Research Assistance with Dr. Xiao-Ning Zhang at St. Bonaventure University

1. Sinead Coleman, Jason Chien, Xiao-Ning Zhang
Department of Biology, St. Bonaventure University, St. Bonaventure, NY 14778
Abstract A. B.
A. SR45.1 (AS1)
SR45.2 (AS2)
SR45 is an important splicing factor that is involved in
multiple developmental processes in Arabidopsis thaliana. CATCTCCTCAACGGAAAACAG
T S P Q R K T G
SR45 has two splicing isoforms, SR45.1 and SR45.2, that
Alternative Acceptor Site (21 nt.)
play distinct roles in root growth and flower development.
SR45.1 has two hypothesized phosphorylation sites,
threonine 218 (T218) and serine 219 (S219), that are missing
in SR45.2. To further investigate the function of these two
C.
B.
sites after phosphorylation, we substituted these amino acids
in the existing SR45.1-GFP construct with aspartic acid (D)
and glutamic acid (E) by site-direct mutagenesis. The
resulting mutant genes were transformed into sr45-1 mutant
plants to generate stable transgenic plants. Figure 2 Transgenic plants overexpressing different SR45-GFP constructs.
The transgenic plant lines were screened by examining their A. Domain arrangement of SR45.1, SR45.2, and mutant constructs with different amino acid substitutions.
resistance to herbicide and selected by the presence of the B and C: An example of the expression of SR45.1 mutant proteins visualized by GFP. GFP signal
GFP signal. Our results show that the expression level of was detected in nucleus of root cells in the SR45.1S219E construct.
GFP and its sustainability are directly related to the B: Root tip. Scale bar represents 100µm. C: Nucleus. Scale bar represents 10µm.
effectiveness of the transgene. For the petal development,
substitutions at either/both sites recovered the normal
development to various degrees. For root growth, the double A. B. Figure 4 Phosphorylation Mimicking on threonine (T218)
substitution resulted in overgrowth, while the substitution on
and serine (S219) in SR45.1.
T218 gave a better recovery than the substitution on S219
A. Two SR45 isoforms: SR45.1 and SR45.2. Exons are shown as green
alone. Therefore these data suggest that the phosphorylation
boxes; introns are shown as straight lines; untranslated regions (UTRs)
of both T218 and S219 may not be necessary for the normal
are shown as white boxes. The alternative 3’ splice site sequence that is
function of SR45.1 in both root and petal development.
present in SR45.1 but missing in SR45.2 is shown with its deduced amino
However, a phosphorylated T218, but not a phosphorylated
acid sequence.
S219, may be required for a fully functional SR45.1 in roots
B. Structure similarity of phosphoserine, phosphothreonine, aspartic
and petals
acid (D) and glutamic acid (E).
Conclusion
In order to study the functional difference between SR45.1 and
SR45.2, we identified two residues (T218 and S219) present in SR45.1
but absent in SR45.2 as potential targets for phosphorylation
C. D. modification. Due to the structural similarity between the
phosphorylated residues and phosphorylation mimics, namely D and E,
we substituted T218 and S219 with D and E to generate a set of
SR45.1 mutant genes and introduced them into sr45-1 mutant plants,
separately. By analyzing the degree of recovery from mutant
phenotypes in these transgenic plants, we found that both T218D and
T218E had a greater effect on recovering both root growth and petal
development to wild type than S219D and S219E. When both T218
and S219 were forced to be negatively charged by phosphorylation
mimics, the root exhibited exaggerated growth, while the observations
on petal development were not conclusive. This indicates that SR45.1
may be phosphorylated at T218 rather than S219 in its active form in
roots. However, since these two residues are missing in SR45.2,
SR45.2 is regulated differently from SR45.1. This study provided
Figure 3 Amino acid substitutions and their effect on root growth and flower petal further evidence on the difference between two isoforms of SR45 and
how it may contribute to the distinct functions of the two isoforms in
development.
regulating plant development and growth.
Plants of Col wild type, sr45-1 and two independent transgenic lines for each amino acid substitution
were used for all the analysis. Reference
A and B: Root growth. Root length was measured from 4-day-old seedlings. Error bars show the X.-N. Zhang & S. M. Mount. Two alternatively spliced isoforms of the
standard deviation (n=15). Arabidopsis thaliana SR45 protein have distinct roles during normal
C and D: Petal development. Petal width-to-length ratio was measured from individual flowers plant development. Plant Physiol. 2009, 150(3): 1-9.
randomly picked from plants at 10 days after flowering. Error bars show the standard deviation (n=19). *
presents statistical difference compared to Col; † presents statistical difference compared to the sr45-1 This Project is supported by the National Science Foundation and St
Figure 1 Experimental procedure mutant (p<0.05). Bonaventure University.