.net ...
10. Observation And Experimentation Of Observation
Observation is both an act and a remark made about an issue of interest. It is the process of close
monitoring of an occurrence for some given reasons, scientific or not. It is also the information
gathered from the monitoring process. In any scientific study, certain steps have to be followed. There
has to be observation/experimentation for any hypothesis to be formed and tested. It all starts from the
experimentation stage where close observations are made. Scientists rely mostly on observation in its
many forms in order to gain evidence during their studies. Nevertheless, the observational evidence is
majorly theory laden. The anticipation is based on past theories such that their aim is to agree with a
learnt theory or to reject it. ... Show more content on Helpwriting.net ...
If In any cases the observations are laden in any way, then there is a threat to science. Studies have
shown that perception can be influenced by theories. The theories can therefore control the
observation from the initial stages up to the end. Once the perception is theory based rather than the
real observation at hand, the attention to the process, how the observer comprehend the process and
later interpret the results has an effect to the scientific process(science). The findings could be
interpreted in the right and best way possible but their credibility depend on how the observations
were collected. If they were biased, then their credibility is low and unreliable.
Observation mainly involve seeing . Certain theories need observational support to be scientifically
accepted. Observational support is further applied when comparing two theories that might closely
explain a similar topic. Scientists make conclusions based on what they see which is further
influenced by on their beliefs. Despite that two people observing the same thing, their conclusions
might vary. This makes it hard when deciding which theory is better, observation technique isn t the
better way. Its dependence on the observers perspective stand in the way of making the right choice.
Certain observation statements are laden. Most of them are theory laden for instance ice melts in the
sun . When
... Get more on HelpWriting.net ...
11. Hannah Roberts Sky High Poem
The real voyage of discovery consists of not in seeking new landscapes, but in having new eyes. The
belief that discoveries can generate new ideas is explored and proven true in the Robert Frost poems
The Tuft of Flowers, and Home Burial, through the juxtaposing perceptions of the world and
humanity, which the key personae, develop as a result of their discoveries. This leads to the
development of more optimistic outlook for the speaker in Tuft, who comes to a new view of human
togetherness. And a more pessimistic outlook for The Wife in Burial who comes to see the world as
evil. Hannah in the related text Sky High by Hannah Roberts, also comes to renewed perceptions of
herself and the world as a result of the confronting discoveries she makes. ... Show more content on
Helpwriting.net ...
Roberts showcases the disillusions one makes of their childhood as a fantasy, through the distinctive
voices of the persona and the change of a child s perspective to an adults perspective. The title Sky
High highlights the hyperbole of the extreme sense of change the persona feels as she was once a child
witnessing the clothesline reach the sky and now as an adult seeing it contrarily, as she feels like that
childhood fantasy was an exaggeration. The text explores the transition from the innocence and
imagination of childhood to an adult with less freedom and more responsibility. The metaphor a small
pilot light was burning inside somewhere ...unlikely that the washing line would still support me , is a
reference to the inner child, waiting to take a swing, but stopped by the responsibilities and age. It was
an aged, unwrapped old washing line , throughout the text the washing line metaphorically symbolises
the changes the persona feels. Roberts uses various language feature to indicate how interesting
perceptions and important ideas of the society and the changes in society are explored through
distinctive voices of the
... Get more on HelpWriting.net ...
12. Technological Advancements Impact On Business Growth And...
Introduction
Technology has always played a major role in business growth and development. Its application has
risen at an unimaginable rate among enterprises. The resultant effect is that organizations continuously
experience innovation resulting from technological advances. The assimilation of technology
promotes modifications in organizational processes, tasks, and the nature of work. The technology
driven changes bring about an increase in the number of people using technological devices such as
computers to perform tasks. Technological advancements tremendously affect employee s morale,
nature of tasks, and impacts interactions among co workers. The managers of technological changes
need to play both the roles of implementers and technical developers. The introduction of technology
to an organization comes with a vast array of challenges to the management.
Most of the changes in the marketplace are driven by technological advancements. Technological
innovations in the marketplace are categorized into two, namely: sustaining and disruptive
innovations. Innovations that do not significantly impact the existing markets are defined as sustaining
innovations. Disruptive innovations, on the other hand, are innovations that result into a new market
and value network. They disrupt existing markets and value networks. Whether sustaining or
disrupting, businesses are supposed to anticipate change and prepare in advance. Appropriate action is
required to deal with changing
... Get more on HelpWriting.net ...
13. Disadvantages Of Online Shopping
Advantages and Disadvantages of
Online Shopping from Consumer Perspective
By Puneet Hundal
8136699
COMM1085
Professor Paula Crooks
January 5, 2018
ADVANTAGES AND DISADVANTAGES OF ONLINE SHOPPING FROM CONSUMER
PERSPECTIVE
Gigantic determinations, incredible costs, accommodation and administration are for the most part
only a single tick away with the most recent development of internet shopping. Today, individuals
everywhere throughout the world can purchase nearly anything without even crossing their doorsteps.
Internet shopping enables individuals to buy anything from plane tickets, to clothing, to autos, to basic
supplies, to stocks and shares and the rundown proceeds. In any case, one of the most difficult issues
is to choose where to shop on the web. Classifieds, barters, online organizations, shopping
administrations and gateways all have diverse preferences and hindrances. However, every type of
shopping has its cost. There are many shrouded expenses of shopping on the web, for example,
dispatching and taking care of, and enrollment charges. When shopping on the web there are
numerous imperative factors that must be considered. These variables incorporate your privacy and
security.
BOOMING GROWTH IN ONLINE SHOPPING
Online or web based shopping has seen tremendous growth during the past decade which has
transformed it into a rising territory of business administration and information technology. Shopping
online has become the new TREND and it is here to stay
... Get more on HelpWriting.net ...
14. In The Article The Fossil Record Supports Evolution, Writer,
In the article The Fossil Record Supports Evolution, writer, David A. Thomas argues his position. He
favors Evolution over Creationism. In the article David explains how there are gaps in fossilization.
He tells how creationists expose those gaps and claim that because of those gaps evolution is not
proven to be true. However Thomas explains that there are many difficult steps in the process of
uncovering fossils, but those difficulties don t disprove anything. He says that creationists say that
because scientists don t have the full fossil that they aren t real. Thomas explains that just because they
don t have the full fossil doesn t mean the fragment is useless. It means that there are in fact fossils in
B.C times and there could be ... Show more content on Helpwriting.net ...
Creationism is the belief that God created the universe and all that exists. There has been a long
disagreement between the evolution believers called evolutionists and Creationism believers called
creationists. Thomas defends his belief in evolutionism from the creationists. The creationists claimed
the evolutionists argument, which is fossilization, has gaps in it that make their ideals flawed. Thomas
defends his position by giving evidence on how he can prove that fossilization is valid truthful
evidence to support evolutionism. Thomas uses the explanation of the formation of the fossils to
defend his case. He gives a series of descriptive steps all telling how each step helps support his
argument, each step supporting evolution in different ways. The formation of fossils gives the
explanation that animals must die and be buried in a compositional area. This allows scientists to be
able to date the age of the discovered fossils. Thomas admits that dating fossils might not be one
hundred percent accurate, and there are gaps. Thomas also claims that dating the fossils is much more
evidence based than any evidence creationists have. This article is just a small portion of the
arguments for both sides have it s primarily evolutionists. It s just defending one of the many critiques
of the creationists. Thomas explains to the readers that even though he can t physically prove that
evolution is true, he can back up his claims with science based calculations,
... Get more on HelpWriting.net ...
15. Captain Of Industry Analysis
During the Gilded Age (1870 1900), a period in which things were fraudulent and deceitful, the
surface was clinquant while underneath that lustrous coat laid corruption. Although, entrepreneurs
such as Andrew Carnegie, J.P. Morgan, John D. Rockefeller, Jay Gould, and Cornelius Vanderbilt also
known as Captains of Industry are recognized for economic prosperity in America after the Civil War,
in 1873 and 1893 the United States suffered from a grave economic depression due to the perfidious
methods the Captain of Industry utilized. Techniques that involved corruption in the government
resulting in monopolies dominating the industry, and increasing their wealth by exploiting workers
often by extended hours and exceedingly low wages. Eventually, ... Show more content on
Helpwriting.net ...
The techniques included employees being paid low wages for long hours; the average income for a
worker was $380 (Captains of Industry or Robber Barons, background essay). By paying the workers
extremely low wages then the more profits for the employer. In 1883, a cartoon named The Protectors
of our Industry displays the inequality between the distribution of wealth in America between the
Captains of Industry and the working class. It demonstrates the Captains of Industry accruing more
wealth through the labor of the workers. As a result of the tactics utilized the men s wealth multiplied
and 9 percent of Americans controlled 75 percent of the national wealth (Captains of Industry or
Robber Barons, background essay). The author s purpose in drawing this was to inform the common
people and the working people and for them to realize what the Captains of Industry are doing is
unequitable. In 1953, a historian stated that the methods that were used were ethically questionable but
it was a natural response to the cutthroat competition of the period . However, the tactics they used by
ruining their competitors and cheating stockholders only managed to create the Panic of 1873 and the
Panic of
... Get more on HelpWriting.net ...
16. Multiple Intelligences Self Assessment Quiz
I choose to take the Multiple Intelligences Self Assessment quiz. When I taught preschool and as the
trainer for my department I have learned that there are many different methods in which people learn.
I have learned to adapt how I teach and train based on what is required by the learner. Due to this I
was curious to determine the variety of learning methods that work best for me. I discovered that I
have a broad range of ways in which I learn best. I have always excelled at learning and find that I
learn fairly quickly, so this is not surprising to me. What did surprise me was that my highest
percentage was naturalistic. One question that I often ask is, Why? I enjoy having a knowledge of how
things work and the ability to understand a variety of subjects, but did not realize how highly it
impacted my learning. The few categories where I scored low were music and body kinesthetic.
Neither of these surprise me much. When I work and am trying to concentrate I find that music and
movement is very distracting. I have learned to eliminate them when focus and concentration is
crucial. The rest of the categories I scored from 49% to 63%. I feel this explains my ability to learn a
broad spectrum of things quickly no matter what the method of learning is. The two areas where I
scored the highest were interpersonal and intrapersonal. This explains my drive for success, ability to
gain insight into a variety of situations and people, my solid foundation in who I am and what
... Get more on HelpWriting.net ...
17. Bee Bread Research Paper
According to recent testing conducted by Food Safety News, 76 percent of honey offered on the
American market isn t real honey but rather a fake product packed with sugars and toxic syrups. In
addition to this, these fake products also contain heavy metals and antibiotics!
BEES ARE FED WITH CORN SYRUP AND FRUCTOSE
The actual nutrition of the bee has a critical role in developing and keeping healthy colonies.
Carbohydrates are of utmost importance since they supply energy for all the activities within the hive.
Bees naturally get carbohydrates by collecting nectar and honeydew, but unfortunately natural sources
are limited due to the fact that harvesting honey by humans has removed the colony`s supply of
carbohydrates. Consequently, beekeepers ... Show more content on Helpwriting.net ...
But, the U.S uses this pesticide on nearly 143 million acres, which is a third of its crops. Imidacloprid
and thiamethoxam are also extensively used in the U.S, despite the fact that they have been linked to
bee death.
MOST HONEY IS FAKE
Not only all the honey in stores is fake, but it also has no bee pollen. Manufacturers use special
machines to extract it out and then mix in honey imported from China and India. Therefore, nobody is
familiar with the origin of the honey itself.
4 WAYS TO SPOT ARTIFICIAL HONEY
1. Light a Fire: Dip the tip of the matchstick in the honey and light a fire. If the match lights easily and
the flame burns off the honey, it means that it is natural. On the other hand, fake honey doesn t make
like due to the moisture it contains.
2. The Shelf Life Test: Real like crystallizes over time while the fake one remains looking like syrup,
regardless of how long it is stored.
3. The Water Test: Add a tablespoon of honey into a glass of water. If it settles at the bottom of the
glass, your honey is real. If it dissolves in the water, it`s a fake!
4. The Thumb Test: Put some honey on the thumb. If it stays intact, it`s pure. If it spreads around, it`s
... Get more on HelpWriting.net ...
18. My Experience In Math
I believe everyone is capable of learning math. Everyone has struggled with something in life, and I
always had a struggle with mathematics. When I used to live in Illinois I didn t really struggle a lot in
math till I got into the fourth grade. I was in a class with fourth and fifth graders, we would always do
assignments and take tests and I always made bad grades on it. It always took me a while to
understand things and I wasn t engaged in math so I always got distracted. Also i thought about other
things that were not related to the teachers lessons. I always lacked confidence in myself because I
always failed at doing something when it came to math. I never believed in myself and I could never
see myself exceeding in math in the future. After a while, my teacher started noticing me struggling on
every assignment. They put me in a extra class to get me help. I didn t want to be in that class because
I wanted to be taught in the same class as my friends, so it made me a little upset at everything.
Whenever I went to the class they would walk me through the math to the point where I got it. Over a
period of time I started understanding Fourth grade math a little bit and I was improving. I wasn t the
best but I still showed improvement. I could still tell I didn t have much confidence in myself because
every time I took a test I always change my answer and was never too sure if I was right or wrong.
After fourth grade I moved to Texas. Everything was so different,
... Get more on HelpWriting.net ...
19. Neglect And Lesion Analysis
In the hypothetical situation, the patient described was suffering from hemispatial neglect, a
neurological condition that results from hemispheric damage. Patients suffering from this condition
fail to acknowledge a stimuli situated contralaterally to their hemispheric lesion (Verdon, Schwartz, S,
Lovblad, Hauert, Vuilleumier, 2001). Lesions on both the left and right hemisphere can cause neglect,
however, only the right hemisphere lesions cause lasting deficits (Stone, Halligan, Greenwood, 1993),
which is the reason for the opinion that the right hemisphere is dominant for attention. Although
neglect has been associated with impairment to the right inferior parietal lobe (Vallar, 2001). neglect,
however, has also been observed within ... Show more content on Helpwriting.net ...
It is worthwhile attempting to determine whether there are common brain regions that are involved in
neglect patients. Neglect may result from different combinations of component deficit in different
patients (Husain Rorden, 2003), finding common regions across patients would suggest there may be
significant deficits that are common to many patients with
... Get more on HelpWriting.net ...
20. Assignment On Business Law Assignment
Assignment attachment form
When submitting your assignment it must be accompanied by this Assignment Attachment Form.
Please make sure that you complete all of the details correctly.
Provide ALL details requested on this form.
Use one form for each assignment.
Unit name: Business Law 1100
Given name: Elton Aik Yin
Surname: Goh
Student number: 90004481
Email: 90004481@learning.cic.wa.edu.au
Assignment title: Business Law Assignment
Date submitted: 25th August 2014
Student s comment to tutor:
Word Count: 3497
Marker s Comments
Recorded mark:
Marker:
Comments:
Part A
Question 1
Step 1: Area of law
The area of law is contract law focusing on the element of agreement.
Step 2: Principles of law
21. Contract law is defined as lawfully enforceable agreement between two or more people to a contract.
An agreement also known as a promise consists of an offer and an acceptance. An offer is defined as
indication of the terms upon which an individual is ready to be obligated. On the other hand, an
acceptance is the agreement of the terms that have been offered. The parties associated with the
agreement are known as an offeror or an offeree. The offeror is the one who makes the offer, and the
offeree is the one accepts the offer (Curtin College 2014).
For an offer to be satisfied, there are rules to be considered. The offer has to be complete, promissory,
intention to undergo a contract when accepted, and focused on an individual or a group. In addition,
... Get more on HelpWriting.net ...
22. Explain What Number Of Natural Selenium Contain Six Stable...
3.
Samples of natural selenium contain six stable isotopes. these isotopes have the same number of
proton electrons in each atom they differ in the number of neutrons in each atom, the atomic mass,
their nuclear stability
Electron configuration 1S2, 2S2, 2P6, 3s2, 3p6, 4s2, 3d10, 4p4
Indicate the number of unpaired electrons in the ground state atom it has 2 unpaired electrons in the 4P
orbital. in a chemical reaction it is likely to take 2 electrons become Se 2 or likely to do 2 covalent
bond with other atom. it is also likely to lose all 6 electrons in its valence shell become a +6, or fewer
electrons become +4 or a +2 just as sulfur does above it in the same group.
It is easier for it to lose electrons than it is for Br, this is because Br has the same atomic radius (115
pm) as does Se, but Br more protons to hold its electrons from being taken, itso has a stronger pull for
its own electrons and greater than that of tellurium. Se has a strong hold on its electrons, because it is
a smaller atom than Te, with Te s valence electrons further out the strength with which they are held
falls off by the square with distance. Te has a radius of 140 pm compared to Br s of 115 pm. ... Show
more content on Helpwriting.net ...
The History of the Periodic Table of elements is vast, and filled with interesting facts that not many
average people would know about, these four scientists have had all contributed to the table in some
way, and lead it to its current state, here is what they have
... Get more on HelpWriting.net ...
23. Political Instability And Armed Conflicts
The Arab world today is shrouded in controversy. Political instability and armed conflicts are
portrayed as the norm throughout the Middle East. According to the pseudo regional specialists, the
causes behind all the conflicts faced are obvious, religion and radicalism. Yet this fails to answer the
question, why , which opens the door to better understand the foundation of the present day Arab
states. This questions the origins to why the Arabs chose to leave the Ottoman Empire and take
support from the British Empire, which at the time seemed contradictory. Unless British involvement
with the Arabs had enticed the revolution, then to what extent did European Jihadist propaganda sway
the Arabs to revolt against the Ottoman Empire in 1916? This paper will discuss that the Arab revolt
against the Ottomans was in an effort take control of the Arab territories for themselves without the
need for external influence to push them into making the decision. As such, the alternative explanation
would be that Sharif Hussein was influenced by the British into believing that the revolt was his
opportunity to liberate the Arabs from the Ottomans. Illustrating this point will be by examining
circumstances that had led to the Arab s decision, understanding how European intervention and
motives shaped the revolt, and assessing the incentives the Arabs had for revolting. In order to fully
understand the nature of the revolt from the eyes of the Arabs, and their reasons for their actions
... Get more on HelpWriting.net ...
24. Cultural Relatedness Paper
Relatedness is the socially recognized ties that connect people in a variety of different ways. It
attempts to understand and record the ways in which people in specific ethnographic contexts
articulate and engage in the relationships that are important to them in everyday life. Relatedness can
take many forms such as friendship, marriage, parenthood, shared links to a common ancestor,
workplace association, just to name a few. These forms can be shared via many different means as
well. They can be shared physically by a body substance such as blood, semen, genes, or mother s
milk. It can be through spiritual means such as soul, spirit, nurturance, or love. You can also have
cases where more than one substance is shared.
2. There are two major strategies humans have used in constructing patterns of descent. The first
strategy involves the descent group being formed by people who believe they are related to each other
by connection made though their mothers and fathers equally. Essentially they believe that they
equally related to their fathers side as they are their mothers side. This is known as bilateral descent
(cognatic descent) from this bilateral descent arises two forms of kinship groups. The first being made
up of people who believe they are ... Show more content on Helpwriting.net ...
The major elements of kinship are marriage descent and adoption. Kinship developed through
relationship is known as marriage, kinship based on birth is termed descent, and kinship based on
nurturance alone is known as adoption. These are all selective in different societies. Marriage/mating
can be seen in some societies that may place women as the main role in the bearing of children and
giving no attention to the male s role in the conception process. Birth/descent can be seen in some
societies where they trace the connections to a person through the men, which emphasizes the paternal
role. Adoption can be seen in societies where members are encouraged to adopt not only children but
also adult
... Get more on HelpWriting.net ...
25. What Learning Has Occurred And How This Will Influence...
Chapter 6 Overview The final section of this dissertation will focus on reflecting upon the experience
of undertaking a dissertation, what learning has occurred and how this will influence future practice as
a staff nurse working in the NHS. The author will utilise Rolfe, Freshwater and Jasper s (2001) model.
The author chose this model as it is a simpler model than Gibbs (1998) model, Rolfe et al (2001)
poses the questions What? So what? And Now what? The author felt due to its simplicity that this
model was more suited to this reflection. What? The author undertook a twelve thousand word
dissertation as part of a BSc (Hons) nursing degree. The dissertation has been completed as a
patchwork text order, consisting of 4 separate pieces ... Show more content on Helpwriting.net ...
So what? From completing this dissertation the author has learnt just how important research is and
how essential it is for nurses to have an in depth understanding of the care they are giving to their
patients. This dissertation has helped the author have a great knowledge on CBT and just how
effective and valuable it is in treating people who have sexually offended. Undertaking a patchwork
assessment made the author reflect upon patient care and although we may consider an individual s
care needs individually, holistic care is the ultimate aim in delivering high quality patient care.
Holistic care is seeing the patient as a physical, spiritual and psychological whole and not just
focusing on one particular area (NursingTimes.Net 2009). A patchwork text is a type of assessment
which consists of smaller sections that once put together becomes a comprehensible and combined
piece of work (Scoggins and Winter 1999). Research is essential in all areas of nursing as nurses have
a duty to ensure they are up to date with all relevant developments in nursing and should be able to
give rationale for all care they give. Nursing research expands the evidence base and improves clinical
practice (NursingTimes.Net 2014). Nurses need to have the ability to research a subject in order to
keep up to date with the ever changing nursing practice and ultimately improve the delivery of care to
our
... Get more on HelpWriting.net ...
26. The Principle Of Separation Of Power
Our Founding Fathers were no strangers to the long standing care of a government. Throughout
history it has been proven over and over that when any one person is allowed to obtain and stockpile
power that he/she becomes the greatest threat to liberty. It is no wonder that the most famous and
treasured part of the Constitution, the separation of powers, was molded over hundreds of years.
The idea of separation of power is not necessarily a new concept. As far back as 350 B.C. the Greek
philosopher Aristotle made the observation in Politics that any government whether it be monarchal,
democratic, and etc. has three basic branches: the deliberative, the magisterial, and the judicative.
Today all three can be directly compared to: legislative, executive, and judicial within our modern day
governments. However, while Aristotle asserted that all three were basic components to any and all
governments, he did not specify that they should be wielded by separate entities of said governments.
It would not be until centuries after Aristotle s death that his idea of the different functions of
government would be separated into different branches. It was the French philosopher Baron de
Montesquieu put forth the idea that these powers should be separated, and no one person/branch
should hold multiple powers. Of course while John Locke had made the case for splitting the
legislative and executive powers, it was Montesquieu that gave our Founding Fathers the proof and/or
backing for a
... Get more on HelpWriting.net ...
27. Coubertin Hockey History
The Olympics were reinvented when Coubertin invented the International Olympic Committee in the
late 1800s. The IOC was made to modernize the games to societies standards. Coubertin had a more
inclusively cosmopolitan vision and greater organizational skills than any of his predecessors, [he]
succeeded where they had failed (Guttman,121). Originally, Coubertin chose a Greek scholar named
Demetrios Bikelas to become the first president of the IOC. He served as president for the six years
and then Coubertin took over for almost the next 30 years. Coubertin used the Olympics to introduce
new sports to the masses and to show political neutrality when countries were in conflict and/or at
war. He was separate beliefs from athletics to make the ... Show more content on Helpwriting.net ...
Hockey became a sport that everyone could bond over. From natives, immigrants, and locals, hockey
was able to form a community s collective identity regardless of where they were from and their socio
economic status. According to Bairner, there is certainly a perceived Canadian way of playing the
game that is celebrated as being in some manner indicative of a national character rugged, honest,
utilitarian (Bariner,125). This Canadian way could have effected Canada s Olympic Performances
because they do not want to be put in the same box as their southern counterpart, the United States.
Even though the two countries are connected, Canadians pride themselves on being different from the
United States and their standards. They do not want to be categorized together and the Olympics is an
opportunity for them to distinguish themselves from Americans. As another powerful nation, the
Olympics becomes a time for Canadians to prove that they are a contender among the United States,
Russia, and China. The grit that is needed in hockey and the Canadian way, is then passed along to all
the other Canadian athletes in the games. Hockey pretty much sets the tone for all the other athletes in
the summer and in the winter
... Get more on HelpWriting.net ...
28. Relationship Between Growth Opportunities And Amount Of...
relationship can be observed by comparing the small companies, where SOCO has $0.8bn retained
earnings and zero debt, while JKX has almost $0.4bn and some debt in their capital structure.
4.3. Growth Empirical studies suggest a negative relationship between growth opportunities and
amount of leverage. The market to book ratio (calculated as market value of equity over book value of
equity) is used as proxy of the growth opportunities available to a firm (Niu, 2008).
Growth opportunities are mainly intangible and thus not suited to serve as collateral or to be
liquidated. Hence firms with high growth potential might not prefer, or not even be offered, to raise
additional capital through debt financing (Jensen and Meckling, 1976).
Furthermore, due to agency conflicts, managers of companies with high leverage (debt controlled)
may forgo positive NPV projects, because the returns of such project will be transferred to debt
holders rather than shareholders. Therefore, highly leveraged companies might have low amount of
investment opportunities and thus a lower growth rate (Myers, 1984).
Rajan and Zingales (1995) support this inverse relationship and suggest, that firms with high market to
book ratios suffer under higher bankruptcy costs. The shares of such companies are overvalued and
thus the company may prefer issuing stock. This equity may be raised at lower costs, due to the
signals that a high market to book ratio is sending to the market. Therefore firms with a high
... Get more on HelpWriting.net ...
29. The Glass Castle Zeitgeism
While the era of the 1970s brought various memorable people and moments, it was also a time when
several individuals went through the process of discovering their self identity. In the novel The Glass
Castle by Jeannette Wells, she shares her adventure of finding herself, which took place during this
era. These ideas that explain the mood during this time period is known as the Zeitgeist. This specific
Zeitgeist took place during the 1970s and deals with one searching for their self identity. During this
time, people were losing and searching for who they were, and it brought several thoughts about self
identity into this period. This Zeitgeist connected to the cultural trends because it was common for
people to move to large cities, such ... Show more content on Helpwriting.net ...
Several of these poems were about how people were losing themselves. Most of them were caught in a
situation that caused them to lose who they are. This causes people to either go crazy or continue
doing what they know because they do not understand anything else. These nonfiction readings
exemplify this Zeitgeist because they each explain how someone went through the journey of finding
who they are. In, Straw Into Golds: The Metamorphosis of the Everyday, by Sandra Cisneros she
writes about her life and how she went into achieving beyond her dreams. This also ties into, They
Live the Dream, by Dan Rathe, where he writes about several different people s stories and how each
found their American Dream. He explains how there is not just one set American dream, everyone has
their own individual one. Some may not achieve their dream, but we all have created one. These art
pieces exemplify this Zeitgeist because they each show how the artist sees themselves. In the painting
by Chuck Close, he creates a very realistic painting which is created by, small dashes, dots of pigment,
thumbprints, or applied pieces of colored paper. Jean Michel Basquiat s painting is also representing
how he envisions himself. This painting looks kind of demon or monster like. When one compares
these two paintings they can see how differently these artists portrayed
... Get more on HelpWriting.net ...
30. Frederick Loewe Concert Report Sample
An exciting new performing group, the PHAZE Ensemble, will be making their concert debut on July
5th at 7pm at the Frederick Loewe Performance Hall, which is housed in the Watchorn Hall building,
home to the School of Music, on the University of Redlands campus. With free admission to the
concert, the event is being billed as welcoming of all, from seasoned concert goers to those whom for
this maybe the first concert experience.
This inaugural concert is called Caged Birdsong: An Evening of New Music and is themed around
Maya Angelou s famous poem, Caged Bird. The group will be performing contemporary music by
living and late composers, as well as premiering a collaboratively composed work by the members of
PHAZE that is a creative exploration
... Get more on HelpWriting.net ...
31. Reconstruction Era Essay
The Reconstruction Era
America s great Reconstruction Era took place in the 1865 1877 time frame lasting a little over 14
years containing some of the most important moments in America s history. Creating freedom and
natural rights to all. The Thirteenth, Fourteenth and Fifteenth Amendment were created in this item
period supporting most reasoning towards the Reconstruction Era introducing a series of laws and
constitutional amendments to try to secure civil and political rights for black people
The Thirteenth Amendment was one of the most influential amendments to have ever been passed in
our country and meant an ending to slavery. It passed by the Senate on April 8th in 1864 and by the
House on January 31st in ... Show more content on Helpwriting.net ...
President Lincoln issued the Emancipation Proclamation on January 1st in 1863 announcing that all
people held as slaves shall be free. Lincoln hoped to inspire all blacks and slaves in the Confederacy
even though the proclamation was limited in many ways. It applied only to states that had seceded
from the Union, leaving slavery untouched in the loyal border states. While the freedom was promised
depended upon the Union military victory. The Emancipation Proclamation did not end slavery in the
nation but shaped the reasoning for war. Approximately 200,000 black soldiers and sailors had fought
for freedom and the Union. This confirmed the battle a war for freedom. For all that the Emancipation
Proclamation did for freedom, it is now taken place among the great documents of human freedom.
This amendment effected our nation in many ways. It negatively affected families and friends
relationships by choosing their own sides of the wars and what they felt were right. Some white
farmers had to sell their farms due to losing slave workers and most whites were unhappy. By
abolishing slavery we were able to make many positive changes as well including the economy. Many
job opportunities opened up for white people due to the lack of slaves while blacks had a hard time
finding jobs at first but were even able to eventually find jobs for themselves(ushistory.org,2008
2017). As
... Get more on HelpWriting.net ...
32. Tas2r38 Locus Lab Summary
Summary: The objective of the project is to determine if I carry the allele at the TAS2R38 locus. In
order to find that out, DNA was extracted from cells within the mouth. The DNA sample was
quantified, amplified by PCR, ran through gel electrophoresis, purified and sequenced. The results for
my DNA was not able to be determined through sequencing. The DNA samples of the class recorded
that 62% of the participants were tasters (carries the allele at the TAS2R38 locus) and 38% of the
participants were non tasters (does not carry the allele at the TAS2R38 locus). Objective: The
objective of the project is to be able to determine which alleles are carried at the TAS2R38 locus and
verify if the genotype reflects the expected phenotype. Methods: ... Show more content on
Helpwriting.net ...
If you are a taster, the paper will seem bitter. If you are not a taster, the paper will not have a flavor
and taste plain. Results and Analysis: Experiment 1 2: The DNA concentration was 60 ng/µL
(6.00*10^4 ng/mL). The total yield was 0.6 ng (60 ng/µL DNA /100 µL H2O). The DNA sample was
divided by 100 µL instead of 25 µL of H2O because the sample was diluted 4 times. Experiment 3:
The forward primer found is 5 ATGCCTTTCGTTTTCTTGGTG 3 . The reverse primer found is 5
ATCTGCCAGTTGAGCCTTGT 3 . Experiment 4 5: PCR did not work for my obtained DNA as there
was no evidence of movement of the DNA. PCR did work for lab numbers 33 and 12. The size of my
fragment could not be determined and cannot compare to the size that was expected. The negative
control was clean as there was no traces of movements. Experiment 6: The DNA concentration after
TAS2R38 PCR purification and quantification was 0.344 ng/µL (34.4 ng/mL). My genotype at the
TAS2R38 locus was not determined by the sequencing. The genotypic frequencies of the class
obtained by sequencing: 0.4 (40%) TT, 0.4 (40%) Tt, 0.2 (20%) tt. The allelic frequencies of the class
obtained by sequencing: 0.6 (60%) T and 0.4 (40%)
... Get more on HelpWriting.net ...
33. Is Cheerleading A Sport Essay
Is Cheerleading a Sport? A lot of people do not consider cheerleading to be a sport. When most people
think of cheerleading, they think of pretty girls in skirts, waving pompons, cheering for their school s
football or basketball team. Although that can be true, that is not all cheerleading is. There are two
types of cheerleading. There is sideline cheerleading, and there is competitive cheerleading. Sideline
cheerleading is what goes on at a football or basketball games. Competitive cheerleading is what is
shown on television stations like ESPN where a team of guys and girls preform a routine. Although
sideline cheerleading is not considered a sport, competitive cheerleading is. Sideline cheerleading is
what people most often see. According to Renee R., Sideline cheerleaders main goal is to entertain the
crowd and lead them with team cheers... (Renee R.) When people see often cheerleaders at a sporting
event, they are seen as the sideshow to the game who dances, preform cheers, and shows spirit that
supports their school s ... Show more content on Helpwriting.net ...
Whether people think that it is or not, that does not get in the way of these athletes of doing what they
love. The Meriam Webster Dictionary definition of an athlete says, A person who is trained in or good
at sports, games, or exercises that require physical skill and strength. (http://www.merriam
webster.com/dictionary/athlete) Is that not what a cheerleader is? Asia Webb writes an article about
her feeling on this debate. She says, So what if we don t play in the dirt with pads or slide across home
plate after hitting a home run? We throw girls in the air and practice every day. You have to be
physically and emotionally strong to be a cheerleader. The strength in us comes from not only our
exercise but also our commitment to cheer. (Asia Webb) This quotes shows that cheerleading is so
much more than people think it
... Get more on HelpWriting.net ...
34. Connor Mcdavid Character
When Connor McDavid met with the media at the Bell Centre before Sunday afternoon s game
against the Canadiens, he looked like your typical, 20 year old Canadian kid.
A little awkward physically as he continues to grow into his body at 6 foot 1 and 190 pounds, soft
spoken and battling a bit of acne. But there s nothing typical about McDavid once he hits the ice.
The young Edmonton captain didn t score a goal as the Oilers beat the Canadiens 1 0 in a shootout,
but he was named the first star and was exciting to watch every time he hit the ice, logging 25:07. He
had a game high six shots on goal and drew three penalties with his blazing speed.
You could sell tickets just to watch McDavid skate by himself. It s a thing of beauty with his effortless
... Show more content on Helpwriting.net ...
He s got the weight of the world on him, to be perfectly honest. He handles himself with poise and
grace and respect and love of the game, and it s great to see a young guy like him in his 20s really
enjoy and love coming to the rink and competing every day to be the best player he can be. As an
older guy now, it s something that you can feed off of and I think that s what s made him a great leader
and a good captain so far.
So, what did McDavid do on his Saturday night in Montreal?
Not too much ... just kind of hung out, he said. It s definitely a fun city and a good place to be at, but
you got to keep it pretty serious.
McDavid still has close friends back home in Richmond Hill, Ont., who just go to school and do
normal teenage things. They must be living vicariously through their superstar friend, no?
I think it s kind of the other way around, McDavid said. I kind of live through them on Saturday nights
when you re in bed by 9. You wake up and hear the stories and I think they definitely follow what I m
doing and stuff like that. But they re all having a good time and doing their thing.
So is McDavid. He s just not your typical
... Get more on HelpWriting.net ...
35. Was The Reconstruction A Success Or A Failure Essay
Discuss Whether Reconstruction Was a Success or a Failure. Reconstruction is the period of
rebuilding the south that succeeded the Civil War (1861 1865). This period of time is set by the
question now what? The Union won the war and most of the south was destroyed. Devastation,
buildings turned into crumbles and lost crops. The South was drowning in poverty. To worsen the
situation there were thousands of ex slaves that were set free by the Emancipation Proclamation and
the 13 Amendment. All these ex slaves , Dr. Susan Walens commented, and no place to put them, The
ex slaves weren t just homeless but they had no rights, unlike white man. The government and
congress had to solve the issues present in the south and the whole nation ... Show more content on
Helpwriting.net ...
This was working alright until President Johnson, who had preceded Lincoln, order all the land under
federal control to be given back to whom they were taken from (Foner). This is a big setback for
reconstruction and freed slaves. The Freedmen Bureau was the federal institution in control of those
terrains given to blacks and now they had to take it back. Under the administration of O. O. Howard
the bureau functions were to establish schools, provide aide to the poor and aged, settle disputes
between whites and blacks and among freedpeople, and secure for former slave and white Unionist
equal treatment before court, (Foner 483). The Bureau did not have enough agents to put in action the
task appointed to it in the south. The Freedmen Bureau was dissolved after five years living the black
man on its own. Something that President Johnson did to start the period of Reconstruction was to
pardon all Confederates soldiers if they plead loyalty and alliance to the Union. No one was held
accountable for what happened, one man was murder. Also he demanded that the states in the south
abolish slavery and change their constitution in order to be accepted into the United States. Those
were Andrew Johnson terms for Reconstructions. Not very efficient because it leaves all these
defeated soldiers, filled with anger and violence in the streets. Then Congress tried to pass the Civil
Rights bill and the 14th amendment which
... Get more on HelpWriting.net ...
36. How To Dissected Frogs
I ve been tasked to write about a enjoyable educational activity I did at school. So today I ve chosen to
tell you guys about the time we dissected frogs in 7th grade. It was the funniest and the most smelliest
activity I have ever done and I ll tell you why. There are a lot of reasons it was the funniest and the
most smelliest activity. The first and obvious reason to why it smelled so bad was because of the frogs.
The frogs had been in a bucket that was filed with a stinky preservation liquid all school year so when
they opened the buckets it reeked. The smell of the open buckets quickly spread in the air and made
everybody cover their noses with their shirts. It was so bad that the smell even began to spread
through are clothes. The second
... Get more on HelpWriting.net ...
37. Biometric Facial Recognition
When determining the perpetrator of a crime, fingerprint identification and biometric facial
recognition are commonly used forensic methods. Fingerprint identification, which is defined by
Thomas E. Baker (2016) as the matching of fingerprint patterns found on surfaces to those of known
persons (Thomas E. Baker, 2016), has long been an accurate way of identifying persons since the
early 20th century. Biometric facial recognition on the other hand, is a method of identification which
has come into fruition of late due to advances in modern computing and imagery technology.
Biometric facial recognition is defined by Joseph Dewey and the Salem Press Encyclopedia (2013) as
computer applications that can identify a person using a digital image of his or her face and comparing
it to a database of stored facial images (Dewey et al., 2013). When comparing, and contrasting these
two forensic methods of ... Show more content on Helpwriting.net ...
The process involves establishing a database of known fingerprints, which were stored based on
employment needs, criminal processing, or voluntarily. To identify a person based on fingerprints, the
technician uses the analysis of fingerprint minutiae, such as ridge endings, dots, islands, bifurcations,
and other features, for the specific identification of a person (Thomas E. Baker, 2016). The process of
making an identification based off the method of facial recognition is far more advanced. Facial
recognition measures distinguishing facial features such as the dimensions of the nose, the distance
between eye sockets, the slope of the forehead, the line and size of the jaw, and the contours of the
cheeks (Dewey et al., 2013). Once the subjects photograph is obtained by the specific system, it uses
the above parameters to compare the subjects photograph to one which had been previously taken and
stored in the organizations
... Get more on HelpWriting.net ...
38. Essay On Australia s Physical Features And Climate
Student name:Zhen hu
Student ID:GEC00000A3
Unit code: VU21470 Task 1
Discuss Australia s Physical features and climate 1.Lake Batyo at North Control Victoria. 2.Lake
Corangamite at Western District Lakes, Victoria. 3.Lake Hindmorsh at Whinmera, Victoria. 4.Murray
River at New South Wales. 5.Warrego River at Queensland, New South Wales. 6.Cooper Creek at
Queensland, South Australia. 7. Marat Bogong at Alptne National park, Victoria, Australia . 8.Mount
Battle Frere at Queensland , Australia . 9.Great Victoria at Western Australia , South Australia .
10.Great Sandy at Western Australia , South Australia . 11.Great Sandy at Western Australia , Northern
Territory 12.Tiran at South Australia. 13. Western ... Show more content on Helpwriting.net ...
The most interesting facts is despite Australia is a sixth largest country in the world, But also begin the
world s smallest continent. Task 2 25. The coastal areas of Australia are affected by climate change.
26. The impacts from climate change across a number of sectors, including water security, agriculture,
coastal communities, and infrastructure. 27. The species and places depend on intricate ecosystems,
and even small changes to the climate can disrupt the delicate balance of nature. 28. Stop cutting down
trees, cutting down trees is the prime reason of the climate change shocking, every year 33 millions
acres of forests are cut down. If we improve the agricultural practices witch includes forest
management and proper paper recycling, there is a change that an equilibrium could be maintained of
cutting trees and planting new trees.
Task 3
1. Melbourne 2. Air and water pollution 3. Urban sprang has been another counterpart factor to
Australia pollution problems. As more and more people move to the cities, the pressures on resources
increase more water electricity and cars are used in a more concentrated areas. Air pollution is a major
result of these pressures. 4. 1) using renewable energy. 2) Reducing reliance on pollution products like
cars. 3) charging Industries that produce high levels of pollution.
Task 4
I will introduce myself and tell the class what I will be talking about. Today I m
... Get more on HelpWriting.net ...