SlideShare ist ein Scribd-Unternehmen logo
1 von 27
Chapter 13
From DNA to Protein
From Genes to Proteins
Your traits are determined by proteins that are
built according to instructions in DNA.
These sections of DNA are your genes.
The first step in decoding the DNA instructions is
to copy part of the DNA into RNA.
13.1 RNA
Like DNA, RNA consists of a long chain of
nucleotides.
3 main differences between DNA and RNA:
The sugar in RNA is ribose, not deoxyribose.
RNA is single – stranded, while DNA is double –
stranded
RNA contains uracil instead of thymine.
3 Types of RNA:
1. Messenger RNA (mRNA) –
serves as “messengers” from
DNA to the rest of the cell.
2. Ribosomal RNA (rRNA) –
make up ribosomes
3. Transfer RNA (tRNA) – transfers
each amino acid to the ribosome.
tRNA
A
G
U
Met Amino Acid
Anticodon
RNA Synthesis: Transcription
Occurs in the nucleus
Copying part of DNA into a complementary
sequence in RNA.
Requires an enzyme known as RNA
polymerase.
RNA polymerase binds to DNA and separates the
DNA strands.
It uses one strand of DNA as a template to make a
strand of mRNA.
How does RNA polymerase
know where to start?
Promoters – have specific base sequences
where RNA polymerase will bind to begin
transcription.
Practice
DNA Template strand:
TACGGATCCTAAC
Write the corresponding mRNA sequence:
In eukaryotes, many genes are
interrupted by introns, which have no
coding information.
Exons are the portions of a gene that
are translated.
After transcription the introns in the
mRNA are cut out by spliceosomes.
13.2 Ribosomes and
Protein Synthesis
Translation
The sequence of bases in mRNA serve as
instructions for the order of amino acids to
produce proteins (polypeptides).
Steps of Translation:
1. mRNA transcribed
from DNA moves to
the cytoplasm.
2. mRNA attaches to a
ribosome.
3. As mRNA moves
across the
ribosome the
proper amino
acid is attached
to the growing
amino acid
chain.
This is the job
of tRNA
4. A peptide bond
forms between the
amino acids.
 until the ribosome
reaches a stop
codon
 releases the amino
acid chain.
The Genetic Code
RNA contains 4 bases: adenine, uracil, cytosine,
guanine
These 4 letters code for 20 amino acids.
The code is read 3 letters at a time.
Each group of 3 letters is known as a codon.
Separate the following mRNA
sequence into codons:
UCGCACGGU
The codon AUG can serve as a “start” codon for
protein synthesis (Methionine).
There are also 3 “stop” codons which act like a
period at the end of a sentence.
Table can be found on p. 367.
Practice Problems
Transcribe and translate the following DNA
sequences:
1. TACGGATATAAGCCGTTAATT
mRNA:
Protein (polypeptide):
2. TACAAATGGTTCCTTACAACT
mRNA:
Protein (polypeptide):
Mutations
Mutations in gametes can be passed on to
offspring, but mutations in body cells affect only
the individual in which they occur.
Gene Mutations
Point mutation – a single nucleotide
change
Insertion
ATCGGA → ATCCGGA
Frameshift Mutations
Deletion
ATCGGA → ATGGA
Substitution
ATCGGA → ACCGGA
Transcribe and translate the following DNA
sequence:
TACTATACCTGGACT
mRNA:
Protein (polypeptide):
Now transcribe and translate that same gene with an
insertion mutation:
TACTATACCTGGACCT
mRNA:
Protein (polypeptide):
How does this protein differ from the original?

Weitere ähnliche Inhalte

Was ist angesagt?

Rna and protein synthesis
Rna and protein synthesisRna and protein synthesis
Rna and protein synthesisMuhmmad Asif
 
Biosnthesis of rna
Biosnthesis of rnaBiosnthesis of rna
Biosnthesis of rnanazish66
 
12.3 DNA - RNA - Amino Acid - Protein
12.3 DNA - RNA - Amino Acid - Protein12.3 DNA - RNA - Amino Acid - Protein
12.3 DNA - RNA - Amino Acid - Proteinsbcvmi06
 
Protein synthesis with turning point
Protein synthesis with turning pointProtein synthesis with turning point
Protein synthesis with turning pointtas11244
 
Dna replication copy
Dna replication   copyDna replication   copy
Dna replication copyRammy Az
 
Powerpoint 13.2
Powerpoint 13.2Powerpoint 13.2
Powerpoint 13.2Mneel1
 
Lecture 3 protein synthesis
Lecture 3 protein synthesisLecture 3 protein synthesis
Lecture 3 protein synthesiswodrick philemon
 
Unit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rnaUnit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rnaNondumiso _P Zondi
 
Unit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rnaUnit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rnaRUBYKENKE
 

Was ist angesagt? (17)

Biological molecules
Biological moleculesBiological molecules
Biological molecules
 
Translation
TranslationTranslation
Translation
 
Rna and protein synthesis
Rna and protein synthesisRna and protein synthesis
Rna and protein synthesis
 
Biosnthesis of rna
Biosnthesis of rnaBiosnthesis of rna
Biosnthesis of rna
 
12.3 DNA - RNA - Amino Acid - Protein
12.3 DNA - RNA - Amino Acid - Protein12.3 DNA - RNA - Amino Acid - Protein
12.3 DNA - RNA - Amino Acid - Protein
 
Lesson 13.1
Lesson 13.1Lesson 13.1
Lesson 13.1
 
Protein synthesis with turning point
Protein synthesis with turning pointProtein synthesis with turning point
Protein synthesis with turning point
 
Dna replication copy
Dna replication   copyDna replication   copy
Dna replication copy
 
Lesson 13.2
Lesson 13.2Lesson 13.2
Lesson 13.2
 
Powerpoint 13.2
Powerpoint 13.2Powerpoint 13.2
Powerpoint 13.2
 
Lecture 3 protein synthesis
Lecture 3 protein synthesisLecture 3 protein synthesis
Lecture 3 protein synthesis
 
Rna structure
Rna structureRna structure
Rna structure
 
Presentation
PresentationPresentation
Presentation
 
Transfer rna
Transfer rna Transfer rna
Transfer rna
 
Unit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rnaUnit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rna
 
Unit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rnaUnit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rna
 
Unit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rnaUnit 2 genetics nucleic acid rna
Unit 2 genetics nucleic acid rna
 

Andere mochten auch

Ch 10 Notes for website
Ch 10 Notes for websiteCh 10 Notes for website
Ch 10 Notes for websitepetersbiology
 
Biology - Chp 16 - Evolution Of Populations - Powerpoint
Biology - Chp 16 - Evolution Of Populations - PowerpointBiology - Chp 16 - Evolution Of Populations - Powerpoint
Biology - Chp 16 - Evolution Of Populations - PowerpointMr. Walajtys
 
Chapter 13 How Populations Evolve
Chapter 13 How Populations EvolveChapter 13 How Populations Evolve
Chapter 13 How Populations EvolveWesley McCammon
 
Notes chapter 7part1
Notes chapter 7part1Notes chapter 7part1
Notes chapter 7part1petersbiology
 
Notes chapter 7part2
Notes chapter 7part2Notes chapter 7part2
Notes chapter 7part2petersbiology
 
Biology Unit 4 notes
Biology Unit 4 notesBiology Unit 4 notes
Biology Unit 4 notespetersbiology
 
Ch28&29 notes Nervous system and the eye
Ch28&29 notes Nervous system and the eyeCh28&29 notes Nervous system and the eye
Ch28&29 notes Nervous system and the eyepetersbiology
 
Biology 2 Chapter 5 notes
Biology 2 Chapter 5 notesBiology 2 Chapter 5 notes
Biology 2 Chapter 5 notespetersbiology
 
Bio 2 Chapter 30 - Bones and Muscles
 Bio 2 Chapter 30 - Bones and Muscles Bio 2 Chapter 30 - Bones and Muscles
Bio 2 Chapter 30 - Bones and Musclespetersbiology
 
Powerpoint 13.1
Powerpoint 13.1Powerpoint 13.1
Powerpoint 13.1Mneel1
 
Using QR Codes in the EFL classroom to motivate reading
Using QR Codes in the EFL classroom to motivate readingUsing QR Codes in the EFL classroom to motivate reading
Using QR Codes in the EFL classroom to motivate readingJavier Aguirre
 

Andere mochten auch (20)

Notes ch16
Notes ch16Notes ch16
Notes ch16
 
Ch 10 Notes for website
Ch 10 Notes for websiteCh 10 Notes for website
Ch 10 Notes for website
 
Biology - Chp 16 - Evolution Of Populations - Powerpoint
Biology - Chp 16 - Evolution Of Populations - PowerpointBiology - Chp 16 - Evolution Of Populations - Powerpoint
Biology - Chp 16 - Evolution Of Populations - Powerpoint
 
Chapter 13 How Populations Evolve
Chapter 13 How Populations EvolveChapter 13 How Populations Evolve
Chapter 13 How Populations Evolve
 
The flipped classroom
The flipped classroomThe flipped classroom
The flipped classroom
 
Notes ch12 DNA
Notes ch12 DNANotes ch12 DNA
Notes ch12 DNA
 
Notes chapter 7part1
Notes chapter 7part1Notes chapter 7part1
Notes chapter 7part1
 
Notes chapter 7part2
Notes chapter 7part2Notes chapter 7part2
Notes chapter 7part2
 
Concept 30.4
Concept 30.4Concept 30.4
Concept 30.4
 
Notes ch12 DNA
Notes ch12 DNANotes ch12 DNA
Notes ch12 DNA
 
Notes ch12 DNA
Notes ch12 DNANotes ch12 DNA
Notes ch12 DNA
 
Biology Unit 4 notes
Biology Unit 4 notesBiology Unit 4 notes
Biology Unit 4 notes
 
Ch28&29 notes Nervous system and the eye
Ch28&29 notes Nervous system and the eyeCh28&29 notes Nervous system and the eye
Ch28&29 notes Nervous system and the eye
 
Ch12 notes
Ch12 notesCh12 notes
Ch12 notes
 
Biology 2 Chapter 5 notes
Biology 2 Chapter 5 notesBiology 2 Chapter 5 notes
Biology 2 Chapter 5 notes
 
Bio 2 Chapter 30 - Bones and Muscles
 Bio 2 Chapter 30 - Bones and Muscles Bio 2 Chapter 30 - Bones and Muscles
Bio 2 Chapter 30 - Bones and Muscles
 
Chapter 9 part 1
Chapter 9 part 1 Chapter 9 part 1
Chapter 9 part 1
 
Chapter 8 notes
Chapter 8 notesChapter 8 notes
Chapter 8 notes
 
Powerpoint 13.1
Powerpoint 13.1Powerpoint 13.1
Powerpoint 13.1
 
Using QR Codes in the EFL classroom to motivate reading
Using QR Codes in the EFL classroom to motivate readingUsing QR Codes in the EFL classroom to motivate reading
Using QR Codes in the EFL classroom to motivate reading
 

Ähnlich wie Notes ch13 website

Rna protein-synthesis
Rna protein-synthesisRna protein-synthesis
Rna protein-synthesislegoscience
 
1.4 Genetic code in the DNA and RNA.pptx
1.4 Genetic code in the DNA and RNA.pptx1.4 Genetic code in the DNA and RNA.pptx
1.4 Genetic code in the DNA and RNA.pptxMeharSaeed2
 
section 5, chapter 4
section 5, chapter 4section 5, chapter 4
section 5, chapter 4Michael Walls
 
Transcription and Translation.pptx
Transcription and Translation.pptxTranscription and Translation.pptx
Transcription and Translation.pptxMANJUSINGH948460
 
03.5 biochemistry - transcription & translation
03.5   biochemistry - transcription & translation03.5   biochemistry - transcription & translation
03.5 biochemistry - transcription & translationmralfordscience
 
BiologyExchange.co.uk Shared Resource
BiologyExchange.co.uk Shared ResourceBiologyExchange.co.uk Shared Resource
BiologyExchange.co.uk Shared Resourcebiologyexchange
 
Chapter 10 keynote.key
Chapter 10 keynote.keyChapter 10 keynote.key
Chapter 10 keynote.keytaipion
 
Chapter13 worksheets
Chapter13 worksheetsChapter13 worksheets
Chapter13 worksheetsCXG050
 
Transcription & Translation
Transcription & TranslationTranscription & Translation
Transcription & TranslationCrystal Wood
 
Protein synthesis
Protein synthesisProtein synthesis
Protein synthesisFiza Khan
 
TRANSCRIPTION AND TRANSLATION.pptx
TRANSCRIPTION AND TRANSLATION.pptxTRANSCRIPTION AND TRANSLATION.pptx
TRANSCRIPTION AND TRANSLATION.pptxJane360787
 
3.5 transcription & translation
3.5 transcription & translation3.5 transcription & translation
3.5 transcription & translationcartlidge
 
Chapter 13 packet
Chapter 13 packetChapter 13 packet
Chapter 13 packetjfg082
 
Transcription and Translation part 2.ppt
Transcription and Translation part 2.pptTranscription and Translation part 2.ppt
Transcription and Translation part 2.pptmikeebio1
 
Transcription and Translation part 2.ppt
Transcription and Translation part 2.pptTranscription and Translation part 2.ppt
Transcription and Translation part 2.pptmikeebio1
 
Protein Syntheis
Protein SyntheisProtein Syntheis
Protein Syntheisallyjer
 
IB Biology 2.7 Slides: Transcription & Translation
IB Biology 2.7 Slides: Transcription & TranslationIB Biology 2.7 Slides: Transcription & Translation
IB Biology 2.7 Slides: Transcription & TranslationJacob Cedarbaum
 
protien synthesis (1).pptx
protien synthesis (1).pptxprotien synthesis (1).pptx
protien synthesis (1).pptxFatmaEhab7
 

Ähnlich wie Notes ch13 website (20)

Rna protein-synthesis
Rna protein-synthesisRna protein-synthesis
Rna protein-synthesis
 
1.4 Genetic code in the DNA and RNA.pptx
1.4 Genetic code in the DNA and RNA.pptx1.4 Genetic code in the DNA and RNA.pptx
1.4 Genetic code in the DNA and RNA.pptx
 
section 5, chapter 4
section 5, chapter 4section 5, chapter 4
section 5, chapter 4
 
Translation
TranslationTranslation
Translation
 
Transcription and Translation.pptx
Transcription and Translation.pptxTranscription and Translation.pptx
Transcription and Translation.pptx
 
03.5 biochemistry - transcription & translation
03.5   biochemistry - transcription & translation03.5   biochemistry - transcription & translation
03.5 biochemistry - transcription & translation
 
BiologyExchange.co.uk Shared Resource
BiologyExchange.co.uk Shared ResourceBiologyExchange.co.uk Shared Resource
BiologyExchange.co.uk Shared Resource
 
Chapter 10 keynote.key
Chapter 10 keynote.keyChapter 10 keynote.key
Chapter 10 keynote.key
 
Chapter13 worksheets
Chapter13 worksheetsChapter13 worksheets
Chapter13 worksheets
 
BU5.3 Protein Synthesis
BU5.3 Protein SynthesisBU5.3 Protein Synthesis
BU5.3 Protein Synthesis
 
Transcription & Translation
Transcription & TranslationTranscription & Translation
Transcription & Translation
 
Protein synthesis
Protein synthesisProtein synthesis
Protein synthesis
 
TRANSCRIPTION AND TRANSLATION.pptx
TRANSCRIPTION AND TRANSLATION.pptxTRANSCRIPTION AND TRANSLATION.pptx
TRANSCRIPTION AND TRANSLATION.pptx
 
3.5 transcription & translation
3.5 transcription & translation3.5 transcription & translation
3.5 transcription & translation
 
Chapter 13 packet
Chapter 13 packetChapter 13 packet
Chapter 13 packet
 
Transcription and Translation part 2.ppt
Transcription and Translation part 2.pptTranscription and Translation part 2.ppt
Transcription and Translation part 2.ppt
 
Transcription and Translation part 2.ppt
Transcription and Translation part 2.pptTranscription and Translation part 2.ppt
Transcription and Translation part 2.ppt
 
Protein Syntheis
Protein SyntheisProtein Syntheis
Protein Syntheis
 
IB Biology 2.7 Slides: Transcription & Translation
IB Biology 2.7 Slides: Transcription & TranslationIB Biology 2.7 Slides: Transcription & Translation
IB Biology 2.7 Slides: Transcription & Translation
 
protien synthesis (1).pptx
protien synthesis (1).pptxprotien synthesis (1).pptx
protien synthesis (1).pptx
 

Mehr von petersbiology

Chapter 10 notes - Cell Growth and Division
Chapter 10 notes - Cell Growth and DivisionChapter 10 notes - Cell Growth and Division
Chapter 10 notes - Cell Growth and Divisionpetersbiology
 
Notes photosynthesis and cr
Notes  photosynthesis and crNotes  photosynthesis and cr
Notes photosynthesis and crpetersbiology
 
Biology 1 Unit 3 notes
Biology 1 Unit 3 notesBiology 1 Unit 3 notes
Biology 1 Unit 3 notespetersbiology
 
03 lecture_presentation
 03 lecture_presentation 03 lecture_presentation
03 lecture_presentationpetersbiology
 
02 lecture_presentation
 02 lecture_presentation 02 lecture_presentation
02 lecture_presentationpetersbiology
 
Honors ch2 notes 2013
Honors ch2 notes 2013Honors ch2 notes 2013
Honors ch2 notes 2013petersbiology
 
Bio 1 Ch 1 notes 2013
Bio 1 Ch 1 notes 2013Bio 1 Ch 1 notes 2013
Bio 1 Ch 1 notes 2013petersbiology
 

Mehr von petersbiology (13)

Ch14 notes website
Ch14 notes websiteCh14 notes website
Ch14 notes website
 
Chapter 10 notes - Cell Growth and Division
Chapter 10 notes - Cell Growth and DivisionChapter 10 notes - Cell Growth and Division
Chapter 10 notes - Cell Growth and Division
 
Notes photosynthesis and cr
Notes  photosynthesis and crNotes  photosynthesis and cr
Notes photosynthesis and cr
 
Chapter 9 part 2
Chapter 9 part 2Chapter 9 part 2
Chapter 9 part 2
 
Chapter 5 notes
Chapter 5 notesChapter 5 notes
Chapter 5 notes
 
Chapter 4 Notes
Chapter 4 NotesChapter 4 Notes
Chapter 4 Notes
 
Biology 1 Unit 3 notes
Biology 1 Unit 3 notesBiology 1 Unit 3 notes
Biology 1 Unit 3 notes
 
03 lecture_presentation
 03 lecture_presentation 03 lecture_presentation
03 lecture_presentation
 
02 lecture_presentation
 02 lecture_presentation 02 lecture_presentation
02 lecture_presentation
 
Honors ch2 notes 2013
Honors ch2 notes 2013Honors ch2 notes 2013
Honors ch2 notes 2013
 
Ch2 notes 2013
Ch2 notes 2013Ch2 notes 2013
Ch2 notes 2013
 
Bio 2 ch1 Notes
Bio 2 ch1 NotesBio 2 ch1 Notes
Bio 2 ch1 Notes
 
Bio 1 Ch 1 notes 2013
Bio 1 Ch 1 notes 2013Bio 1 Ch 1 notes 2013
Bio 1 Ch 1 notes 2013
 

Kürzlich hochgeladen

The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsJoaquim Jorge
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityPrincipled Technologies
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherRemote DBA Services
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdfhans926745
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEarley Information Science
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Igalia
 
Tech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfTech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfhans926745
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024The Digital Insurer
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)wesley chun
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Enterprise Knowledge
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsMaria Levchenko
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoffsammart93
 

Kürzlich hochgeladen (20)

The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Artificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and MythsArtificial Intelligence: Facts and Myths
Artificial Intelligence: Facts and Myths
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
 
Tech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdfTech Trends Report 2024 Future Today Institute.pdf
Tech Trends Report 2024 Future Today Institute.pdf
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed texts
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
 

Notes ch13 website

  • 1. Chapter 13 From DNA to Protein
  • 2. From Genes to Proteins Your traits are determined by proteins that are built according to instructions in DNA. These sections of DNA are your genes. The first step in decoding the DNA instructions is to copy part of the DNA into RNA.
  • 3. 13.1 RNA Like DNA, RNA consists of a long chain of nucleotides. 3 main differences between DNA and RNA: The sugar in RNA is ribose, not deoxyribose. RNA is single – stranded, while DNA is double – stranded RNA contains uracil instead of thymine.
  • 4. 3 Types of RNA: 1. Messenger RNA (mRNA) – serves as “messengers” from DNA to the rest of the cell. 2. Ribosomal RNA (rRNA) – make up ribosomes
  • 5. 3. Transfer RNA (tRNA) – transfers each amino acid to the ribosome. tRNA A G U Met Amino Acid Anticodon
  • 6. RNA Synthesis: Transcription Occurs in the nucleus Copying part of DNA into a complementary sequence in RNA. Requires an enzyme known as RNA polymerase. RNA polymerase binds to DNA and separates the DNA strands. It uses one strand of DNA as a template to make a strand of mRNA.
  • 7. How does RNA polymerase know where to start? Promoters – have specific base sequences where RNA polymerase will bind to begin transcription.
  • 8.
  • 9.
  • 10. Practice DNA Template strand: TACGGATCCTAAC Write the corresponding mRNA sequence:
  • 11. In eukaryotes, many genes are interrupted by introns, which have no coding information. Exons are the portions of a gene that are translated. After transcription the introns in the mRNA are cut out by spliceosomes.
  • 12. 13.2 Ribosomes and Protein Synthesis Translation The sequence of bases in mRNA serve as instructions for the order of amino acids to produce proteins (polypeptides).
  • 13.
  • 14. Steps of Translation: 1. mRNA transcribed from DNA moves to the cytoplasm. 2. mRNA attaches to a ribosome.
  • 15. 3. As mRNA moves across the ribosome the proper amino acid is attached to the growing amino acid chain. This is the job of tRNA
  • 16. 4. A peptide bond forms between the amino acids.  until the ribosome reaches a stop codon  releases the amino acid chain.
  • 17. The Genetic Code RNA contains 4 bases: adenine, uracil, cytosine, guanine These 4 letters code for 20 amino acids. The code is read 3 letters at a time. Each group of 3 letters is known as a codon.
  • 18. Separate the following mRNA sequence into codons: UCGCACGGU
  • 19. The codon AUG can serve as a “start” codon for protein synthesis (Methionine). There are also 3 “stop” codons which act like a period at the end of a sentence.
  • 20. Table can be found on p. 367.
  • 21. Practice Problems Transcribe and translate the following DNA sequences: 1. TACGGATATAAGCCGTTAATT mRNA: Protein (polypeptide):
  • 23. Mutations Mutations in gametes can be passed on to offspring, but mutations in body cells affect only the individual in which they occur.
  • 24. Gene Mutations Point mutation – a single nucleotide change Insertion ATCGGA → ATCCGGA Frameshift Mutations Deletion ATCGGA → ATGGA Substitution ATCGGA → ACCGGA
  • 25.
  • 26. Transcribe and translate the following DNA sequence: TACTATACCTGGACT mRNA: Protein (polypeptide):
  • 27. Now transcribe and translate that same gene with an insertion mutation: TACTATACCTGGACCT mRNA: Protein (polypeptide): How does this protein differ from the original?