SlideShare ist ein Scribd-Unternehmen logo

Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities

•
•
Yoon Sup Choi
Yoon Sup Choi

I reviewed recent advances, challenges, and opportunities to implement clinical cancer genomics. Case studies of advanced systems, such as Foundation Medicine, MI-ONCOSEQ are introduced for benchmark. A few fundamental limitations to establish personalized oncology are also discussed.

Wissenschaft
1 von 115
Clinical Genomics for Personalized Cancer Medicine : Recent Advances, Challenges, and Opportunities 서울대학병원 의생명연구원 최윤섭, Ph.D.
“It's in Apple's DNA that technology alone is not enough. It's technology married with liberal arts.”
The Convergence of IT, BT and Medicine
The Greatest Scientific Achievement in 20 century?
What have been changed?
http://greatprojectscampaign.com/human-genome-project.html
2003 Human Genome Project 13 years (676 weeks) $2,700,000,000 2007 Dr. CraigVenter’s genome 4 years (208 weeks) $100,000,000 2008 Dr. James Watson’s genome 4 months (16 weeks) $1,000,000 2009 (Nature Biotechnology) 4 weeks $48,000 현재 1-2 weeks ~$5,000
13 years 1 week (676 weeks) Over the last decade,
$2,700,000,000 ~$5,000 Over the last decade,
Ferrari 458 Spider $398,000 40 cents http://www.guardian.co.uk/science/2013/jun/08/genome-sequenced
The Age of The $1000 Genome is Coming!
Illumina HiSeq XTen full coverage human genomes for less than $1,000
The $1000 Genome is Already Here!
A T G C DNA = Biological Data = Digital Data
GTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGC GGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCG TCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCC GGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCAC CGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCT TCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGC AGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCC ACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGC TCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGT AAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGC CCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGA GGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCG CCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCT CGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGG ACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATC GCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCG ACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGA ACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCC CGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGAC TCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCT GCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGC GCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCG TTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGG CCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACA GGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGC GAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAA AGGTAAGGGCGTGTCTCGCCGGCTCCCCCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCG ACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTC CCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTG AGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGG CTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCC GGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCAC CGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGG CGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCCCACCGCGCACGGCCCCCTGACTCCGTCC AGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGC GAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCC CGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCG CCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGAC GGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCC CGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCG CCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGG CGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGC Big Data
Human Genome = 3 billion base pair = 100 GB ~ 10TB
High performance computing power is the key!
Personalized Cancer Genome Analysis
Depression Asthma Diabetes Arthritis Alzheimer Cancer 62% 60% 57% 50% 30% 25% Source of data: Brian B. Spear, Margo Heath-Chiozzi, Jeffery Huff, “ClinicalTrends in Molecular Medicine,”Volume 7, Issue 5, 1 May 2001, Pages 201-204. PERCENTAGE OFTHE PATIENT POPULATION FOR WHICH A PARTICULAR DRUG IS EFFECTIVE
Tumor Heterogeneity Meric-Bernstam F, Mills GB. Nat Rev Clin Oncol. 2012 Sep;9(9):542-8.
in the understanding of tumour heterogeneity; second, the role of surgery as a therapeutic modality in the era of targeted therapy; third, the use of personalized therapy in the perioperative period and, finally, the possibilities of personalization of surgical procedures according to lung cancer subtypes. VATS lobectomy showed that intraoperative blood loss was significantly reduced in the VATS group compared with open lobectomy in nine studies; however, no differ- ence was observed in five studies and the values were not reported in seven studies.12 Hospital stay was also signifi- cantly shorter in VATS group in five studies. Park et al.,13 Heterogeneity in patients with adenocarcinoma of the lung according to driver oncogenes Heterogeneity within patients with EGFR mutation Heterogeneity in resistance mechanisms in one patient HER2 3% EGFR ~40% in Asians ~15% in Caucasians ALK ~5% KRAS ~15% in Asians ~30% in Caucasians RET ~1% ROS1 ~1% BRAF ~1% PIK3CA ~1% NRAS ~1% MET <5% Others? Exon 19del ~50% L858R ~40% Sensitive Inherent resistance CRKL ~3% BIM 20–40% IκB ~30% Inherent T790M ~2% by sequencing ~30% by sensitive method Further heterogeneity EGFR-TKI Drug X T790M MET a cb T790M Heterogeneity in patients with adenocarcinoma of the lung according to driver oncogenes Heterogeneity within patients with EGFR mutation Heterogeneity resistance mecha in one patien HER2 3% EGFR ~40% in Asians ~15% in Caucasians ALK ~5% KRAS ~15% in Asians ~30% in Caucasians RET ~1% ROS1 ~1% BRAF ~1% PIK3CA ~1% NRAS ~1% MET <5% Others? Exon 19del ~50% L858R ~40% Sensitive Inherent resistance CRKL ~3% BIM 20–40% IκB ~30% Inherent T790M ~2% by sequencing ~30% by sensitive method Further heterogeneity EGFR-TKI Drug T790M ME a cb T790M Figure 1 | Various classes of tumour heterogeneity in adenocarcinoma of the lung. a | Heterogeneity in patients with adenocarcinoma of the lung according to driver oncogenes that are crucial for selecting targeted drugs for treatment.2,76 Number of people reflects approximate incidence.2,76 b | Heterogeneity in patients with EGFR mutations, resulting in MitsudomiT, Suda K,YatabeY. Nat Rev Clin Oncol. 2013 Apr;10(4):235-44. Heterogeneity in Lung Adenocarcinoma
Percent 20 15 10 5 0 BRCA 1/2 PIK3CA am pPTEN delA KT am pN F1 del KRA S CD KN 2A del CCN D 1 am p CCN E1 am pRB1 del Percent 80 60 40 20 0 EG FR ERBB2PD G FRA M ET N F1 RA S PTEN PI3KCD KN 2A CD K4/6 RB1 ID H 1/2 emrofitluMamotsalboilGrecnaCnairavO KRAS EGFR ALK BRAF PIK3CA MET ERBB2 MEK1 NRAS ROS RET Other? Lung Adenocarcinoma EGFR ERBB2/3 FGFR PI3K MAPK TOR Other? Lung Squamous Cancer ERBB2 PIK3CA AKT FGFR1 amp PTEN Other? Breast Cancer KRAS PTEN PIK3CA KRAS+ PIK3CAERBB2/3 BRAF NRAS Other? Colorectal Cancer BRAF NRAS NF1 KIT Other? Melanoma CDKN2A CCND1 PTEN PIK3CA HRAS EGFR, ERBB2 Other? Head and Neck Squamous Cancer (PTEN and CDKN2A are frequently inactivated) CBA D E HG F Levi A. Garraway Garraway LA. J Clin Oncol. 2013 May 20;31(15):1806-14. Genomic alterations in common solid tumors. Expanding catalogs of cancer mutations dispel the notion that cancer mutations are tissue-specific Roychowdhury S et al. SciTransl Med. 2011 Nov 30;3(111):111ra121.
Although the number of actionable alterations in any individual cancer patient’s sample was low (average, 1.57), a wide variety of alter- ations was observed across all samples, with 1,579 unique alterations reported. Actionable Genomic Alterations Were Identified in a Large Number of Genes assay, highlighting the broad applicability of the approach. Given that matched normal specimens are not routinely collected in clinical practice, reporting focused on known sites of somatic mutation39, truncations or homozygous deletions of known tumor suppressor genes40, as well as known amplifications of oncogenes and gene fusions in genes known to be rearranged in solid tumors. Alterations were reported in 174/189 (92%) of tested genes, with an surprising to observe that current clinical testing paradigms compris- ing only mutation hotspots10,11,43 capture less than one-third of total actionable results (Fig. 6c). The therapeutic implications of the long tail were particularly notable for proven targets of therapy, as exemplified by ERBB2. Although ERBB2 is currently clinically validated only as an amplified or overexpressed drug target in breast and gastro-esophageal cancer, we observed ERBB2 ab Head & neck 4% Soft tissue, 6% Unknown, 9% Gene amplification, 33% Sub/indel, 8% Gene deletion, 8% Mutation hotspots, 31% Lung, 18% Rearrangement, 3% Truncation, 17% Breast, 14% Colon, 7%Pancreas, 5% Ovary, 5% Skin, 3% Liver, 3% Uterus, 3% Others, 26% Patientsamples(%) c 40 45 35 30 25 20 15 10 5 0 TP53KR AS APCM C L1 R B 1 N F1 B R C A2 AU R KAN KX2_1 KIT ESR 1 IG F1R R ET TSC 2 M SH 6 ALK EW SR 1 PD G FR A R U N X1 VH L FG FR 2 M AP2K4 TET2 C C N D 2 M ET C D K6 N F2 C C N D 3 FG FR 3 PIK3R 1 AKT1 B AP1 R PTO R C D H 1 ID H 1 AKT2 SM AR C A4 SO X2 KD M 6A D N M T3A N O TC H 1 N R AS LR P1B R IC TO R B R C A1 C TN N B 1 ATM FB XW 7 C C N E1 PTPR D STK11 SM AD 4 B R AF C D K4 FG FR 1 ER B B 2 M D M 2 EG FR C C N D 1 AR ID 1A PTEN C D KN 2B PIK3C AM YC C D KN 2A amples(%) d 30 25 20 15 e Lung (17) Unknown (2) Stomach (1) Pancreas (1) Ovary (1) Bladder (1) Duodenum (1)ERBB2 Furin-Like TM Tyrosine_KinaseFurin-Like R678Q(4) L755S(4) D769Y(3) V842I(4) Receptor_L Receptor_L Colon (2) Uterus (4) Breast (8) ollected somatic n tumor cogenes tumors. with an ing only mutation hotspots10,11,43 capture less than one-third of total actionable results (Fig. 6c). The therapeutic implications of the long tail were particularly notable for proven targets of therapy, as exemplified by ERBB2. Although ERBB2 is currently clinically validated only as an amplified or overexpressed drug target in breast and gastro-esophageal cancer, we observed ERBB2 nknown, 9% Gene amplification, 33% Sub/indel, 8% Gene deletion, 8% Mutation hotspots, 31% 18% Rearrangement, 3% Truncation, 17% Breast, 14% % c AU R KAN KX2_1 KIT ESR 1 IG F1R R ET TSC 2 M SH 6 ALK EW SR 1 PD G FR A R U N X1 VH L FG FR 2 M AP2K4 TET2 C C N D 2 M ET C D K6 N F2 C C N D 3 FG FR 3 PIK3R 1 AKT1 B AP1 R PTO R C D H 1 ID H 1 AKT2 SM AR C A4 SO X2 KD M 6A D N M T3A N O TC H 1 N R AS LR P1B R IC TO R R C A1 1 Lung (17) Unknown (2) Stomach (1) Pancreas (1) Ovary (1) Bladder (1) Duodenum (1) Furin-Like TM Tyrosine_Kinase R678Q(4) L755S(4) D769Y(3) P780_Y781insGSP(4) V842I(4) Receptor_L Colon (2) Uterus (4) Breast (8) Nat Biotechnol. 2013 Nov;31(11):1023-31.
The Long Tail Comprehensive genomic profiling through WGS is necessary vs.Targeted Seq, SNP chips, Hotspot Panels, Single gene tests…
Cell cycle DNA methylationGenome integrity HIPPO signalling Histone Histone modifier MAPK signalling Metabolism NFE2L Other PI(3)K signalling Protein phosphatase Proteolysis Ribosome RTK signalling Splicing TGF-β signalling TOR signalling Transcription factor/regulator Wnt/β-catenin signalling BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer MIR142 B4GALT3 EGR3 CRIPAK PRX LIFR AR EPPK1 HGF NPM1 USP9X NCOR1 POLQ ARHGAP35 MALAT1 LRRK2 NOTCH1 NAV3 STK11 MTOR RPL5 RPL22 PTPN11 PPP2R1A NFE2L3 NFE2L2 IDH2 IDH1 TET2 DNMT3A AJUBA CDH1 PCBP1 U2AF1 SF3B1 SPOP KEAP1 FBXW7 HIST1H2BD H3F3C HIST1H1C SOX17 TBL1XR1 AXIN2 CTNNB1 APC ACVR2A SMAD2 ACVR1B TGFBR2 SMAD4 AKT1 PIK3CG TLR4 PIK3R1 PTEN PIK3CA MAPK8IP1 MAP2K4 NRAS BRAF MAP3K1 NF1 KRAS CDKN2C CDKN1A CCND1 CDKN1B CDK12 RB1 CDKN2A FGFR3 KIT FGFR2 EPHB6 PDGFRA ERBB4 EPHA3 FLT3 EGFR ERCC2 RAD21 CHEK2 SMC3 SMC1A BRCA1 BAP1 STAG2 ATR BRCA2 ATRX ATM TP53 EZH2 ASXL1 ARID5B MLL4 KDM6A KDM5C SETBP1 NSD1 SETD2 PBRM1 ARID1A MLL2 MLL3 FOXA2 CEBPA VEZF1 ELF3 SOX9 CBFB PHF6 FOXA1 EIF4A2 WT1 SIN3A TBX3 MECOM RUNX1 TSHZ2 TAF1 CTCF EP300 TSHZ3 GATA3 VHL 0.0 0.1 0.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 0.2 0.0 0.1 0.5 0.0 0.0 0.2 0.0 0.0 1.2 0.0 0.9 0.2 1.0 0.3 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.0 0.4 0.3 2.0 0.3 0.0 0.3 1.0 0.5 0.0 5.3 0.0 0.0 0.4 0.7 5.1 0.5 0.5 0.7 1.7 1.2 0.5 0.4 1.2 0.3 1.3 0.9 1.0 0.8 5.2 0.0 2.7 0.5 0.0 0.9 1.7 0.6 1.7 1.2 1.0 0.7 2.1 0.0 2.3 0.5 0.0 1.8 3.5 0.3 3.5 1.2 2.0 0.3 0.0 2.8 2.7 0.7 0.0 3.1 4.0 0.3 3.0 1.4 1.0 0.5 0.0 0.3 2.7 0.2 0.0 10.5 5.8 0.6 1.3 1.7 0.0 0.0 0.0 0.3 0.3 0.0 27.0 0.9 0.0 0.0 0.4 1.8 3.1 1.2 0.0 0.7 4.3 1.0 0.5 5.3 4.6 0.3 6.5 2.1 8.2 3.9 0.5 0.7 3.3 0.7 0.0 2.6 3.5 0.3 1.3 2.2 7.1 0.8 0.5 1.0 4.3 1.2 0.0 5.7 9.2 1.0 3.9 2.4 5.1 0.9 0.5 0.7 3.7 1.2 0.5 4.0 5.8 1.6 10.0 2.5 15.3 1.1 0.0 0.0 6.3 1.9 0.0 9.7 5.8 1.0 0.0 2.7 5.1 0.7 2.6 1.0 5.0 1.4 0.0 6.6 11.5 2.9 3.5 2.8 5.1 0.4 0.0 0.0 19.3 1.0 0.5 3.1 8.1 0.6 1.7 3.1 5.1 1.4 2.1 1.0 7.3 1.4 0.0 21.5 19.0 1.3 5.2 4.6 0.0 0.3 0.0 0.0 0.3 0.2 0.0 8.8 1.7 0.0 0.4 0.9 2.0 1.4 3.6 1.4 1.3 6.0 0.0 7.5 4.6 1.9 5.2 3.0 0.0 0.4 0.0 2.8 0.0 1.4 0.0 0.4 1.2 0.0 0.9 0.7 0.0 0.0 0.0 0.3 0.7 0.5 0.0 0.4 0.0 0.0 10.9 1.0 0.0 0.1 1.0 1.7 0.3 0.2 4.5 2.6 1.7 0.3 0.9 1.0 1.0 0.1 1.6 0.0 1.3 1.2 0.0 1.3 4.6 1.3 8.7 1.5 3.1 0.8 0.0 0.3 1.3 0.2 0.0 0.0 2.3 0.3 1.7 0.8 9.2 0.1 0.0 0.0 5.3 1.2 0.0 2.2 14.9 0.0 5.2 2.3 0.0 0.0 1.6 0.0 0.0 0.0 10.0 0.4 0.0 0.0 0.4 0.8 3.1 0.3 0.0 5.2 0.3 0.5 9.5 0.9 1.2 0.0 0.9 1.5 3.1 0.4 0.0 0.7 0.3 1.9 8.5 3.1 2.3 0.0 2.2 1.6 0.0 0.5 1.0 0.0 1.7 1.2 25.5 4.0 4.0 1.0 1.3 2.8 2.0 0.1 0.0 0.3 6.0 0.5 0.0 0.9 0.0 0.0 0.0 0.8 5.1 7.0 0.5 0.3 1.3 0.5 0.0 1.3 1.7 0.3 3.0 2.5 1.0 0.0 2.6 0.0 0.0 0.2 0.0 0.4 0.0 0.0 0.9 0.3 1.0 0.3 0.5 0.0 1.3 0.0 4.0 2.6 0.0 0.0 0.9 0.8 4.1 1.8 1.0 0.7 0.7 1.0 0.5 2.2 2.3 0.0 2.2 1.3 1.0 0.1 0.0 0.0 1.0 0.0 0.0 0.4 0.6 0.3 6.5 0.7 3.1 0.1 0.0 0.0 4.0 0.5 0.0 17.1 12.1 0.3 1.3 2.6 9.2 0.8 11.4 0.3 5.0 0.2 0.0 1.3 5.2 1.0 11.7 3.0 1.0 0.0 0.0 0.0 1.3 0.0 0.0 0.0 1.2 0.3 2.6 0.4 0.0 0.0 0.0 0.7 0.7 0.0 0.0 1.8 1.2 0.0 0.9 0.4 1.0 0.4 1.0 0.7 1.3 0.2 0.0 0.4 0.6 1.3 0.0 0.6 0.0 0.0 0.5 0.3 0.3 0.0 0.0 0.4 0.0 0.0 3.0 0.3 2.0 1.1 0.0 0.0 1.0 0.7 0.0 2.2 1.2 0.3 1.3 0.8 3.1 0.1 3.6 0.3 1.7 0.2 0.0 0.9 0.6 0.3 2.6 0.9 2.0 0.1 4.7 0.3 0.7 0.2 0.0 3.5 1.7 0.6 28.3 2.9 4.1 0.5 81.9 0.3 4.0 1.4 0.0 9.2 4.0 2.2 5.7 7.3 1.0 0.5 2.6 0.0 0.7 0.2 0.0 0.9 1.2 0.0 0.4 0.6 1.0 0.5 5.7 0.0 1.0 0.5 0.0 0.9 1.2 0.0 1.3 0.9 0.0 0.7 3.6 0.0 1.3 1.0 0.0 2.2 1.2 0.3 1.7 1.0 3.1 0.4 2.6 0.7 3.0 0.2 0.0 0.9 1.7 1.0 1.3 1.1 2.0 0.4 9.8 0.3 2.0 0.5 0.0 3.1 2.9 0.0 0.0 1.4 0.0 2.5 0.0 0.3 0.7 0.5 0.0 0.0 0.6 0.0 1.3 0.9 2.0 0.4 0.5 2.4 2.7 0.7 0.0 5.3 7.5 1.0 1.3 1.7 2.0 1.2 0.0 0.3 2.0 0.5 0.5 11.4 5.8 1.0 0.4 1.9 1.0 2.5 2.1 11.4 1.7 0.5 0.0 1.3 0.6 0.3 30.9 4.4 3.1 3.8 1.0 30.7 1.3 4.3 0.0 2.2 8.1 0.6 63.5 9.7 17.4 33.6 17.6 11.0 20.6 2.9 0.0 4.4 14.9 0.6 52.2 17.8 2.0 0.3 2.1 0.7 0.7 0.5 0.0 1.8 1.2 0.3 0.4 0.7 0.0 4.1 2.6 0.0 0.3 0.0 0.0 1.3 0.6 0.3 1.3 1.4 2.0 0.1 8.8 0.3 0.0 0.0 7.5 1.8 0.6 0.6 2.6 1.5 2.0 0.4 3.6 2.1 1.0 0.2 0.0 6.6 4.6 0.6 0.9 1.5 3.1 7.2 0.0 2.1 1.0 1.2 0.0 1.8 1.7 0.3 3.5 2.7 7.1 2.5 1.0 11.0 2.7 1.7 1.0 11.8 10.3 3.8 3.5 4.4 0.0 0.8 45.1 0.7 0.3 0.2 4.0 26.3 1.2 0.6 20.0 6.7 0.0 0.0 0.0 1.0 0.0 0.2 0.0 0.0 0.6 0.6 0.0 0.2 12.2 0.0 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.3 0.0 0.6 2.0 0.1 0.0 0.0 0.3 0.0 0.0 0.9 0.6 0.0 5.2 0.6 2.0 0.9 1.0 0.3 0.7 0.0 0.0 1.8 0.0 0.3 0.9 0.7 4.1 0.9 1.6 0.3 1.7 1.4 0.0 3.1 0.6 2.9 2.2 1.5 14.3 1.8 0.5 8.3 3.0 0.2 0.0 5.3 6.9 1.9 3.9 3.2 4.1 0.0 0.5 0.7 21.3 1.0 0.0 6.6 14.9 0.0 0.4 3.6 8.2 0.1 0.5 1.4 1.7 1.4 0.0 0.4 2.3 0.3 0.4 1.0 1.0 0.5 1.0 1.0 1.0 0.7 4.0 1.8 3.5 1.9 2.2 1.4 2.0 0.9 0.0 0.3 0.7 0.2 0.0 3.1 2.3 0.0 10.4 1.5 3.1 0.4 0.0 1.4 1.3 1.2 0.0 9.7 3.5 0.3 1.7 1.6 6.1 0.4 1.0 3.8 1.0 1.4 0.5 6.6 4.0 1.0 1.3 1.9 2.0 0.8 3.6 0.3 4.3 1.4 0.0 7.5 5.2 0.0 2.6 2.1 1.0 0.5 3.1 1.0 3.7 0.5 0.5 8.8 6.3 1.0 2.2 2.1 2.0 0.4 0.0 1.7 0.7 0.5 26.5 4.0 4.0 1.0 0.9 2.7 1.0 0.7 1.6 26.6 4.7 1.7 1.0 11.4 2.9 1.9 1.3 4.6 12.2 0.1 0.5 0.0 0.3 0.2 0.0 1.3 0.0 0.3 0.4 0.7 2.0 0.5 1.0 0.3 1.0 0.0 2.5 2.6 1.2 0.3 0.9 0.9 2.0 0.4 0.0 1.7 2.3 0.7 0.0 0.9 1.2 0.3 1.3 0.9 1.0 0.4 0.0 1.4 1.7 1.2 3.5 2.6 2.3 0.3 0.4 1.2 3.1 0.8 1.6 1.7 1.0 0.5 3.5 1.3 0.6 1.3 4.4 1.5 4.1 1.6 0.0 1.0 2.7 1.0 0.0 3.5 5.2 3.5 0.9 1.9 4.1 0.3 0.0 0.7 1.0 10.1 0.0 1.3 0.6 0.6 2.2 2.0 10.2 0.9 1.0 4.1 0.7 1.7 3.0 2.6 3.5 1.0 3.9 2.2 4.1 0.8 2.1 1.4 5.3 1.2 0.0 5.7 4.0 0.6 7.0 2.4 6.1 1.7 1.6 1.4 3.7 1.9 0.0 5.7 5.8 3.2 4.4 2.7 8.2 1.2 1.0 5.5 4.3 1.9 0.0 6.1 5.8 0.6 3.0 2.8 11.2 2.1 5.7 1.4 2.7 2.9 0.0 7.9 4.0 1.3 6.5 3.3 50.0 32.9 58.6 28.3 69.8 2.2 7.5 51.8 79.3 94.6 27.8 42.0 1.0 0.1 0.0 1.0 0.3 0.7 1.5 2.2 2.3 0.0 1.7 0.8 3.1 0.4 1.6 0.0 3.0 1.0 2.5 1.3 5.2 0.0 0.9 1.3 3.1 0.4 0.0 0.3 3.3 0.7 0.0 2.2 1.7 0.6 9.6 1.6 7.1 0.7 2.1 2.1 2.7 1.0 0.0 1.8 4.0 0.3 8.3 2.0 26.5 1.1 0.0 1.0 2.7 1.0 1.5 0.9 4.0 0.0 0.9 2.0 1.0 0.5 0.5 0.7 1.0 6.5 0.0 4.8 2.9 1.9 2.2 2.0 2.0 0.4 1.6 1.4 3.0 1.4 1.0 12.7 5.2 0.0 2.2 2.2 6.1 0.3 0.5 0.3 10.6 1.0 0.0 3.1 5.2 0.6 5.7 2.4 6.1 1.2 2.6 1.7 2.3 11.5 0.5 7.9 2.9 1.9 2.6 3.6 6.1 0.4 0.0 0.7 2.3 32.9 0.0 1.8 3.5 0.3 2.6 5.4 27.6 2.0 5.7 0.7 3.0 2.9 0.5 6.1 6.3 1.0 30.0 5.4 25.5 1.6 1.6 1.7 17.9 3.1 0.5 8.8 20.1 0.6 8.3 5.9 24.5 6.4 2.6 3.1 7.3 3.6 0.5 18.4 15.5 1.9 5.2 6.6 1.0 0.0 0.5 0.0 0.0 0.0 0.0 0.0 0.0 0.6 4.8 0.5 0.0 0.0 0.0 0.0 0.0 0.2 6.5 0.0 0.6 0.0 0.0 0.5 2.0 0.9 0.0 0.7 0.7 0.0 0.0 0.9 1.7 0.0 0.0 0.6 8.2 0.1 3.6 0.0 0.3 0.0 0.0 0.4 0.0 0.3 0.4 0.6 0.0 0.1 4.2 1.0 0.7 0.7 0.0 1.3 0.6 0.0 0.4 0.7 1.0 2.1 0.0 0.0 0.0 0.2 1.0 0.4 0.6 0.0 0.4 0.7 3.1 0.4 0.0 0.3 0.3 0.5 3.0 0.9 1.2 0.3 1.3 0.8 4.1 1.7 0.0 1.0 0.7 0.0 0.0 0.4 0.6 0.0 0.0 0.8 2.0 0.5 2.6 0.0 0.0 0.7 0.0 1.8 1.2 0.6 1.3 0.8 0.0 0.1 1.0 0.7 0.0 0.7 6.0 3.5 2.3 0.0 0.4 1.0 1.0 0.5 0.5 0.7 0.7 0.5 0.0 1.8 2.9 0.6 5.2 1.1 3.1 2.4 1.0 0.0 0.7 0.0 0.0 4.4 2.9 1.0 1.3 1.4 5.1 0.5 1.0 1.4 1.7 1.0 0.0 3.5 4.6 0.6 3.0 1.5 1.0 3.3 1.0 0.0 0.7 0.0 9.0 0.4 0.0 0.0 1.3 1.6 4.1 0.9 3.1 2.4 1.3 0.7 0.0 6.6 3.5 1.0 1.7 1.8 2.0 1.1 1.6 1.4 2.3 1.2 0.0 4.0 6.9 1.6 8.7 2.3 2.0 2.4 1.6 0.0 3.3 0.5 0.5 1.3 0.0 0.3 16.5 2.4 17.4 0.8 2.1 0.3 8.0 1.4 0.0 0.9 4.6 0.3 5.2 2.5 2.0 0.7 3.1 0.7 1.3 1.2 0.5 14.9 6.3 1.0 3.9 2.6 1.0 10.6 1.0 0.0 2.0 0.0 0.0 2.6 2.9 0.3 0.4 3.2 0.0 0.0 0.0 0.0 0.0 52.3 0.0 0.0 0.6 0.0 0.9 6.9 Cell cycle DNA methylationme integrity HIPPO signalling Histone ne modifier MAPK signalling Metabolism NFE2L Other PI(3)K signalling Protein phosphatase Proteolysis Ribosome K signalling Splicing TGF-β signalling TOR signalling anscription or/regulator Wnt/β-catenin signalling BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer MIR142 B4GALT3 EGR3 CRIPAK PRX LIFR AR EPPK1 HGF NPM1 USP9X NCOR1 POLQ ARHGAP35 MALAT1 LRRK2 NOTCH1 NAV3 STK11 MTOR RPL5 RPL22 PTPN11 PPP2R1A NFE2L3 NFE2L2 IDH2 IDH1 TET2 DNMT3A AJUBA CDH1 PCBP1 U2AF1 SF3B1 SPOP KEAP1 FBXW7 HIST1H2BD H3F3C HIST1H1C SOX17 TBL1XR1 AXIN2 CTNNB1 APC ACVR2A SMAD2 ACVR1B TGFBR2 SMAD4 AKT1 PIK3CG TLR4 PIK3R1 PTEN PIK3CA MAPK8IP1 MAP2K4 NRAS BRAF MAP3K1 NF1 KRAS CDKN2C CDKN1A CCND1 CDKN1B CDK12 RB1 CDKN2A FGFR3 KIT FGFR2 EPHB6 PDGFRA ERBB4 EPHA3 FLT3 EGFR ERCC2 RAD21 CHEK2 SMC3 SMC1A BRCA1 BAP1 STAG2 ATR BRCA2 ATRX ATM TP53 EZH2 ASXL1 ARID5B MLL4 KDM6A KDM5C SETBP1 NSD1 SETD2 PBRM1 ARID1A MLL2 MLL3 FOXA2 CEBPA VEZF1 ELF3 SOX9 CBFB PHF6 FOXA1 EIF4A2 WT1 SIN3A TBX3 MECOM RUNX1 TSHZ2 TAF1 CTCF EP300 TSHZ3 GATA3 VHL 0.0 0.1 0.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 0.2 0.0 0.1 0.5 0.0 0.0 0.2 0.0 0.0 1.2 0.0 0.9 0.2 1.0 0.3 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.0 0.4 0.3 2.0 0.3 0.0 0.3 1.0 0.5 0.0 5.3 0.0 0.0 0.4 0.7 5.1 0.5 0.5 0.7 1.7 1.2 0.5 0.4 1.2 0.3 1.3 0.9 1.0 0.8 5.2 0.0 2.7 0.5 0.0 0.9 1.7 0.6 1.7 1.2 1.0 0.7 2.1 0.0 2.3 0.5 0.0 1.8 3.5 0.3 3.5 1.2 2.0 0.3 0.0 2.8 2.7 0.7 0.0 3.1 4.0 0.3 3.0 1.4 1.0 0.5 0.0 0.3 2.7 0.2 0.0 10.5 5.8 0.6 1.3 1.7 0.0 0.0 0.0 0.3 0.3 0.0 27.0 0.9 0.0 0.0 0.4 1.8 3.1 1.2 0.0 0.7 4.3 1.0 0.5 5.3 4.6 0.3 6.5 2.1 8.2 3.9 0.5 0.7 3.3 0.7 0.0 2.6 3.5 0.3 1.3 2.2 7.1 0.8 0.5 1.0 4.3 1.2 0.0 5.7 9.2 1.0 3.9 2.4 5.1 0.9 0.5 0.7 3.7 1.2 0.5 4.0 5.8 1.6 10.0 2.5 15.3 1.1 0.0 0.0 6.3 1.9 0.0 9.7 5.8 1.0 0.0 2.7 5.1 0.7 2.6 1.0 5.0 1.4 0.0 6.6 11.5 2.9 3.5 2.8 5.1 0.4 0.0 0.0 19.3 1.0 0.5 3.1 8.1 0.6 1.7 3.1 5.1 1.4 2.1 1.0 7.3 1.4 0.0 21.5 19.0 1.3 5.2 4.6 0.0 0.3 0.0 0.0 0.3 0.2 0.0 8.8 1.7 0.0 0.4 0.9 2.0 1.4 3.6 1.4 1.3 6.0 0.0 7.5 4.6 1.9 5.2 3.0 0.0 0.4 0.0 2.8 0.0 1.4 0.0 0.4 1.2 0.0 0.9 0.7 0.0 0.0 0.0 0.3 0.7 0.5 0.0 0.4 0.0 0.0 10.9 1.0 0.0 0.1 1.0 1.7 0.3 0.2 4.5 2.6 1.7 0.3 0.9 1.0 1.0 0.1 1.6 0.0 1.3 1.2 0.0 1.3 4.6 1.3 8.7 1.5 3.1 0.8 0.0 0.3 1.3 0.2 0.0 0.0 2.3 0.3 1.7 0.8 9.2 0.1 0.0 0.0 5.3 1.2 0.0 2.2 14.9 0.0 5.2 2.3 0.0 0.0 1.6 0.0 0.0 0.0 10.0 0.4 0.0 0.0 0.4 0.8 3.1 0.3 0.0 5.2 0.3 0.5 9.5 0.9 1.2 0.0 0.9 1.5 3.1 0.4 0.0 0.7 0.3 1.9 8.5 3.1 2.3 0.0 2.2 1.6 0.0 0.5 1.0 0.0 1.7 1.2 25.5 4.0 4.0 1.0 1.3 2.8 2.0 0.1 0.0 0.3 6.0 0.5 0.0 0.9 0.0 0.0 0.0 0.8 5.1 7.0 0.5 0.3 1.3 0.5 0.0 1.3 1.7 0.3 3.0 2.5 1.0 0.0 2.6 0.0 0.0 0.2 0.0 0.4 0.0 0.0 0.9 0.3 1.0 0.3 0.5 0.0 1.3 0.0 4.0 2.6 0.0 0.0 0.9 0.8 4.1 1.8 1.0 0.7 0.7 1.0 0.5 2.2 2.3 0.0 2.2 1.3 1.0 0.1 0.0 0.0 1.0 0.0 0.0 0.4 0.6 0.3 6.5 0.7 3.1 0.1 0.0 0.0 4.0 0.5 0.0 17.1 12.1 0.3 1.3 2.6 9.2 0.8 11.4 0.3 5.0 0.2 0.0 1.3 5.2 1.0 11.7 3.0 1.0 0.0 0.0 0.0 1.3 0.0 0.0 0.0 1.2 0.3 2.6 0.4 0.0 0.0 0.0 0.7 0.7 0.0 0.0 1.8 1.2 0.0 0.9 0.4 1.0 0.4 1.0 0.7 1.3 0.2 0.0 0.4 0.6 1.3 0.0 0.6 0.0 0.0 0.5 0.3 0.3 0.0 0.0 0.4 0.0 0.0 3.0 0.3 2.0 1.1 0.0 0.0 1.0 0.7 0.0 2.2 1.2 0.3 1.3 0.8 3.1 0.1 3.6 0.3 1.7 0.2 0.0 0.9 0.6 0.3 2.6 0.9 2.0 0.1 4.7 0.3 0.7 0.2 0.0 3.5 1.7 0.6 28.3 2.9 4.1 0.5 81.9 0.3 4.0 1.4 0.0 9.2 4.0 2.2 5.7 7.3 1.0 0.5 2.6 0.0 0.7 0.2 0.0 0.9 1.2 0.0 0.4 0.6 1.0 0.5 5.7 0.0 1.0 0.5 0.0 0.9 1.2 0.0 1.3 0.9 0.0 0.7 3.6 0.0 1.3 1.0 0.0 2.2 1.2 0.3 1.7 1.0 3.1 0.4 2.6 0.7 3.0 0.2 0.0 0.9 1.7 1.0 1.3 1.1 2.0 0.4 9.8 0.3 2.0 0.5 0.0 3.1 2.9 0.0 0.0 1.4 0.0 2.5 0.0 0.3 0.7 0.5 0.0 0.0 0.6 0.0 1.3 0.9 2.0 0.4 0.5 2.4 2.7 0.7 0.0 5.3 7.5 1.0 1.3 1.7 2.0 1.2 0.0 0.3 2.0 0.5 0.5 11.4 5.8 1.0 0.4 1.9 1.0 2.5 2.1 11.4 1.7 0.5 0.0 1.3 0.6 0.3 30.9 4.4 3.1 3.8 1.0 30.7 1.3 4.3 0.0 2.2 8.1 0.6 63.5 9.7 17.4 33.6 17.6 11.0 20.6 2.9 0.0 4.4 14.9 0.6 52.2 17.8 2.0 0.3 2.1 0.7 0.7 0.5 0.0 1.8 1.2 0.3 0.4 0.7 0.0 4.1 2.6 0.0 0.3 0.0 0.0 1.3 0.6 0.3 1.3 1.4 2.0 0.1 8.8 0.3 0.0 0.0 7.5 1.8 0.6 0.6 2.6 1.5 2.0 0.4 3.6 2.1 1.0 0.2 0.0 6.6 4.6 0.6 0.9 1.5 3.1 7.2 0.0 2.1 1.0 1.2 0.0 1.8 1.7 0.3 3.5 2.7 7.1 2.5 1.0 11.0 2.7 1.7 1.0 11.8 10.3 3.8 3.5 4.4 0.0 0.8 45.1 0.7 0.3 0.2 4.0 26.3 1.2 0.6 20.0 6.7 0.0 0.0 0.0 1.0 0.0 0.2 0.0 0.0 0.6 0.6 0.0 0.2 12.2 0.0 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.3 0.0 0.6 2.0 0.1 0.0 0.0 0.3 0.0 0.0 0.9 0.6 0.0 5.2 0.6 2.0 0.9 1.0 0.3 0.7 0.0 0.0 1.8 0.0 0.3 0.9 0.7 4.1 0.9 1.6 0.3 1.7 1.4 0.0 3.1 0.6 2.9 2.2 1.5 14.3 1.8 0.5 8.3 3.0 0.2 0.0 5.3 6.9 1.9 3.9 3.2 4.1 0.0 0.5 0.7 21.3 1.0 0.0 6.6 14.9 0.0 0.4 3.6 8.2 0.1 0.5 1.4 1.7 1.4 0.0 0.4 2.3 0.3 0.4 1.0 1.0 0.5 1.0 1.0 1.0 0.7 4.0 1.8 3.5 1.9 2.2 1.4 2.0 0.9 0.0 0.3 0.7 0.2 0.0 3.1 2.3 0.0 10.4 1.5 3.1 0.4 0.0 1.4 1.3 1.2 0.0 9.7 3.5 0.3 1.7 1.6 6.1 0.4 1.0 3.8 1.0 1.4 0.5 6.6 4.0 1.0 1.3 1.9 2.0 0.8 3.6 0.3 4.3 1.4 0.0 7.5 5.2 0.0 2.6 2.1 1.0 0.5 3.1 1.0 3.7 0.5 0.5 8.8 6.3 1.0 2.2 2.1 2.0 0.4 0.0 1.7 0.7 0.5 26.5 4.0 4.0 1.0 0.9 2.7 1.0 0.7 1.6 26.6 4.7 1.7 1.0 11.4 2.9 1.9 1.3 4.6 12.2 0.1 0.5 0.0 0.3 0.2 0.0 1.3 0.0 0.3 0.4 0.7 2.0 0.5 1.0 0.3 1.0 0.0 2.5 2.6 1.2 0.3 0.9 0.9 2.0 0.4 0.0 1.7 2.3 0.7 0.0 0.9 1.2 0.3 1.3 0.9 1.0 0.4 0.0 1.4 1.7 1.2 3.5 2.6 2.3 0.3 0.4 1.2 3.1 0.8 1.6 1.7 1.0 0.5 3.5 1.3 0.6 1.3 4.4 1.5 4.1 1.6 0.0 1.0 2.7 1.0 0.0 3.5 5.2 3.5 0.9 1.9 4.1 0.3 0.0 0.7 1.0 10.1 0.0 1.3 0.6 0.6 2.2 2.0 10.2 0.9 1.0 4.1 0.7 1.7 3.0 2.6 3.5 1.0 3.9 2.2 4.1 0.8 2.1 1.4 5.3 1.2 0.0 5.7 4.0 0.6 7.0 2.4 6.1 1.7 1.6 1.4 3.7 1.9 0.0 5.7 5.8 3.2 4.4 2.7 8.2 1.2 1.0 5.5 4.3 1.9 0.0 6.1 5.8 0.6 3.0 2.8 11.2 2.1 5.7 1.4 2.7 2.9 0.0 7.9 4.0 1.3 6.5 3.3 50.0 32.9 58.6 28.3 69.8 2.2 7.5 51.8 79.3 94.6 27.8 42.0 1.0 0.1 0.0 1.0 0.3 0.7 1.5 2.2 2.3 0.0 1.7 0.8 3.1 0.4 1.6 0.0 3.0 1.0 2.5 1.3 5.2 0.0 0.9 1.3 3.1 0.4 0.0 0.3 3.3 0.7 0.0 2.2 1.7 0.6 9.6 1.6 7.1 0.7 2.1 2.1 2.7 1.0 0.0 1.8 4.0 0.3 8.3 2.0 26.5 1.1 0.0 1.0 2.7 1.0 1.5 0.9 4.0 0.0 0.9 2.0 1.0 0.5 0.5 0.7 1.0 6.5 0.0 4.8 2.9 1.9 2.2 2.0 2.0 0.4 1.6 1.4 3.0 1.4 1.0 12.7 5.2 0.0 2.2 2.2 6.1 0.3 0.5 0.3 10.6 1.0 0.0 3.1 5.2 0.6 5.7 2.4 6.1 1.2 2.6 1.7 2.3 11.5 0.5 7.9 2.9 1.9 2.6 3.6 6.1 0.4 0.0 0.7 2.3 32.9 0.0 1.8 3.5 0.3 2.6 5.4 27.6 2.0 5.7 0.7 3.0 2.9 0.5 6.1 6.3 1.0 30.0 5.4 25.5 1.6 1.6 1.7 17.9 3.1 0.5 8.8 20.1 0.6 8.3 5.9 24.5 6.4 2.6 3.1 7.3 3.6 0.5 18.4 15.5 1.9 5.2 6.6 1.0 0.0 0.5 0.0 0.0 0.0 0.0 0.0 0.0 0.6 4.8 0.5 0.0 0.0 0.0 0.0 0.0 0.2 6.5 0.0 0.6 0.0 0.0 0.5 2.0 0.9 0.0 0.7 0.7 0.0 0.0 0.9 1.7 0.0 0.0 0.6 8.2 0.1 3.6 0.0 0.3 0.0 0.0 0.4 0.0 0.3 0.4 0.6 0.0 0.1 4.2 1.0 0.7 0.7 0.0 1.3 0.6 0.0 0.4 0.7 1.0 2.1 0.0 0.0 0.0 0.2 1.0 0.4 0.6 0.0 0.4 0.7 3.1 0.4 0.0 0.3 0.3 0.5 3.0 0.9 1.2 0.3 1.3 0.8 4.1 1.7 0.0 1.0 0.7 0.0 0.0 0.4 0.6 0.0 0.0 0.8 2.0 0.5 2.6 0.0 0.0 0.7 0.0 1.8 1.2 0.6 1.3 0.8 0.0 0.1 1.0 0.7 0.0 0.7 6.0 3.5 2.3 0.0 0.4 1.0 1.0 0.5 0.5 0.7 0.7 0.5 0.0 1.8 2.9 0.6 5.2 1.1 3.1 2.4 1.0 0.0 0.7 0.0 0.0 4.4 2.9 1.0 1.3 1.4 5.1 0.5 1.0 1.4 1.7 1.0 0.0 3.5 4.6 0.6 3.0 1.5 1.0 3.3 1.0 0.0 0.7 0.0 9.0 0.4 0.0 0.0 1.3 1.6 4.1 0.9 3.1 2.4 1.3 0.7 0.0 6.6 3.5 1.0 1.7 1.8 2.0 1.1 1.6 1.4 2.3 1.2 0.0 4.0 6.9 1.6 8.7 2.3 2.0 2.4 1.6 0.0 3.3 0.5 0.5 1.3 0.0 0.3 16.5 2.4 17.4 0.8 2.1 0.3 8.0 1.4 0.0 0.9 4.6 0.3 5.2 2.5 2.0 0.7 3.1 0.7 1.3 1.2 0.5 14.9 6.3 1.0 3.9 2.6 1.0 10.6 1.0 0.0 2.0 0.0 0.0 2.6 2.9 0.3 0.4 3.2 0.0 0.0 0.0 0.0 0.0 52.3 0.0 0.0 0.6 0.0 0.9 6.9 Nature. 2013 Oct 17;502(7471):333-9. Mutational landscape and significance across 12 major cancer types. Kandoth C et. al. • 120가지의 주요 암 유전자들이 12가지 주요 암종에서 유전 변이가 발견되는 빈도를 총 3,281 환자 샘플(TCGA) 에서 조사
NCCN Guidelines Index NSCLC Table of Contents Discussion Version 4.2014, 06/05/14 © National Comprehensive Cancer Network, Inc. 2014, All rights reserved. The NCCN Guidelines® and this illustration may not be reproduced in any form without the express written permission of NCCN® . UPDATES NCCN Guidelines Version 4.2014 Updates Non-Small Cell Lung Cancer Updates in the 1.2014 version of the Guidelines for Non-Small Cell Lung Cancer from the 2.2013 version include: NSCL-6 • • Surgery as initial treatment, margins positive: R1 resection separated out with the following recommendations: resection + chemotherapy or chemoradiation (sequential or concurrent). R2 resection separated out with the following recommendations: resection + chemotherapy or concurrent chemoradiation. NSCL-8 • T1-3, N0-1: unresectable changed to medically inoperable. • Surgery as initial treatment, margins positive: R1 resection separated out with the following recommendations: chemoradiation (sequential or concurrent). R2 resection separated out with the following recommendations: concurrent chemoradiation. • Footnote “s” is new to the page: Patients likely to receive adjuvant chemotherapy may be treated with induction chemotherapy as an alternative. NSCL-9 • Surgery as initial treatment, margins positive: R1 resection separated out with the following recommendations: chemoradiation (sequential or concurrent). R2 resection separated out with the following recommendations: concurrent chemoradiation. NSCL-10 • (eg, small subsolid nodules with slow growth). However, if the lesion(s) becomes symptomatic or becomes high risk for producing symptoms (eg, subsolid nodules with accelerating growth or increasing solid component or increasing FDG uptake, even while small), treatment should be considered. NSCL-13 • T1-2, N0-1; T3, N0: SABR of the lung lesion added as a treatment option after chemotherapy. NSCL-14 • H&P and chest CT recommendations in surveillance changed from a category 2B to a category 2A. NSCL-15 • Mediastinal lymph node recurrence: treatment recommendations listed according to prior treatment with RT. If patients received prior RT, the recommendation of systemic chemotherapy added. NSCL-16 • Establish histologic subtype with adequate tissue for molecular testing: “consider rebiopsy if appropriate” added. • “Integrate palliative care” added with footnote “b”. A link to the NCCN Guidelines for Palliative Care added. • Adenocarcinoma, large cell, NSCLC NOS; the following added: Category 1 added to ALK testing. EGFR ± ALK testing should be conducted as part of a multiplex/next-generation sequencing. • Consider EGFR mutation and ALK testing are not routinely recommended except especially in never smokers and or small biopsy specimens, or mixed histology. EGFR ± ALK testing should be conducted as part of a multiplex/next-generation sequencing. • Footnote “cc” added with direction to a new page, Targeted Agents for Patients with Other Genetic Alterations (NSCL-H). • EGFR mutation and ALK negative: “or unknown” added. Printed by yoon sup choi on 6/19/2014 8:23:15 PM. For personal use only. Not approved for distribution. Copyright © 2014 National Comprehensive Cancer Network, Inc., All Rights Reserved.
NCCN Guidelines Version 4.2014 Non-Small Cell Lung Cancer NCCN Guidelines Index NSCLC Table of Contents Discussion Version 4.2014, 06/05/14 © National Comprehensive Cancer Network, Inc. 2014, All rights reserved. The NCCN Guidelines® and this illustration may not be reproduced in any form without the express written permission of NCCN® . Note: All recommendations are category 2A unless otherwise indicated. Clinical Trials: NCCN believes that the best management of any cancer patient is in a clinical trial. Participation in clinical trials is especially encouraged. NSCL-16 aSee Principles of Pathologic Review (NSCL-A). bTemel JS, Greer JA, Muzikansky A, et al. Early palliative care for patients with metastatic non-small-cell lung cancer. N Engl J Med 2010;363:733-742. ccSee Targeted Agents for Patients with Other Genetic Alterations (NSCL-H). ddIn patients with squamous cell carcinoma, the observed incidence of EGFR mutations is 2.7% with a confidence that the true incidence of mutations is less than 3.6%. This frequency of EGFR mutations does not justify routine testing of all tumor specimens. Forbes SA, Bharma G, Bamford S, et al. The catalogue of somatic mutations in cancer (COSMIS). Curr Protoc Hum Genet 2008;chapter 10:unit 10.11. eePaik PK, Varghese AM, Sima CS, et al. Response to erlotinib in patients with EGFR mutant advanced non-small cell lung cancers with a squamous or squamous-like component. Mol Cancer Ther 2012;11:2535-2540. ffConsider ROS1 testing; if positive, may treat with crizotinib. Bergethon K, Shaw AT, Ou SH, et al. ROS1 rearrangements define a unique molecular class of lung cancers. J Clin Oncol 2012;30:863-870. SYSTEMIC THERAPY FOR METASTATIC DISEASE HISTOLOGIC SUBTYPE Metastatic Disease • Establish histologic subtypea with adequate tissue for molecular testing (consider rebiopsy if appropriate) • Smoking cessation counseling • Integrate palliative careb (See NCCN Guidelines for Palliative Care) • Adenocarcinoma • Large Cell • NSCLC not otherwise Squamous cell carcinoma • EGFR mutation testinga (category 1)a • ALK testing (category 1)a • EGFR ± ALK testing should be conducted as part of multiplex/next-generation sequencingcc • Consider EGFR mutation and ALK testingdd especially in never smokers or small biopsy specimens, or mixed histologyee • EGFR ± ALK testing should be conducted as part of multiplex/next- generation sequencingcc Sensitizing EGFR mutation positive ALK positive Sensitizing EGFR mutation and ALK negative or unknownff See First-Line Therapy (NSCL-17) See First-Line Therapy (NSCL-18) See First-Line Therapy (NSCL-19) See First-Line Therapy (NSCL-20) Printed by yoon sup choi on 6/19/2014 8:23:15 PM. For personal use only. Not approved for distribution. Copyright © 2014 National Comprehensive Cancer Network, Inc., All Rights Reserved.
Implementing Personalize Oncology the case of Foundation Medicine
Analyzed cancer genome in 2011 spending $100,000 at Broad Institute
• 암환자의 FFPE 시료를 이용, 315 개의 암 관련 ‘actionable gene’ 변이를 한 번에 분석 • 이를 기반으로, 환자의 유전자 변이를 표적으로 하는 치료제 정보를 의사에게 제공 • Broad Institute 에서 spin-off , GoogleVentures와 빌게이츠 투자 • 2012년에 서비스를 시작, 2013년 9월에 나스닥 IPO • 분석 가격: $5,800 • 2014년 3사 분기: 6,428 회 분석 (149% 성장), 2014년 22,000-25,000 회 분석 예상 http://www.foundationmedicine.com/
©2013NatureAmerica,Inc.Allrig sensitivity, specificity, accuracy and precision across the reportable range of the assay, in line with guidelines established by the Next Generation Sequencing: Standardization of Clinical Testing work- group25. Relevant sample types were represented, including FFPE. Base substitutions, indels, focal gene amplifications and homozygous gene deletions were tested. We report our experience with the first 2,221 patient tumor FFPE specimens submitted to our Clinical Laboratory Improvement Amendments (CLIA)-certified and College In contrast to diagnostic assays for a limited number of genomic sites, analytical validation of an NGS-based genomic profiling test assaying ~1.5 Mb of target sequence is a complex challenge. A single tumor spec- imen can harbor multiple types of genomic alterations, at any position in the tested region, at a wide range of mutant allele frequencies (MAF) or copy number levels. Reference specimens containing all possible somatic alterations in all cancer-related genes do not exist. We therefore developed a representative validation approach with reference samples a b c dFFPE tumor sample Sequencing library preparation Analysis pipeline Clinical report OR Genomic DNA Sequencing library Biotinylated DNA baits Hybridization capture DNA Extraction Sequencing Base substitutions Bayesian algorithm Short insertions/deletions Local assembly Copy number alterations Comparison with process- matched normal control Gene fusions Analysis of chimeric read pairs Analysis & interpretation Sample requirements Surface area: ≥25 mm2 Sample volume: ≥1 mm3 Nucleated cellularity: ≥80% or ≥30,000 cells Tumor content: ≥20% Fraction of patients with tissue insufficient for analysis: 10–15% Laboratory process highlights Requires ≥50 ng of dsDNA (quantified by PicoGreen) Fragmentation by sonication (Covaris) and ‘with-bead’ library construction Hybridization capture with biotinylated DNA oligonucleotides 49 × 49 paired-end sequencing on the Illumina HiSeq platform to >500× average unique coverage, with >100× at >99% of exons Analysis methods highlights Sensitivity to variants present at any mutant allele frequency Detection of long (1–40 bp) indel variants using de Bruijn graph–based local assembly CGH-like analysis of read- depth for CNAs assessment Reporting approach Interpretation without a matched normal Germline variants from 1000 Genomes Project (dbSNP135) removed Known driver alterations (COSMIC v62) highlighted as biologically significant A concise summary of the biomedical literature and current clinical trials is provided for each highlighted alteration Figure 1 NGS-based cancer genomic profiling test workflow. (a) DNA is extracted from routine FFPE biopsy or surgical specimens. (b) 50–200 ng of DNA undergoes whole-genome shotgun library construction and hybridization-based capture of 4,557 exons of 287 cancer-related genes and 47 introns of 19 genes frequently rearranged in solid tumors. Hybrid-capture libraries are sequenced to high depth using the Illumina HiSeq2000 platform. (c) Sequence data are processed using a customized analysis pipeline designed to accurately detect multiple classes of genomic alterations: base substitutions, short insertions/deletions, copy-number alterations and selected gene fusions. (d) Detected mutations are annotated according to clinical significance and reported. Nat Biotechnol. 2013 Nov;31(11):1023-31. NGS-based cancer genomic profiling test workflow
315 cancer related genes & introns from 28 genes often rearranged or altered in cancer Current as of August 4, 2014 th high accuracy. The test simultaneously sequences anged or altered in cancer to a typical median depth of ter than 500X. Each covered read represents a unique tions that occur at low frequencies due to tumor w tumor purity and small tissue samples. FoundationOne s of genomic alterations, including base substitutions, letions (indels), copy number alterations (CNAs) and using a small, routine FFPE sample (including core or rovided in an interpretive report, both in hard copy and 4 ation is found in any one of the genes on the current ort will identify the gene and alteration and will provide an on the front page of the report are found to have one or evant alterations. All other genes are not found to have vant alterations. In some cases, pertinent negatives the front of the report; these are genes that have no ancer, EGFR in lung cancer). The complete list of genes ppears in the “Current Gene List” table to the right, in the ation is detected in one of the genes included on in the report so that they may be acted upon in the clinical evidence emerge. of the estimated tumor DNA. One Includes Genes That Are Commonly n All Solid Tumors l classes of actionable alterations, including those in One report often reveals alterations that may lead to ent options for physicians and their patients to consider. *As measured from the date the Foundation Medicine laboratory receives a sample that meets requirements. Current Gene List4 clinical literature. CURRENT GENE LIST FANCC GATA3 MITF STAT4 GATA4 JAK3 PDGFRA RET STK11 CIC FANCE GATA6 JUN MPL RICTOR SUFU AKT1 FANCF GID4 (C17orf39) KAT6A (MYST3) MRE11A PDK1 RNF43 SYK CRKL FANCG GLI1 KDM5A ROS1 TAF1 AKT3 FANCL GNA11 KDM5C PIK3CA RPTOR ALK CSF1R FAS GNA13 KDM6A MTOR RUNX1 TERC AMER1 C11orf30 (EMSY) CTCF FAT1 GNAQ KDR PIK3CG RUNX1T1 TERT (promoter only) APC CARD11 CTNNA1 GNAS KEAP1 MYC PIK3R1 AR FGF10 KEL MYCL (MYCL1) ARAF CUL3 FGF14 KIT MYCN TNFAIP3 ARFRP1 CCND1 CYLD FGF19 GRM3 TNFRSF14 ARID1A DAXX (MLL) NF1 POLD1 TOP1 CCND3 FGF3 (MLL3) POLE CCNE1 DICER1 FGF4 TP53 ASXL1 DNMT3A FGF6 KRAS PRDM1 TSC1 ATM CD79A DOT1L FGFR1 LMO1 SMAD3 ATR EGFR PRKAR1A SMAD4 ATRX CDC73 EP300 FGFR3 LYN PRKCI SMARCA4 AURKA FGFR4 LZTR1 PRKDC VEGFA NPM1 SMO AXIN1 CDK4 FLCN IGF1R NRAS SNCAIP AXL CDK6 FLT1 NSD1 PTEN SOCS1 FLT3 NTRK1 PTPN11 SOX10 XPO1 CDKN1A FLT4 IKZF1 MAP3K1 QKI IL7R MCL1 NTRK3 RAC1 SOX9 ERG FOXP1 NUP93 RAD50 SPEN ZNF703 ERRFI1 MDM4 PAK3 RAD51 SPOP ESR1 RAF1 SPTA1 IRF4 SRC FAM46C GATA1 MEN1 PAX5 RARA FANCA JAK1 MET STAT3 SELECT REARRANGEMENTS ALK ETV4 FGFR1 KIT MYC RARA EGFR ETV5 PDGFRA RET ETV1 ETV6 FGFR3 NTRK1 RAF1 ROS1 1 and established the performance - ndationOne. This updated version of FoundationOne met these performance -
e anatomic Increasingly, c alterations, ns, cancer pes of us drivers equences an depth of s a unique mor undationOne stitutions, Technical Information Base Substitutions1 Indels1 Copy Number Alterations1 Rearrangements Sensitivity >99% MAF 5% >97% MAF 10% >95% CN 8 or 0 30% tumor nuclei 2 >99% for ALK fusion3 20% tumor nuclei >99% >99% >99% >99% (each covered read is of a unique DNA fragment to enable detection of alterations at low frequency) 5001 14 day average* *As measured from the date the Foundation Medicine laboratory receives a sample that meets requirements. Technical Information and Test Overview Current Gene List4 Technical Information of FoundationOne
Number of Samples 441 Number of failed samples 4% (16) Number of samples analyzed 96% (425) Number of samples  analyzed with at least one actionable alteration 77% (325) Number of samples analyzed with at least one actionable alteration not detectable by hotspot tests1 59% (251) Number of alterations per analyzed sample 2.74 (range 0-9) Number of actionable alterations per analyzed sample 1.40 (range 0-5) Actionability for Cancer Samples • At least one actionable alteration was found from 77% of samples. • On average,1.4 actionable alterations was found from one sample.
Lung Breast Colorectal Number of samples 82 70 44 Number of failed samples 5% (4) 4% (3) 0% (0) Number of samples analyzed 95% (78) 86% (67) 100% (44) Samples with at least one actionable alteration 86% (67) 85% (57) 86% (38) Alterations per sample 2.7 (range 0-6) 2.9 (range 0-7) 3.8 (range 1-7) Actionable alterations per sample 1.6 (range 0-5) 1.6 (range 0-4) 1.5 (range 0-3) Actionability for Lung, Colon, and Breast Cancers was High The three major tumor subtypes, lung, breast, and colorectal, accounted for 196 out of the 441 samples (44%). The percentage of samples with at least one actionable alteration was 86%, 85%, and 86% respectively.
Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 1 of 11 Date of Birth 09 August 1948 Client ASAN Medical Center Specimen Received 04 February 2013 Gender Male Ordering Physician Kim, Kyu-pyo Specimen Site Lymph Node FMI Case # TRF007878 Additional Recipient C. Anthony Blau Date of Collection 04 January 2013 Medical Record # Not Given FMI Client # 200535 Specimen Type Slide Specimen ID S-13-132 A Pathologist Sejin Jang ABOUT THE TEST: FoundationOne™ is a next-generation sequencing (NGS) based assay which identifies genomic alterations within hundreds of cancer-related genes. PATIENT RESULTS TUMOR TYPE: SOFT TISSUE SARCOMA (NOS) 7 genomic alterations Genomic Alterations Identified† NF2 W74* CCND2 amplification KRAS G13D, amplification TP53 R282W FGF23 amplification FGF6 amplification 3 therapies associated with potential clinical benefit 0 therapies associated with lack of response 6 clinical trials † For a complete list of the genes assayed, please refer to the Appendix THERAPEUTIC IMPLICATIONS Genomic Alterations Detected FDA Approved Therapies (in patient’s tumor type) FDA Approved Therapies (in another tumor type) Potential Clinical Trials NF2 W74* None Everolimus Lapatinib Temsirolimus Yes, see clinical trials section CCND2 amplification None None Yes, see clinical trials section KRAS G13D, amplification None None Yes, see clinical trials section TP53 R282W None None None FGF23 amplification None None None FGF6 amplification None None None Note: Genomic alterations detected may be associated with activity of certain FDA approved drugs; however, the agents listed in this report may have varied clinical evidence in the patient’s tumor type. Neither the therapeutic agents nor the trials identified are ranked in order of potential or predicted efficacy for this patient, nor are they ranked in order of level of evidence for this patient’s tumor type. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 2 of 11 GENOMIC ALTERATIONS GENE ALTERATION INTERPRETATION NF2 W74* Merlin, encoded by NF2, functions by coordinating signaling of receptor tyrosine kinases (RTKs) such as the epidermal growth factor receptor (Egfr) with cell contact (Curto and McClatchey, 2008; 17971776). The inactivation of Merlin in cancer disrupts this mechanism and leads to unrestrained RTK signaling despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. KRAS G13D, amplification The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; 22016105, Feldmann et al., 2007; 17520196, Han et al., 2011; 22011285). Activating mutations in RAS genes can cause uncontrolled cell proliferation and tumor formation (Pylayeva-Gupta et al., 2011; 21993244, Kahn et al., 1987; 3310850). The G13D mutation lies within the first "G box" domain of the KRAS protein, one of several conserved regions (Colicelli, 2004; 15367757). Disruption of this region creates a protein that is defective for GTP hydrolysis and therefore constitutively active. KRAS alterations have been reported variously from 0-44% in soft tissue sarcoma (COSMIC, The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013), perhaps dependent on country of origin (Yoo et al., 1999; 10463479, Yoo and Robinson, 1999; 10391564, Barretina et al., 2010; 20601955, Jin et al., 2010; 20150643). KRAS amplification has been reported in 4/207 (2%) soft tissue sarcomas in the Sarcoma Genome Project dataset (The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013). Constitutive activation of KRAS leads to activation of the RAF/MEK/ERK pathway, leading to tumorigenesis (Pylayeva-Gupta et al., 2011; 21993244). Therefore, tumors with activating mutations in KRAS may be sensitive to inhibitors of this pathway. Both the KRAS-targeting reovirus Reolysin and specific MEK inhibitors are under investigation for tumors bearing KRAS mutations. Activating mutations in KRAS have been associated with resistance to Egfr inhibitors in colorectal carcinoma; however, this relationship has not been a significant subject of study in soft tissue sarcoma (Lièvre et al., 2006; 16618717, De Roock et al., 2011; 21163703). Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 4 of 11 THERAPIES There are no therapies FDA approved in this patient's tumor type that are specific to the reported genomic alterations. ADDITIONAL THERAPIES – FDA APPROVED IN OTHER TUMOR TYPES THERAPY RATIONALE Everolimus Everolimus is an orally available mTOR inhibitor that has been approved for use in renal cell carcinoma, pancreatic neuroendocrine tumors, subependymal giant cell astrocytoma associated with TSC, and hormone receptor positive, HER2 negative advanced breast cancer. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to everolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Everolimus is currently being tested in clinical trials in several tumor types. A Phase 1 trial of everolimus and figitumumab, an IGF-1R inhibitor, in sarcomas and other solid tumors showed that the combination was safe and well- tolerated, with a partial response in 1/18 patients and stable disease in 15/18 patients (Quek et al., 2011; 21177764). Lapatinib Lapatinib is a dual tyrosine kinase inhibitor, targeting both Egfr and Her2 (Erbb2). It has been approved for use in metastatic breast cancer. Mutation of NF2 may lead to Egfr and/or Erbb2 activation; lapatinib inhibits Egfr and Erbb2 and has shown preclinical activity in NF2 deficient vestibular schwannoma (Ammoun et al., 2010; 20511180). Lapatinib is currently in clinical trials in multiple solid tumor types. Temsirolimus Temsirolimus is an intravenous mTOR inhibitor that has been approved for use in advanced renal cell carcinoma. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to temsirolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Temsirolimus is currently being tested in clinical trials in several tumor types. A Phase 2 trial of temsirolimus as single agent in soft tissue sarcoma reported limited efficacy and moderate toxicity, with a partial response exhibited in 2 of 40 evaluable patients (Okuno et al., 2011; 21287536). A Phase 1 trial of temsirolimus combined with liposomal doxorubicin in recurrent and refractory bone and soft tissue sarcoma patients reported that the combination treatment is safe and demonstrates sufficient preliminary efficacy to pursue the Phase 2 portion of the study (Thornton et al., 2013; 23382028). Genomic alterations detected may be associated with activity of certain FDA approved drugs, however the agents listed in this report may have little or no evidence in the patient’s tumor type Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 5 of 11 CLINICAL TRIALS TO CONSIDER IMPORTANT: While every effort is made to ensure the accuracy of the information contained below, the information available in the public domain is continuously updated and should be investigated by the physician or research staff. This is not meant to be a complete list of available trials. In order to conduct a more thorough search, please go to www.clinicaltrials.gov and use the search terms provided below. For more information about a specific clinical trial, type the NCT ID of the trial indicated below into the search bar. GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS NF2 W74* Mutation or loss of NF2 results in the dysregulation of RTK and mTOR signaling. Therefore, RTK or mTOR inhibitors may be relevant for patients with NF2 mutations. A search of the trial website clinicaltrials.gov, using terms such as “NF2”, "lapatinib", "mTOR" and/or "solid tumor" retrieves more than 10 trials that may be relevant for this patient's tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID An Open-label, Multi-center Phase I Dose- finding Study of RAD001 (Everolimus, Afinitor®) in Combination With BEZ235 in Patients With Advanced Solid Tumors Phase 1 MTOR, PI3K Missouri, Auckland (New Zealand), Barcelona (Spain), Bordeaux Cedex (France), Montpellier Cedex 5 (France), Newcastle Upon Tyne (United Kingdom), Seoul (Korea, Republic of), Verona (Italy), Wilrijk (Belgium) NCT01482156 A Phase I Study of the HER1, HER2 Dual Kinase Inhibitor, Lapatinib Plus the Proteosomal Inhibitor Bortezomib in Patients With Advanced Malignancies Phase 1 EGFR, Her2/neu, proteasome District of Columbia NCT01497626
Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 1 of 11 Date of Birth 09 August 1948 Client ASAN Medical Center Specimen Received 04 February 2013 Gender Male Ordering Physician Kim, Kyu-pyo Specimen Site Lymph Node FMI Case # TRF007878 Additional Recipient C. Anthony Blau Date of Collection 04 January 2013 Medical Record # Not Given FMI Client # 200535 Specimen Type Slide Specimen ID S-13-132 A Pathologist Sejin Jang ABOUT THE TEST: FoundationOne™ is a next-generation sequencing (NGS) based assay which identifies genomic alterations within hundreds of cancer-related genes. PATIENT RESULTS TUMOR TYPE: SOFT TISSUE SARCOMA (NOS) 7 genomic alterations Genomic Alterations Identified† NF2 W74* CCND2 amplification KRAS G13D, amplification TP53 R282W FGF23 amplification FGF6 amplification 3 therapies associated with potential clinical benefit 0 therapies associated with lack of response 6 clinical trials † For a complete list of the genes assayed, please refer to the Appendix THERAPEUTIC IMPLICATIONS Genomic Alterations Detected FDA Approved Therapies (in patient’s tumor type) FDA Approved Therapies (in another tumor type) Potential Clinical Trials NF2 W74* None Everolimus Lapatinib Temsirolimus Yes, see clinical trials section CCND2 amplification None None Yes, see clinical trials section KRAS G13D, amplification None None Yes, see clinical trials section TP53 R282W None None None FGF23 amplification None None None FGF6 amplification None None None Note: Genomic alterations detected may be associated with activity of certain FDA approved drugs; however, the agents listed in this report may have varied clinical evidence in the patient’s tumor type. Neither the therapeutic agents nor the trials identified are ranked in order of potential or predicted efficacy for this patient, nor are they ranked in order of level of evidence for this patient’s tumor type.
Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 2 of 11 GENOMIC ALTERATIONS GENE ALTERATION INTERPRETATION NF2 W74* Merlin, encoded by NF2, functions by coordinating signaling of receptor tyrosine kinases (RTKs) such as the epidermal growth factor receptor (Egfr) with cell contact (Curto and McClatchey, 2008; 17971776). The inactivation of Merlin in cancer disrupts this mechanism and leads to unrestrained RTK signaling despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. KRAS G13D, amplification The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; 22016105, Feldmann et al., 2007; 17520196, Han et al., 2011; 22011285). Activating mutations in RAS genes can cause uncontrolled cell proliferation and tumor formation (Pylayeva-Gupta et al., 2011; 21993244, Kahn et al., 1987; 3310850). The G13D mutation lies within the first "G box" domain of the KRAS protein, one of several conserved regions (Colicelli, 2004; 15367757). Disruption of this region creates a protein that is defective for GTP hydrolysis and therefore constitutively active. KRAS alterations have been reported variously from 0-44% in soft tissue sarcoma (COSMIC, The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013), perhaps dependent on country of origin (Yoo et al., 1999; 10463479, Yoo and Robinson, 1999; 10391564, Barretina et al., 2010; 20601955, Jin et al., 2010; 20150643). KRAS amplification has been reported in 4/207 (2%) soft tissue sarcomas in the Sarcoma Genome Project dataset (The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013). Constitutive activation of KRAS leads to activation of the RAF/MEK/ERK pathway, leading to tumorigenesis (Pylayeva-Gupta et al., 2011; 21993244). Therefore, tumors with activating mutations in KRAS may be sensitive to inhibitors of this pathway. Both the KRAS-targeting reovirus Reolysin and specific MEK inhibitors are under investigation for tumors bearing KRAS mutations. Activating mutations in KRAS have been associated with resistance to Egfr inhibitors in colorectal carcinoma; however, this relationship has not been a significant subject of study in soft tissue sarcoma (Lièvre et al., 2006; 16618717, De Roock et al., 2011; 21163703).
Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) GENOMIC ALTERATIONS GENE ALTERATION INTERPRETATION NF2 W74* Merlin, encoded by NF2, functions by coordinating signaling of receptor tyrosine kinases (RTKs) such as the epidermal growth factor receptor (Egfr) with cell contact (Curto and McClatchey, 2008; 17971776). The inactivation of Merlin in cancer disrupts this mechanism and leads to unrestrained RTK signaling despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; • 유전자(단백질)의 기능 및 암 발병에서 메커니즘 소개 • NF2 유전자에서 나오는 Merlin은 EGFR과 같은 RTKs를 조절하는 기능을 가짐 • Merlin의 비활성화는 이런 메커니즘을 망가뜨려, RTKs 신호를 조절하지 못하게 됨 • 유전 변이가 단백질/메커니즘에 어떠한 영향을 미치는지 설명 • NF2 의 W74*는 Merlin의 premature termination을 통해 단백질의 비활성화를 야기함 • 유전 변이가 해당 암종에 대해 DB/논문에 어떻게 보고 되어 있는지 설명 • cBio Cancer Genomics Portal: 207개의 sarcoma 샘플에는 NF2 loss 데이터는 없음 • Quezado et al.: Epithelial sarcoma 에서 NF2가 위치한 염색체의 loss of heterozygosity 가 보고된 바 있음 • COSMIC: NF2의 변이(W74* ?)가 41%의 soft tissue tumor 에서 보고된 바 있으며, 샘플의 대부분은 schwannoma • 유전 변이에 효과가 있는 약물 (승인/임상)에 대한 간략한 소개 • NF2 loss 변이를 직접 표적으로 하는 승인 받은 약은 없음 • 전임상 결과에 따르면 TKI lapatinib과 mTOR 저해제가 효과 있을 수도 있음 • Lapatinib과 mTOR 저해제는 다른 암종에 대해서 승인 받았으며, solid tumor에 대하여 임상 중임 • Lapatinib은 NF2 변이 vestibular schwannoma 환자에 대한 임상에서 효능을 보임
NF2 W74* despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. KRAS G13D, amplification The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; 22016105, Feldmann et al., 2007; 17520196, Han et al., 2011; 22011285). Activating mutations in RAS genes can cause uncontrolled cell proliferation and tumor formation (Pylayeva-Gupta et al., 2011; 21993244, Kahn et al., 1987; 3310850). The G13D mutation lies within the first "G box" domain of the KRAS protein, one of several conserved regions (Colicelli, 2004; 15367757). Disruption of this region creates a protein that is defective for GTP hydrolysis and therefore constitutively active. KRAS alterations have been reported variously from 0-44% in soft tissue sarcoma (COSMIC, The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013), perhaps dependent on country of origin (Yoo et al., 1999; 10463479, Yoo and Robinson, 1999; 10391564, Barretina et al., 2010; 20601955, Jin et al., 2010; 20150643). KRAS amplification has been reported in 4/207 (2%) soft tissue sarcomas in the Sarcoma Genome Project dataset (The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013). Constitutive activation of KRAS leads to activation of the RAF/MEK/ERK pathway, leading to tumorigenesis (Pylayeva-Gupta et al., 2011; 21993244). Therefore, tumors with activating mutations in KRAS may be sensitive to inhibitors of this pathway. Both the KRAS-targeting reovirus Reolysin and specific MEK inhibitors are under investigation for tumors bearing KRAS mutations. Activating mutations in KRAS have been associated with resistance to Egfr inhibitors in colorectal carcinoma; however, this relationship has not been a significant subject of study in soft tissue sarcoma (Lièvre et al., 2006; • 유전자(단백질)의 기능 및 암 발병에서 메커니즘 소개 • CCND2는 cell cycle 조절 단백질인 cyclin-dependent kinase을 조절하는 cyclin D2를 발현 • PI-3-kinase의 cancer signaling pathway 의 downstream target 임 (레퍼런스) • 유전 변이가 해당 암종에 대해 DB/논문에 어떻게 보고 되어 있는지 설명 • cBio Cancer Genomics Portal: sarcomas의 2.4%에서 CCND2 amplification이 보고 됨 • 논문 • CCND2 변이가 sarcomas와 관련하여 논문에서 보고된 바 없음 • Cyclin D2의 과발현은 몇가지 종류의 sarcomas에 대하여 보고된 바 있음 (레퍼런스) • 유전 변이가 단백질/메커니즘에 어떠한 영향을 미치는지 설명 • Cyclin D2의 발현저하는 NSCLC stage III에서 생존률을 떨어뜨림 (레퍼런스) • CCND2의 발현은 13 metastatic & 18 non-metastatic neuroendocrine tumors의 전이성 저하에 • 유전 변이에 효과가 있는 약물 (승인/임상)에 대한 간략한 소개 • CCND2 amplification을 타겟으로 하는 승인 받은 약물은 없음 • 몇몇 preclinical study가 cyclin D2가 CDK4와 관련이 있고, CDK4/6 저해제에 효과가 있을 수도 있음 • CDK4/6 저해제는 몇몇 암종에 대하여 임상 시험이 진행 중임
• 유전자(단백질)의 기능 및 암 발병에서 메커니즘 소개 • ARID1A는 SWI/SNF chromatin remodeling complex의 단백질을 encoding 함 • ARID1A 는 tumor suppressor 로 생각되며, 이 유전자의 deletion이나 비활성화는 종양 형성을 유발 • 유전 변이가 단백질/메커니즘에 어떠한 영향을 미치는지 설명 • ARID1A Q633* 는 단백질의 premature truncation을 유도하며, PPI에 중요한 LXXLL motifs의 loss유도 • 따라서, 이 유전변이는 단백질의 비활성화를 유도할 것으로 예측됨 (레퍼런스) • 유전 변이가 해당 암종에 대해 DB/논문에 어떻게 보고 되어 있는지 설명 • COSMIC:ARID1A 변이가 6%의 폐암에서 보고 됨 (6% lung adenocarcinoma, 7% lung squamous cell carcinoma) • 유전 변이에 효과가 있는 약물 (승인/임상)에 대한 간략한 소개 • Preclinical Data에 의하면 ARID1A는 tumor suppressor 의 기능을 한다는 것을 뒷받침 • 몇몇 암종에서는 ARID1A의 발현 감소가 세포독성치료의 저항성과 관련이 있음 (레퍼런스) • 현재,ARID1A의 loss를 표적으로 하는 표적치료제는 없음
Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 4 of 11 THERAPIES There are no therapies FDA approved in this patient's tumor type that are specific to the reported genomic alterations. ADDITIONAL THERAPIES – FDA APPROVED IN OTHER TUMOR TYPES THERAPY RATIONALE Everolimus Everolimus is an orally available mTOR inhibitor that has been approved for use in renal cell carcinoma, pancreatic neuroendocrine tumors, subependymal giant cell astrocytoma associated with TSC, and hormone receptor positive, HER2 negative advanced breast cancer. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to everolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Everolimus is currently being tested in clinical trials in several tumor types. A Phase 1 trial of everolimus and figitumumab, an IGF-1R inhibitor, in sarcomas and other solid tumors showed that the combination was safe and well- tolerated, with a partial response in 1/18 patients and stable disease in 15/18 patients (Quek et al., 2011; 21177764). Lapatinib Lapatinib is a dual tyrosine kinase inhibitor, targeting both Egfr and Her2 (Erbb2). It has been approved for use in metastatic breast cancer. Mutation of NF2 may lead to Egfr and/or Erbb2 activation; lapatinib inhibits Egfr and Erbb2 and has shown preclinical activity in NF2 deficient vestibular schwannoma (Ammoun et al., 2010; 20511180). Lapatinib is currently in clinical trials in multiple solid tumor types. Temsirolimus Temsirolimus is an intravenous mTOR inhibitor that has been approved for use in advanced renal cell carcinoma. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to temsirolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Temsirolimus is currently being tested in clinical trials in several tumor types. A Phase 2 trial of temsirolimus as single agent in soft tissue sarcoma reported limited efficacy and moderate toxicity, with a partial response exhibited in 2 of 40 evaluable patients (Okuno et al., 2011; 21287536). A Phase 1 trial of temsirolimus combined with liposomal doxorubicin in recurrent and refractory bone and soft tissue sarcoma patients reported that the combination treatment is safe and demonstrates sufficient preliminary efficacy to pursue the Phase 2 portion of the study (Thornton et al., 2013; 23382028). Genomic alterations detected may be associated with activity of certain FDA approved drugs, however the agents listed in this report may have little or no evidence in the patient’s tumor type
• 약의 유형 및 표적 소개 • Erlotinib 은 저분자 화합물 (small molecule) 약으로 • EGFR의 타이로신 활성효소 억제제 (tyrosine kinase inhibitor)임 • 약의 FDA 승인 적응증 • NSCLC (비세포성 폐암) 및 췌장암에 승인 되었음 • 해당 유전 변이에 대한 약의 효과 설명 • EGFR 활성화 유전변이가 있는 환자들에게서, erlotinib 의 투여는 암의 진행 속도를 늦추는 효과를 나타냄 (ref) • (폐암에 대한) 약의 임상 시험 과정 및 결과 • NSCLC에 대한 erlotinib의 승인은 무작위 임상 3상에서 표준항암치료에 비해 생존기간(OS)의 연장에 근거하였음 (ref) • 몇번의 무작위 임상 3상에서 EGFR 양성 환자들에 대하여, 무진행 생존률(PFS)이 표준치료에 비해 유의미하게 연장됨 (ref) • 해당 유전 변이의 약에 대한 저항성 설명 • 다른 EGFR 활성화 변이와는 달리, 어떤 exon 20 변이는 (전)임상 시험에서 EGFR 타이로신 활성효소 억제제에 대한 저항성을 보였다. • Exon 20 insertion 변이의 경우 어떤 환자들에게서는 EGFR 저해제를 투여했을 경우 질병이 더 진행되지 않았다.
• (폐암에 대한) 약의 임상 시험 과정 및 결과 • 처음 임상시험에서는 무작위 NSCLC 환자에 대하여 위약 대비 생존율에 대한 유의미한 효과를 보이지 못하여, 임상 실패 • 하지만, 추우에 EGFR 변이 환자들에게 항암요법과 병용투여하였을 경우 생존율에 유의미한 차이를 보인 결과 (승인 받음)
Patient Name Lee, Cheol Report Date 26 February 2013 Soft tissue sarcoma (NOS) THERAPIES There are no therapies FDA approved in this patient's tumor type that are specific to the reported genomic alterations. ADDITIONAL THERAPIES – FDA APPROVED IN OTHER TUMOR TYPES THERAPY RATIONALE Everolimus Everolimus is an orally available mTOR inhibitor that has been approved for use in renal cell carcinoma, pancreatic neuroendocrine tumors, subependymal giant cell astrocytoma associated with TSC, and hormone receptor positive, HER2 negative advanced breast cancer. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to everolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Everolimus is currently being tested in clinical trials in several tumor types. A Phase 1 trial of everolimus and figitumumab, an IGF-1R inhibitor, in sarcomas and other solid tumors showed that the combination was safe and well- tolerated, with a partial response in 1/18 patients and stable disease in 15/18 patients (Quek et al., 2011; 21177764). Lapatinib Lapatinib is a dual tyrosine kinase inhibitor, targeting both Egfr and Her2 (Erbb2). It has been approved for use in metastatic breast cancer. Mutation of NF2 may lead to Egfr and/or Erbb2 activation; lapatinib inhibits Egfr and Erbb2 and has shown preclinical activity in NF2 deficient vestibular schwannoma (Ammoun et al., 2010; 20511180). Lapatinib is currently in clinical trials in multiple solid tumor types. Temsirolimus Temsirolimus is an intravenous mTOR inhibitor that has been approved for use in advanced renal cell carcinoma. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to temsirolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Temsirolimus is currently being tested in clinical trials in several tumor types. A Phase 2 trial of temsirolimus as single agent in soft tissue sarcoma reported limited efficacy and moderate toxicity, with a partial response exhibited in 2 of 40 evaluable patients (Okuno et al., 2011; 21287536). A Phase 1 trial of temsirolimus combined with liposomal doxorubicin in recurrent and refractory bone and soft tissue sarcoma patients reported that the combination treatment is safe and demonstrates sufficient preliminary efficacy to pursue the Phase 2 portion of the study (Thornton et al., 2013; 23382028). Genomic alterations detected may be associated with activity of certain FDA approved drugs, however the agents listed in this report may have little or no evidence in the patient’s tumor type • 약의 유형 및 표적 소개 • Everolimus는 경구 투여 가능한 mTOR 저해제이다. • 약의 FDA 승인 적응증 • 신장암, 췌장암, HER2 음성 유방암 등에 승인 받음 • 해당 유전 변이에 대한 약의 효과 설명 • 전임상시험 데이터는 NF2 loss 변이는 everolimus와 유사한 메커니즘을 가진 rapamycin에 반응한다는 결과를 보여준다 • (폐암에 대한) 약의 임상 시험 과정 및 결과 • Everolimus는 현재 여러 암종에 대해서 임상 시험 중에 있다. • Everolimus 와 IGF-1 수용체 저해제인 figitumumab를 병용투여했을 경우 총 18명의 환자 중, • 1명은 부분적으로 암이 줄어들었고, 5명은 안정하게 유지되었다. (ref)
Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 5 of 11 CLINICAL TRIALS TO CONSIDER IMPORTANT: While every effort is made to ensure the accuracy of the information contained below, the information available in the public domain is continuously updated and should be investigated by the physician or research staff. This is not meant to be a complete list of available trials. In order to conduct a more thorough search, please go to www.clinicaltrials.gov and use the search terms provided below. For more information about a specific clinical trial, type the NCT ID of the trial indicated below into the search bar. GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS NF2 W74* Mutation or loss of NF2 results in the dysregulation of RTK and mTOR signaling. Therefore, RTK or mTOR inhibitors may be relevant for patients with NF2 mutations. A search of the trial website clinicaltrials.gov, using terms such as “NF2”, "lapatinib", "mTOR" and/or "solid tumor" retrieves more than 10 trials that may be relevant for this patient's tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID An Open-label, Multi-center Phase I Dose- finding Study of RAD001 (Everolimus, Afinitor®) in Combination With BEZ235 in Patients With Advanced Solid Tumors Phase 1 MTOR, PI3K Missouri, Auckland (New Zealand), Barcelona (Spain), Bordeaux Cedex (France), Montpellier Cedex 5 (France), Newcastle Upon Tyne (United Kingdom), Seoul (Korea, Republic of), Verona (Italy), Wilrijk (Belgium) NCT01482156 A Phase I Study of the HER1, HER2 Dual Kinase Inhibitor, Lapatinib Plus the Proteosomal Inhibitor Bortezomib in Patients With Advanced Malignancies Phase 1 EGFR, Her2/neu, proteasome District of Columbia NCT01497626
CLINICAL TRIALS TO CONSIDER IMPORTANT: While every effort is made to ensure the accuracy of the information contained below, the information available in the public domain is continuously updated and should be investigated by the physician or research staff. This is not meant to be a complete list of available trials. In order to conduct a more thorough search, please go to www.clinicaltrials.gov and use the search terms provided below. For more information about a specific clinical trial, type the NCT ID of the trial indicated below into the search bar. GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS NF2 W74* Mutation or loss of NF2 results in the dysregulation of RTK and mTOR signaling. Therefore, RTK or mTOR inhibitors may be relevant for patients with NF2 mutations. A search of the trial website clinicaltrials.gov, using terms such as “NF2”, "lapatinib", "mTOR" and/or "solid tumor" retrieves more than 10 trials that may be relevant for this patient's tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID An Open-label, Multi-center Phase I Dose- finding Study of RAD001 (Everolimus, Afinitor®) in Combination With BEZ235 in Patients With Advanced Solid Tumors Phase 1 MTOR, PI3K Missouri, Auckland (New Zealand), Barcelona (Spain), Bordeaux Cedex (France), Montpellier Cedex 5 (France), Newcastle Upon Tyne (United Kingdom), Seoul (Korea, Republic of), Verona (Italy), Wilrijk (Belgium) NCT01482156 A Phase I Study of the HER1, HER2 Dual Kinase Inhibitor, Lapatinib Plus the Proteosomal Inhibitor Bortezomib in Patients With Advanced Malignancies Phase 1 EGFR, Her2/neu, proteasome District of Columbia NCT01497626 • 이 임상시험들이 권장되는 이유 • NF2 유전자 변이나 loss는 RTK 와 mTOR 신호전달을 활성화시킨다. • 그러므로 RTK, 혹은 mTOR 저해제가 NF2 변이 환자들에게 적용될 수 있다. • Clinicaltrial.gov 는 NF2, lapatinib, mTOR와 solid tumor 등의 키워드에 대하여 10개가 넘는 임상시험을 보여준다.
Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) CLINICAL TRIALS TO CONSIDER (CONT.) GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS KRAS G13D, amplification Activating mutations in KRAS may result in activation of downstream pathways, including the MAPK pathway. Therefore, inhibitors of MAPK pathway components, including the protein MEK, may be of use in a tumor with a KRAS activating mutation. Additionally, the engineered reovirus Reolysin is under investigation in clinical trials for its ability to specifically target cells bearing activated KRAS. A search of the trial website clinicaltrials.gov, using terms such as "KRAS", "MEK", "sarcoma", and/or "solid tumor", retrieves more than 10 trials that may be relevant for this patient’s tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID A Phase Ib, Open-Label, Dose-Escalation Study Evaluating the Safety, Tolerability and Pharmacokinetics of GDC-0973 in Combination With GDC-0941 When Administered in Patients With Locally Advanced or Metastatic Solid Tumors Phase 1 MEK, PI3K Massachusetts, Michigan, Tennessee NCT00996892 A Phase Ib, Open-label, Multi-center, Dose- escalation and Expansion Study of an Orally Administered Combination of BEZ235 Plus MEK162 in Adult Patients With Selected Advanced Solid Tumors Phase 1 MEK, MTOR, PI3K Massachusetts, Texas, Wisconsin, Ontario (Canada), Barcelona (Spain), Cologne (Germany), Essen (Germany), Victoria (Australia), Villejuif (France) NCT01337765 • 이 임상시험들이 권장되는 이유 • KRAS의 활성화 변이는 MAPK pathway 등의 downstream pathway를 활성화시킨다. • 그러므로 MEK를 포함한 MAPK pathway 의 구성요소들을 저해하는 약은 KRAS 활성화 변이에 대해 사용될 수 있다. • 또한, 임상시험 중인 reovirus Reolysin 은 활성화된 KRAS 를 가지고 있는 세포만을 저해하는 기능으로 연구되고 있다. • Clinialtrial.gov 에는 KRAS, MEK, sarcoma, solid tumor 등으로 10개가 넘는 임상시험을 찾을 수 있다.
http://www.youtube.com/watch?v=CaQnknjrAEs Interactive Cancer Explorer
Wed Nov 5, 2014 “Google will soon start covering the cost of Foundation Medicine's DNA tests for employees and their family-members suffering from cancer, as part of its health benefits portfolio.”
Oct 16, 2014 “Priority Health has begun coverage of Foundation Medicine's genomic profiling services for cancer, making the health plan the first in the country to provide such coverage”
Promising Cases of Personalized Cancer Medicine
vs. Steve Jobs Apple CEO Pancreatic Cancer Dead Dr. Lukas Wartman Geneticist,Washington Univ. Acute Lymphoblastic Leukemia Survived Found Nothing Actionable from Genome Found Something Actionable from Genome
• He developed Acute Lymphoblastic Leukemia, which he studied himself. • Recurred, 5 years after the bone-marrow transplant • Whole genome sequencing +Transcriptome analysis • Overexpression of FLT3 was found (FLT3: cell growth, proliferation) • Sutent (sunitinib), which was approved for Kidney cancer, inhibits FLT3 • ALL was successfully treated by Sutent, the Kidney cancer drug. Dr. Lukas Wartman http://www.nytimes.com/2012/07/08/health/in-gene-sequencing-treatment-for-leukemia-glimpses-of-the-future.html?pagewanted=all&_r=0
‹› • June, 2010: 53 y.o. female diagnosed with metastatic inflammatory breast cancer (IBC) involving liver and bone • Initial therapies: docetaxel, carboplatin and trastuzumab – achieved some improvement • Disease progression within 12 months • April - November, 2011: Numerous additional drug regimens attempted • November, 2011: Rapid progression of disease 24 Case Presentation 2: FMI vs ‘Limited’  Testing Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
‹› FoundationOne® Report – Profiling the Genome 25 Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
‹›“Common”  Mutation  Identified • EGFR Exon 21 L858R point mutation identified – Associated with unprecedented sensitivity to EGFR-TKIs such as gefitinib (Iressa) and erlotinib (Tarceva) • Present in 10% of lung adenocarcinomas • NOT reported with reproducible frequency in other tumor  types  →  NO clinical testing done • Broad based, highly sensitive NGS test (FoundationOne) identifies a transforming lesion in this advanced IBC 26 Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
Cell cycle enome integrity RTK signalling RB1 CDKN2A FGFR3 KIT FGFR2 EPHB6 PDGFRA ERBB4 EPHA3 FLT3 EGFR ERCC2 RAD21 CHEK2 SMC3 SMC1A BRCA1 BAP1 STAG2 ATR BRCA2 ATRX ATM TP53 14.3 1.8 0.5 8.3 3.0 0.2 0.0 5.3 6.9 1.9 3.9 3.2 4.1 0.0 0.5 0.7 21.3 1.0 0.0 6.6 14.9 0.0 0.4 3.6 8.2 0.1 0.5 1.4 1.7 1.4 0.0 0.4 2.3 0.3 0.4 1.0 1.0 0.5 1.0 1.0 1.0 0.7 4.0 1.8 3.5 1.9 2.2 1.4 2.0 0.9 0.0 0.3 0.7 0.2 0.0 3.1 2.3 0.0 10.4 1.5 3.1 0.4 0.0 1.4 1.3 1.2 0.0 9.7 3.5 0.3 1.7 1.6 6.1 0.4 1.0 3.8 1.0 1.4 0.5 6.6 4.0 1.0 1.3 1.9 2.0 0.8 3.6 0.3 4.3 1.4 0.0 7.5 5.2 0.0 2.6 2.1 1.0 0.5 3.1 1.0 3.7 0.5 0.5 8.8 6.3 1.0 2.2 2.1 2.0 0.4 0.0 1.7 0.7 0.5 26.5 4.0 4.0 1.0 0.9 2.7 1.0 0.7 1.6 26.6 4.7 1.7 1.0 11.4 2.9 1.9 1.3 4.6 12.2 0.1 0.5 0.0 0.3 0.2 0.0 1.3 0.0 0.3 0.4 0.7 2.0 0.5 1.0 0.3 1.0 0.0 2.5 2.6 1.2 0.3 0.9 0.9 2.0 0.4 0.0 1.7 2.3 0.7 0.0 0.9 1.2 0.3 1.3 0.9 1.0 0.4 0.0 1.4 1.7 1.2 3.5 2.6 2.3 0.3 0.4 1.2 3.1 0.8 1.6 1.7 1.0 0.5 3.5 1.3 0.6 1.3 4.4 1.5 4.1 1.6 0.0 1.0 2.7 1.0 0.0 3.5 5.2 3.5 0.9 1.9 4.1 0.3 0.0 0.7 1.0 10.1 0.0 1.3 0.6 0.6 2.2 2.0 10.2 0.9 1.0 4.1 0.7 1.7 3.0 2.6 3.5 1.0 3.9 2.2 4.1 0.8 2.1 1.4 5.3 1.2 0.0 5.7 4.0 0.6 7.0 2.4 6.1 1.7 1.6 1.4 3.7 1.9 0.0 5.7 5.8 3.2 4.4 2.7 8.2 1.2 1.0 5.5 4.3 1.9 0.0 6.1 5.8 0.6 3.0 2.8 11.2 2.1 5.7 1.4 2.7 2.9 0.0 7.9 4.0 1.3 6.5 3.3 50.0 32.9 58.6 28.3 69.8 2.2 7.5 51.8 79.3 94.6 27.8 42.0 Transcription factor/regulator BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer SIN3A TBX3 MECOM RUNX1 TSHZ2 TAF1 CTCF EP300 TSHZ3 GATA3 VHL 1.0 0.5 0.5 0.7 0.7 0.5 0.0 1.8 2.9 0.6 5.2 1.1 3.1 2.4 1.0 0.0 0.7 0.0 0.0 4.4 2.9 1.0 1.3 1.4 5.1 0.5 1.0 1.4 1.7 1.0 0.0 3.5 4.6 0.6 3.0 1.5 1.0 3.3 1.0 0.0 0.7 0.0 9.0 0.4 0.0 0.0 1.3 1.6 4.1 0.9 3.1 2.4 1.3 0.7 0.0 6.6 3.5 1.0 1.7 1.8 2.0 1.1 1.6 1.4 2.3 1.2 0.0 4.0 6.9 1.6 8.7 2.3 2.0 2.4 1.6 0.0 3.3 0.5 0.5 1.3 0.0 0.3 16.5 2.4 17.4 0.8 2.1 0.3 8.0 1.4 0.0 0.9 4.6 0.3 5.2 2.5 2.0 0.7 3.1 0.7 1.3 1.2 0.5 14.9 6.3 1.0 3.9 2.6 1.0 10.6 1.0 0.0 2.0 0.0 0.0 2.6 2.9 0.3 0.4 3.2 0.0 0.0 0.0 0.0 0.0 52.3 0.0 0.0 0.6 0.0 0.9 6.9 Nature. 2013 Oct 17;502(7471):333-9. Mutational landscape and significance across 12 major cancer types. Kandoth C et. al.
‹› Left Supraclavicular Lesion: PET-CT Sept, 2012 Nov, 2012 Response Assessment After Starting Erlotinib 27 Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
How to Implement Personalized Cancer Medicine In a Clinical Setting The Case of MI-ONCOSEQ
Genomics WGS, WES Transcriptomics RNA-Seq Epigenomics Bisulfite-Seq ChIP-Seq Smallindels point mutation Copy number variation Structural variation Differential expression Gene fusion Alternative splicing RNA editing Methylation Histone modification Transcription Factor binding Functional effect of mutation Network and pathway analysis Integrative analysis Furtherunderstandingofcancerandclinicalapplications Technologies Data Analysis Integration and interpretationPatient Figure 1 The workflow of integrating omics data in cancer research and clinical application. NGS technologies detect the genomic, transcriptomic and epigenomic alternations including mutations, copy number variations, structural variants, differentially expressed genes, fusion Shyr and Liu Biological Procedures Online 2013, 15:4 Page 2 of 11 http://www.biologicalproceduresonline.com/content/15/1/4 The workflow of integrating omics data in cancer research and clinical application Shyr D, Liu Q. Biol Proced Online. 2013 Feb 13;15(1):4.
C A N C E R Personalized Oncology Through Integrative High-Throughput Sequencing: A Pilot Study Sameek Roychowdhury,1,2 * Matthew K. Iyer,1,3 * Dan R. Robinson,1,4 * Robert J. Lonigro,1,3 Yi-Mi Wu,1,4 Xuhong Cao,1,4,5 Shanker Kalyana-Sundaram,1,4,6 Lee Sam,1,3 O. Alejandro Balbin,1,3 Michael J. Quist,1,4 Terrence Barrette,1,4 Jessica Everett,7 Javed Siddiqui,1,4 Lakshmi P. Kunju,1,4 Nora Navone,8 John C. Araujo,8 Patricia Troncoso,8 Christopher J. Logothetis,8 Jeffrey W. Innis,9 David C. Smith,2,10 Christopher D. Lao,2,10 Scott Y. Kim,11 J. Scott Roberts,11,12 Stephen B. Gruber,2,10 Kenneth J. Pienta,1,2,10,13 Moshe Talpaz,2,10 Arul M. Chinnaiyan1,3,4,5,13† Individual cancers harbor a set of genetic aberrations that can be informative for identifying rational therapies cur- rently available or in clinical trials. We implemented a pilot study to explore the practical challenges of applying high-throughput sequencing in clinical oncology. We enrolled patients with advanced or refractory cancer who were eligible for clinical trials. For each patient, we performed whole-genome sequencing of the tumor, targeted whole-exome sequencing of tumor and normal DNA, and transcriptome sequencing (RNA-Seq) of the tumor to identify potentially informative mutations in a clinically relevant time frame of 3 to 4 weeks. With this approach, we detected several classes of cancer mutations including structural rearrangements, copy number alterations, point mutations, and gene expression alterations. A multidisciplinary Sequencing Tumor Board (STB) deliberated on the clinical interpretation of the sequencing results obtained. We tested our sequencing strategy on human prostate cancer xenografts. Next, we enrolled two patients into the clinical protocol and were able to review the results at our STB within 24 days of biopsy. The first patient had metastatic colorectal cancer in which we identified somatic point mutations in NRAS, TP53, AURKA, FAS, and MYH11, plus amplification and overexpression of cyclin-dependent kinase 8 (CDK8). The second patient had malignant melanoma, in which we identified a somatic point mutation in HRAS and a structural rearrangement affecting CDKN2C. The STB identified the CDK8 amplification and Ras mutation as providing a rationale for clinical trials with CDK inhibitors or MEK (mitogen- activated or extracellular signal–regulated protein kinase kinase) and PI3K (phosphatidylinositol 3-kinase) inhibitors, respectively. Integrative high-throughput sequencing of patients with advanced cancer generates a comprehensive, individual mutational landscape to facilitate biomarker-driven clinical trials in oncology. INTRODUCTION The management of patients with cancer is well suited to a personal- ized approach, as reinforced by recent genomic studies that reveal a disease composed of numerous heterogeneous mutations. Although hallmark mutations such as inactivation of TP53 or activation of BRAF occur frequently, they often appear in concert with a host of uncommon oncogenic events. Further, expanding catalogs of cancer mutations dispel the notion that cancer mutations are tissue-specific (1–7). For example, activating BRAF mutations have in more than 50% of cutaneous melanoma and papilla cinoma, and the mutant proteins are potential tar inhibitors (8, 9). However, BRAF mutations also occur quency (5 to 20%) in multiple myeloma, lung cancer cinoma, and testicular cancer (10, 11). Moreover, a lo fraction of major targetable kinases—including PIK3C dermal growth factor receptor), and ERBB2—may R E S E A R C H A R T I C L E Michigan Oncology Sequencing Project (MI-ONCOSEQ) Roychowdhury S et al. Sci Transl Med. 2011 Nov 30;3(111):111ra121
Sequencing Buccal swab or Blood Sequencing Tumor Board Disclosure of Results Genetic Counselor Analysis 1) Actionable Results? 2) Incidental Results? Informed Consent Tumor Biopsy Genetic Counseling MI-ONCOSEQ: The Michigan Oncology Sequencing Center Precision Medicine Tumor Board Clinically RelevantTimeframe FromTissue Biopsy to Sequencing Results Day 0 Day 27-30
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities

Empfohlen

The Cancer Genome Atlas Update
The Cancer Genome Atlas UpdateThe Cancer Genome Atlas Update
The Cancer Genome Atlas UpdateMelanoma Research Foundation
 
NGS in cancer treatment
NGS in cancer treatmentNGS in cancer treatment
NGS in cancer treatmentNur Suhaida
 
Clinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation SequencingClinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation SequencingBell Symposium &amp; MSP Seminar
 
Liquid biopsy
Liquid biopsyLiquid biopsy
Liquid biopsyDr. Shashank Agrawal
 
Genetics in prostate cancer
Genetics in prostate cancerGenetics in prostate cancer
Genetics in prostate cancerAlok Gupta
 
Car t cells
Car t cellsCar t cells
Car t cellsqussai abbas
 
Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Mohamed Abdulla
 
Cancer genome
Cancer genomeCancer genome
Cancer genomeKundan Singh
 

Empfohlen

The Cancer Genome Atlas Update
The Cancer Genome Atlas UpdateThe Cancer Genome Atlas Update
The Cancer Genome Atlas UpdateMelanoma Research Foundation
 
NGS in cancer treatment
NGS in cancer treatmentNGS in cancer treatment
NGS in cancer treatmentNur Suhaida
 
Clinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation SequencingClinical Applications of Next Generation Sequencing
Clinical Applications of Next Generation SequencingBell Symposium &amp; MSP Seminar
 
Liquid biopsy
Liquid biopsyLiquid biopsy
Liquid biopsyDr. Shashank Agrawal
 
Genetics in prostate cancer
Genetics in prostate cancerGenetics in prostate cancer
Genetics in prostate cancerAlok Gupta
 
Car t cells
Car t cellsCar t cells
Car t cellsqussai abbas
 
Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Mohamed Abdulla
 
Cancer genome
Cancer genomeCancer genome
Cancer genomeKundan Singh
 
Dr arun Triple Negative Breast cancer Presentation
Dr arun Triple Negative Breast cancer PresentationDr arun Triple Negative Breast cancer Presentation
Dr arun Triple Negative Breast cancer PresentationArun Shahi MD,MPH
 
NTRK fusion-positive cancers and TRK inhibitor therapy
NTRK fusion-positive cancers and TRK inhibitor therapyNTRK fusion-positive cancers and TRK inhibitor therapy
NTRK fusion-positive cancers and TRK inhibitor therapyARJUN MANDADE
 
Introduction cancer genetics and genomics
Introduction cancer genetics and genomicsIntroduction cancer genetics and genomics
Introduction cancer genetics and genomicsNuria Lopez-Bigas
 
Precision Medicine in Oncology
Precision Medicine in OncologyPrecision Medicine in Oncology
Precision Medicine in OncologyCanadian Cancer Survivor Network
 
Understanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer RiskUnderstanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer RiskDana-Farber Cancer Institute
 
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTAPPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023CHC Connecticut
 
Car T cell
Car T cellCar T cell
Car T cellRezaSahebi4
 
Cancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerCancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerDenise Sheer
 
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...Prof. Eric Raymond Oncologie Medicale
 
Biomarkers in cancer
Biomarkers in cancerBiomarkers in cancer
Biomarkers in cancerpriya1111
 
Genetic assays in breast cancer
Genetic assays in breast cancerGenetic assays in breast cancer
Genetic assays in breast cancerVibhay Pareek
 
Cancer genetics
Cancer geneticsCancer genetics
Cancer geneticsRobert J Miller MD
 
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...QIAGEN
 
Hr+ her2 neu mbc ppt
Hr+ her2 neu mbc pptHr+ her2 neu mbc ppt
Hr+ her2 neu mbc pptmadurai
 
Precision Medicine in Oncology Informatics
Precision Medicine in Oncology InformaticsPrecision Medicine in Oncology Informatics
Precision Medicine in Oncology InformaticsWarren Kibbe
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.hungnguyenthien
 
Precision Medicine - The Future of Healthcare
Precision Medicine - The Future of HealthcarePrecision Medicine - The Future of Healthcare
Precision Medicine - The Future of HealthcareData Science Thailand
 
Liquid Biopsy in Oncology: Non-Invasive Diagnosis for Cancer Patients
Liquid Biopsy in Oncology�: Non-Invasive Diagnosis for Cancer PatientsLiquid Biopsy in Oncology�: Non-Invasive Diagnosis for Cancer Patients
Liquid Biopsy in Oncology: Non-Invasive Diagnosis for Cancer PatientsKumaraguru Veerasamy
 
Molecular diagnostics of colorectal cancer
Molecular diagnostics of colorectal cancerMolecular diagnostics of colorectal cancer
Molecular diagnostics of colorectal cancerAddisu Alemu
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
 

Weitere ähnliche Inhalte

Was ist angesagt?

Dr arun Triple Negative Breast cancer Presentation
Dr arun Triple Negative Breast cancer PresentationDr arun Triple Negative Breast cancer Presentation
Dr arun Triple Negative Breast cancer PresentationArun Shahi MD,MPH
 
NTRK fusion-positive cancers and TRK inhibitor therapy
NTRK fusion-positive cancers and TRK inhibitor therapyNTRK fusion-positive cancers and TRK inhibitor therapy
NTRK fusion-positive cancers and TRK inhibitor therapyARJUN MANDADE
 
Introduction cancer genetics and genomics
Introduction cancer genetics and genomicsIntroduction cancer genetics and genomics
Introduction cancer genetics and genomicsNuria Lopez-Bigas
 
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTAPPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTDinie Fariz
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023CHC Connecticut
 
Cancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerCancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerDenise Sheer
 
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...Prof. Eric Raymond Oncologie Medicale
 
Biomarkers in cancer
Biomarkers in cancerBiomarkers in cancer
Biomarkers in cancerpriya1111
 
Genetic assays in breast cancer
Genetic assays in breast cancerGenetic assays in breast cancer
Genetic assays in breast cancerVibhay Pareek
 
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...QIAGEN
 
Hr+ her2 neu mbc ppt
Hr+ her2 neu mbc pptHr+ her2 neu mbc ppt
Hr+ her2 neu mbc pptmadurai
 
Precision Medicine in Oncology Informatics
Precision Medicine in Oncology InformaticsPrecision Medicine in Oncology Informatics
Precision Medicine in Oncology InformaticsWarren Kibbe
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.hungnguyenthien
 
Precision Medicine - The Future of Healthcare
Precision Medicine - The Future of HealthcarePrecision Medicine - The Future of Healthcare
Precision Medicine - The Future of HealthcareData Science Thailand
 
Liquid Biopsy in Oncology: Non-Invasive Diagnosis for Cancer Patients
Liquid Biopsy in Oncology�: Non-Invasive Diagnosis for Cancer PatientsLiquid Biopsy in Oncology�: Non-Invasive Diagnosis for Cancer Patients
Liquid Biopsy in Oncology: Non-Invasive Diagnosis for Cancer PatientsKumaraguru Veerasamy
 
Molecular diagnostics of colorectal cancer
Molecular diagnostics of colorectal cancerMolecular diagnostics of colorectal cancer
Molecular diagnostics of colorectal cancerAddisu Alemu
 

Was ist angesagt? (20)

Dr arun Triple Negative Breast cancer Presentation
Dr arun Triple Negative Breast cancer PresentationDr arun Triple Negative Breast cancer Presentation
Dr arun Triple Negative Breast cancer Presentation
 
NTRK fusion-positive cancers and TRK inhibitor therapy
NTRK fusion-positive cancers and TRK inhibitor therapyNTRK fusion-positive cancers and TRK inhibitor therapy
NTRK fusion-positive cancers and TRK inhibitor therapy
 
Introduction cancer genetics and genomics
Introduction cancer genetics and genomicsIntroduction cancer genetics and genomics
Introduction cancer genetics and genomics
 
Precision Medicine in Oncology
Precision Medicine in OncologyPrecision Medicine in Oncology
Precision Medicine in Oncology
 
Understanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer RiskUnderstanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer Risk
 
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENTAPPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023
 
Car T cell
Car T cellCar T cell
Car T cell
 
Cancer Genetics - Denise Sheer
Cancer Genetics - Denise SheerCancer Genetics - Denise Sheer
Cancer Genetics - Denise Sheer
 
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...
First-in-Human Chimeric antigen receptor (CAR) T cell Therapies: Promises and...
 
Biomarkers in cancer
Biomarkers in cancerBiomarkers in cancer
Biomarkers in cancer
 
Genetic assays in breast cancer
Genetic assays in breast cancerGenetic assays in breast cancer
Genetic assays in breast cancer
 
Cancer genetics
Cancer geneticsCancer genetics
Cancer genetics
 
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...
Liquid Biopsy Overview, Challenges and New Solutions: Liquid Biopsy Series Pa...
 
Hr+ her2 neu mbc ppt
Hr+ her2 neu mbc pptHr+ her2 neu mbc ppt
Hr+ her2 neu mbc ppt
 
Precision Medicine in Oncology Informatics
Precision Medicine in Oncology InformaticsPrecision Medicine in Oncology Informatics
Precision Medicine in Oncology Informatics
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
 
Precision Medicine - The Future of Healthcare
Precision Medicine - The Future of HealthcarePrecision Medicine - The Future of Healthcare
Precision Medicine - The Future of Healthcare
 
Liquid Biopsy in Oncology: Non-Invasive Diagnosis for Cancer Patients
Liquid Biopsy in Oncology�: Non-Invasive Diagnosis for Cancer PatientsLiquid Biopsy in Oncology�: Non-Invasive Diagnosis for Cancer Patients
Liquid Biopsy in Oncology: Non-Invasive Diagnosis for Cancer Patients
 
Molecular diagnostics of colorectal cancer
Molecular diagnostics of colorectal cancerMolecular diagnostics of colorectal cancer
Molecular diagnostics of colorectal cancer
 

Ähnlich wie Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities

Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...European School of Oncology
 
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...Alexandra Papadopoulou
 
Next-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones InfographicNext-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones InfographicQIAGEN
 
Personalised medicine in rt dr. ashutosh
Personalised medicine in rt dr. ashutoshPersonalised medicine in rt dr. ashutosh
Personalised medicine in rt dr. ashutoshAshutosh Mukherji
 
Genomica en cancer de pulmon.final.1
Genomica en cancer de pulmon.final.1Genomica en cancer de pulmon.final.1
Genomica en cancer de pulmon.final.1Luis Toache
 
Knocking on the clinic door of precision medicine
Knocking on the clinic door of precision medicine Knocking on the clinic door of precision medicine
Knocking on the clinic door of precision medicine Yoon Sup Choi
 
1 s2.0-s0092867412010616-main
1 s2.0-s0092867412010616-main1 s2.0-s0092867412010616-main
1 s2.0-s0092867412010616-mainDragon Yott
 
Genomic oncology and personalized medicine
Genomic oncology and personalized medicine Genomic oncology and personalized medicine
Genomic oncology and personalized medicine C. Jeff Chang, MD, PhD
 
Translational science in neuroendocrne tumors: opportunities and pitfalls - B...
Translational science in neuroendocrne tumors: opportunities and pitfalls - B...Translational science in neuroendocrne tumors: opportunities and pitfalls - B...
Translational science in neuroendocrne tumors: opportunities and pitfalls - B...Prof. Eric Raymond Oncologie Medicale
 
Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'
Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'
Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'Fundación Ramón Areces
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3Michael Powell
 
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...Affymetrix
 
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)mastaneh zohri
 
Methods, Challenges and Future Directions of Radiogenomics-Crimson Publishers
Methods, Challenges and Future Directions of Radiogenomics-Crimson PublishersMethods, Challenges and Future Directions of Radiogenomics-Crimson Publishers
Methods, Challenges and Future Directions of Radiogenomics-Crimson PublishersCrimsonpublishersCancer
 

Ähnlich wie Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities (20)

Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
 
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
Gene Profiling in Clinical Oncology - Slide 4 - L. Lacroix - New markers to d...
 
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
Poster_Molecular analysis of BRAF and RAS family genes in thyroid carcinoma i...
 
Next-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones InfographicNext-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones Infographic
 
Personalised medicine in rt dr. ashutosh
Personalised medicine in rt dr. ashutoshPersonalised medicine in rt dr. ashutosh
Personalised medicine in rt dr. ashutosh
 
Genomica en cancer de pulmon.final.1
Genomica en cancer de pulmon.final.1Genomica en cancer de pulmon.final.1
Genomica en cancer de pulmon.final.1
 
Knocking on the clinic door of precision medicine
Knocking on the clinic door of precision medicine Knocking on the clinic door of precision medicine
Knocking on the clinic door of precision medicine
 
1 s2.0-s0092867412010616-main
1 s2.0-s0092867412010616-main1 s2.0-s0092867412010616-main
1 s2.0-s0092867412010616-main
 
Cancer gastrico adyuvancia
Cancer gastrico adyuvanciaCancer gastrico adyuvancia
Cancer gastrico adyuvancia
 
Nous reptes de la Medicina de Precisió
Nous reptes de la Medicina de PrecisióNous reptes de la Medicina de Precisió
Nous reptes de la Medicina de Precisió
 
Genomic oncology and personalized medicine
Genomic oncology and personalized medicine Genomic oncology and personalized medicine
Genomic oncology and personalized medicine
 
Translational science in neuroendocrne tumors: opportunities and pitfalls - B...
Translational science in neuroendocrne tumors: opportunities and pitfalls - B...Translational science in neuroendocrne tumors: opportunities and pitfalls - B...
Translational science in neuroendocrne tumors: opportunities and pitfalls - B...
 
Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'
Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'
Dr. José Baselga - Simposio Internacional 'Terapias oncológicas avanzadas'
 
7 capdevila
7 capdevila7 capdevila
7 capdevila
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
 
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
Use of Affymetrix Arrays (GeneChip® Human Transcriptome 2.0 Array and Cytosca...
 
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)
 
targeted therapy
targeted therapytargeted therapy
targeted therapy
 
Methods, Challenges and Future Directions of Radiogenomics-Crimson Publishers
Methods, Challenges and Future Directions of Radiogenomics-Crimson PublishersMethods, Challenges and Future Directions of Radiogenomics-Crimson Publishers
Methods, Challenges and Future Directions of Radiogenomics-Crimson Publishers
 
Update on thyroid tumors
Update on thyroid tumorsUpdate on thyroid tumors
Update on thyroid tumors
 

Mehr von Yoon Sup Choi

한국 원격의료 산업의 주요 이슈
한국 원격의료 산업의 주요 이슈한국 원격의료 산업의 주요 이슈
한국 원격의료 산업의 주요 이슈Yoon Sup Choi
 
원격의료 시대의 디지털 치료제
원격의료 시대의 디지털 치료제원격의료 시대의 디지털 치료제
원격의료 시대의 디지털 치료제Yoon Sup Choi
 
[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어
[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어
[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어Yoon Sup Choi
 
디지털 헬스케어 파트너스 (DHP) 소개 자료
디지털 헬스케어 파트너스 (DHP) 소개 자료디지털 헬스케어 파트너스 (DHP) 소개 자료
디지털 헬스케어 파트너스 (DHP) 소개 자료Yoon Sup Choi
 
[대한병리학회] 의료 인공지능 101: 병리를 중심으로
[대한병리학회] 의료 인공지능 101: 병리를 중심으로[대한병리학회] 의료 인공지능 101: 병리를 중심으로
[대한병리학회] 의료 인공지능 101: 병리를 중심으로Yoon Sup Choi
 
한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언
한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언
한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언Yoon Sup Choi
 
원격의료에 대한 생각, 그리고 그 생각에 대한 생각
원격의료에 대한 생각, 그리고 그 생각에 대한 생각원격의료에 대한 생각, 그리고 그 생각에 대한 생각
원격의료에 대한 생각, 그리고 그 생각에 대한 생각Yoon Sup Choi
 
[C&C] 의료의 미래 디지털 헬스케어
[C&C] 의료의 미래 디지털 헬스케어[C&C] 의료의 미래 디지털 헬스케어
[C&C] 의료의 미래 디지털 헬스케어Yoon Sup Choi
 
포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건
포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건
포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건Yoon Sup Choi
 
디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약Yoon Sup Choi
 
[365mc] 디지털 헬스케어: 의료의 미래
[365mc] 디지털 헬스케어: 의료의 미래[365mc] 디지털 헬스케어: 의료의 미래
[365mc] 디지털 헬스케어: 의료의 미래Yoon Sup Choi
 
디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약Yoon Sup Choi
 
[ASGO 2019] Artificial Intelligence in Medicine
[ASGO 2019] Artificial Intelligence in Medicine[ASGO 2019] Artificial Intelligence in Medicine
[ASGO 2019] Artificial Intelligence in MedicineYoon Sup Choi
 
글로벌 디지털 헬스케어 산업 및 규제 동향
글로벌 디지털 헬스케어 산업 및 규제 동향 글로벌 디지털 헬스케어 산업 및 규제 동향
글로벌 디지털 헬스케어 산업 및 규제 동향 Yoon Sup Choi
 
인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가
인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가
인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가Yoon Sup Choi
 
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)Yoon Sup Choi
 
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)Yoon Sup Choi
 
한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면
한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면
한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면Yoon Sup Choi
 
의료의 미래, 디지털 헬스케어 + 의료 시장의 특성
의료의 미래, 디지털 헬스케어 + 의료 시장의 특성의료의 미래, 디지털 헬스케어 + 의료 시장의 특성
의료의 미래, 디지털 헬스케어 + 의료 시장의 특성Yoon Sup Choi
 
디지털 의료가 '의료'가 될 때 (1/2)
디지털 의료가 '의료'가 될 때 (1/2)디지털 의료가 '의료'가 될 때 (1/2)
디지털 의료가 '의료'가 될 때 (1/2)Yoon Sup Choi
 

Mehr von Yoon Sup Choi (20)

한국 원격의료 산업의 주요 이슈
한국 원격의료 산업의 주요 이슈한국 원격의료 산업의 주요 이슈
한국 원격의료 산업의 주요 이슈
 
원격의료 시대의 디지털 치료제
원격의료 시대의 디지털 치료제원격의료 시대의 디지털 치료제
원격의료 시대의 디지털 치료제
 
[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어
[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어
[KNAPS] 포스트 코로나 시대, 제약 산업과 디지털 헬스케어
 
디지털 헬스케어 파트너스 (DHP) 소개 자료
디지털 헬스케어 파트너스 (DHP) 소개 자료디지털 헬스케어 파트너스 (DHP) 소개 자료
디지털 헬스케어 파트너스 (DHP) 소개 자료
 
[대한병리학회] 의료 인공지능 101: 병리를 중심으로
[대한병리학회] 의료 인공지능 101: 병리를 중심으로[대한병리학회] 의료 인공지능 101: 병리를 중심으로
[대한병리학회] 의료 인공지능 101: 병리를 중심으로
 
한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언
한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언
한국 디지털 헬스케어의 생존을 위한 규제 혁신에 대한 고언
 
원격의료에 대한 생각, 그리고 그 생각에 대한 생각
원격의료에 대한 생각, 그리고 그 생각에 대한 생각원격의료에 대한 생각, 그리고 그 생각에 대한 생각
원격의료에 대한 생각, 그리고 그 생각에 대한 생각
 
[C&C] 의료의 미래 디지털 헬스케어
[C&C] 의료의 미래 디지털 헬스케어[C&C] 의료의 미래 디지털 헬스케어
[C&C] 의료의 미래 디지털 헬스케어
 
포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건
포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건
포스트 코로나 시대, 혁신적인 디지털 헬스케어 기업의 조건
 
디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약
 
[365mc] 디지털 헬스케어: 의료의 미래
[365mc] 디지털 헬스케어: 의료의 미래[365mc] 디지털 헬스케어: 의료의 미래
[365mc] 디지털 헬스케어: 의료의 미래
 
디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약디지털 치료제, 또 하나의 신약
디지털 치료제, 또 하나의 신약
 
[ASGO 2019] Artificial Intelligence in Medicine
[ASGO 2019] Artificial Intelligence in Medicine[ASGO 2019] Artificial Intelligence in Medicine
[ASGO 2019] Artificial Intelligence in Medicine
 
글로벌 디지털 헬스케어 산업 및 규제 동향
글로벌 디지털 헬스케어 산업 및 규제 동향 글로벌 디지털 헬스케어 산업 및 규제 동향
글로벌 디지털 헬스케어 산업 및 규제 동향
 
인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가
인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가
인허가 이후에도 변화하는 AI/ML 기반 SaMD를 어떻게 규제할 것인가
 
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (상)
 
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)
인공지능은 의료를 어떻게 혁신하는가 (2019년 7월) (하)
 
한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면
한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면
한국에서 혁신적인 디지털 헬스케어 스타트업이 탄생하려면
 
의료의 미래, 디지털 헬스케어 + 의료 시장의 특성
의료의 미래, 디지털 헬스케어 + 의료 시장의 특성의료의 미래, 디지털 헬스케어 + 의료 시장의 특성
의료의 미래, 디지털 헬스케어 + 의료 시장의 특성
 
디지털 의료가 '의료'가 될 때 (1/2)
디지털 의료가 '의료'가 될 때 (1/2)디지털 의료가 '의료'가 될 때 (1/2)
디지털 의료가 '의료'가 될 때 (1/2)
 

Kürzlich hochgeladen

Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencyHire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencySheetal Arora
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfSumit Kumar yadav
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Lokesh Kothari
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsAArockiyaNisha
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPirithiRaju
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​ ​Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​ ​kaibalyasahoo82800
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...Sérgio Sacani
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhousejana861314
 
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptxUnlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptxanandsmhk
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...anilsa9823
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)Areesha Ahmad
 
Green chemistry and Sustainable development.pptx
Green chemistry and Sustainable development.pptxGreen chemistry and Sustainable development.pptx
Green chemistry and Sustainable development.pptxRajatChauhan518211
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...RohitNehra6
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisDiwakar Mishra
 
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSpermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSarthak Sekhar Mondal
 
Botany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questionsBotany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questionsSumit Kumar yadav
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )aarthirajkumar25
 
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptxSOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptxkessiyaTpeter
 

Kürzlich hochgeladen (20)

CELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdfCELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdf
 
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencyHire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdf
 
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
Labelling Requirements and Label Claims for Dietary Supplements and Recommend...
 
Natural Polymer Based Nanomaterials
Natural Polymer Based NanomaterialsNatural Polymer Based Nanomaterials
Natural Polymer Based Nanomaterials
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
 
Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​ ​Nanoparticles synthesis and characterization​ ​
Nanoparticles synthesis and characterization​ ​
 
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
PossibleEoarcheanRecordsoftheGeomagneticFieldPreservedintheIsuaSupracrustalBe...
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhouse
 
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptxUnlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
Unlocking the Potential: Deep dive into ocean of Ceramic Magnets.pptx
 
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
Lucknow 💋 Russian Call Girls Lucknow Finest Escorts Service 8923113531 Availa...
 
GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)GBSN - Biochemistry (Unit 1)
GBSN - Biochemistry (Unit 1)
 
Green chemistry and Sustainable development.pptx
Green chemistry and Sustainable development.pptxGreen chemistry and Sustainable development.pptx
Green chemistry and Sustainable development.pptx
 
Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...Biopesticide (2).pptx .This slides helps to know the different types of biop...
Biopesticide (2).pptx .This slides helps to know the different types of biop...
 
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral AnalysisRaman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
Raman spectroscopy.pptx M Pharm, M Sc, Advanced Spectral Analysis
 
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSpermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
 
Botany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questionsBotany krishna series 2nd semester Only Mcq type questions
Botany krishna series 2nd semester Only Mcq type questions
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )
 
The Philosophy of Science
The Philosophy of ScienceThe Philosophy of Science
The Philosophy of Science
 
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptxSOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
SOLUBLE PATTERN RECOGNITION RECEPTORS.pptx
 

Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challenges, and Opportunities

  • 1. Clinical Genomics for Personalized Cancer Medicine : Recent Advances, Challenges, and Opportunities 서울대학병원 의생명연구원 최윤섭, Ph.D.
  • 2. “It's in Apple's DNA that technology alone is not enough. It's technology married with liberal arts.”
  • 3. The Convergence of IT, BT and Medicine
  • 4. The Greatest Scientific Achievement in 20 century?
  • 5.
  • 6. What have been changed?
  • 8. 2003 Human Genome Project 13 years (676 weeks) $2,700,000,000 2007 Dr. CraigVenter’s genome 4 years (208 weeks) $100,000,000 2008 Dr. James Watson’s genome 4 months (16 weeks) $1,000,000 2009 (Nature Biotechnology) 4 weeks $48,000 현재 1-2 weeks ~$5,000
  • 9. 13 years 1 week (676 weeks) Over the last decade,
  • 11. Ferrari 458 Spider $398,000 40 cents http://www.guardian.co.uk/science/2013/jun/08/genome-sequenced
  • 12. The Age of The $1000 Genome is Coming!
  • 13. Illumina HiSeq XTen full coverage human genomes for less than $1,000
  • 14. The $1000 Genome is Already Here!
  • 15. A T G C DNA = Biological Data = Digital Data
  • 16. GTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGC GGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCG TCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCC GGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCAC CGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCT TCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGC AGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCC ACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGC TCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGT AAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGC CCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGA GGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCG CCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCT CGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGG ACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATC GCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCG ACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGA ACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCC CGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGAC TCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCT GCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGC GCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCG TTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGG CCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACA GGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGC GAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAA AGGTAAGGGCGTGTCTCGCCGGCTCCCCCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCG ACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTC CCGCGCCGCCCCCGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTG AGATCAGCTGCGCCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGG CTGCAGGCCAGGCGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCC GGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCGCCGCCAACGCCACAACCAC CGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGG CGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCCCACCGCGCACGGCCCCCTGACTCCGTCC AGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGACGGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGC GAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCC CGACGCGGCCGAGGCGGCCGGAGTCCCGAGCTAGCCCCGGCGGCCGCCGCCGCCCAGACCGGACGACAGGCCACCTCGTCGGCGTCCGCCCGAGTCCCCGCCTCG CCGCCAACGCCACAACCACCGCGCACGGCCCCCTGACTCCGTCCAGTATTGATCGGGAGAGCCGGAGCGAGCTCTTCGGGGAGCAGCGATGCGACCCTCCGGGAC GGCCGGGGCAGCGCTCTGGCGCTGCTGGCTGCGCTCTGCCCGGCGAGTCGGGCTCTGGAGGAAAAGAAAGGTAAGGGCGTGTCTCGCCGGCTCCCGCGCCGCCCC CGGATCGCGCCCCGGACCCCGCAGCCCGCCCAACCGCGCACCGGCGCACCGGCTCGGCGCCCGCGCCCCCGCCCGTCCTTTCCTGTTTCCTTGAGATCAGCTGCG CCGCCGACCGGGACCGCGGGAGGAACGGGACGTTTCGTTCTTCGGCCGGGAGAGTCTGGGGCGGGCGGAGGAGGAGACGCGTGGGACACCGGGCTGCAGGCCAGG CGGGGAACGGGTCCGGGCAGCCCCCGGCGCAGCGCGGCCGCAGCAGCCTCCGCCCCCCGCACGGTGTGAGCGCCCGACGCGGCCGAGGCGGCCGGAGTCCCGAGC Big Data
  • 17. Human Genome = 3 billion base pair = 100 GB ~ 10TB
  • 18. High performance computing power is the key!
  • 20. Depression Asthma Diabetes Arthritis Alzheimer Cancer 62% 60% 57% 50% 30% 25% Source of data: Brian B. Spear, Margo Heath-Chiozzi, Jeffery Huff, “ClinicalTrends in Molecular Medicine,”Volume 7, Issue 5, 1 May 2001, Pages 201-204. PERCENTAGE OFTHE PATIENT POPULATION FOR WHICH A PARTICULAR DRUG IS EFFECTIVE
  • 21. Tumor Heterogeneity Meric-Bernstam F, Mills GB. Nat Rev Clin Oncol. 2012 Sep;9(9):542-8.
  • 22. in the understanding of tumour heterogeneity; second, the role of surgery as a therapeutic modality in the era of targeted therapy; third, the use of personalized therapy in the perioperative period and, finally, the possibilities of personalization of surgical procedures according to lung cancer subtypes. VATS lobectomy showed that intraoperative blood loss was significantly reduced in the VATS group compared with open lobectomy in nine studies; however, no differ- ence was observed in five studies and the values were not reported in seven studies.12 Hospital stay was also signifi- cantly shorter in VATS group in five studies. Park et al.,13 Heterogeneity in patients with adenocarcinoma of the lung according to driver oncogenes Heterogeneity within patients with EGFR mutation Heterogeneity in resistance mechanisms in one patient HER2 3% EGFR ~40% in Asians ~15% in Caucasians ALK ~5% KRAS ~15% in Asians ~30% in Caucasians RET ~1% ROS1 ~1% BRAF ~1% PIK3CA ~1% NRAS ~1% MET <5% Others? Exon 19del ~50% L858R ~40% Sensitive Inherent resistance CRKL ~3% BIM 20–40% IκB ~30% Inherent T790M ~2% by sequencing ~30% by sensitive method Further heterogeneity EGFR-TKI Drug X T790M MET a cb T790M Heterogeneity in patients with adenocarcinoma of the lung according to driver oncogenes Heterogeneity within patients with EGFR mutation Heterogeneity resistance mecha in one patien HER2 3% EGFR ~40% in Asians ~15% in Caucasians ALK ~5% KRAS ~15% in Asians ~30% in Caucasians RET ~1% ROS1 ~1% BRAF ~1% PIK3CA ~1% NRAS ~1% MET <5% Others? Exon 19del ~50% L858R ~40% Sensitive Inherent resistance CRKL ~3% BIM 20–40% IκB ~30% Inherent T790M ~2% by sequencing ~30% by sensitive method Further heterogeneity EGFR-TKI Drug T790M ME a cb T790M Figure 1 | Various classes of tumour heterogeneity in adenocarcinoma of the lung. a | Heterogeneity in patients with adenocarcinoma of the lung according to driver oncogenes that are crucial for selecting targeted drugs for treatment.2,76 Number of people reflects approximate incidence.2,76 b | Heterogeneity in patients with EGFR mutations, resulting in MitsudomiT, Suda K,YatabeY. Nat Rev Clin Oncol. 2013 Apr;10(4):235-44. Heterogeneity in Lung Adenocarcinoma
  • 23. Percent 20 15 10 5 0 BRCA 1/2 PIK3CA am pPTEN delA KT am pN F1 del KRA S CD KN 2A del CCN D 1 am p CCN E1 am pRB1 del Percent 80 60 40 20 0 EG FR ERBB2PD G FRA M ET N F1 RA S PTEN PI3KCD KN 2A CD K4/6 RB1 ID H 1/2 emrofitluMamotsalboilGrecnaCnairavO KRAS EGFR ALK BRAF PIK3CA MET ERBB2 MEK1 NRAS ROS RET Other? Lung Adenocarcinoma EGFR ERBB2/3 FGFR PI3K MAPK TOR Other? Lung Squamous Cancer ERBB2 PIK3CA AKT FGFR1 amp PTEN Other? Breast Cancer KRAS PTEN PIK3CA KRAS+ PIK3CAERBB2/3 BRAF NRAS Other? Colorectal Cancer BRAF NRAS NF1 KIT Other? Melanoma CDKN2A CCND1 PTEN PIK3CA HRAS EGFR, ERBB2 Other? Head and Neck Squamous Cancer (PTEN and CDKN2A are frequently inactivated) CBA D E HG F Levi A. Garraway Garraway LA. J Clin Oncol. 2013 May 20;31(15):1806-14. Genomic alterations in common solid tumors. Expanding catalogs of cancer mutations dispel the notion that cancer mutations are tissue-specific Roychowdhury S et al. SciTransl Med. 2011 Nov 30;3(111):111ra121.
  • 24. Although the number of actionable alterations in any individual cancer patient’s sample was low (average, 1.57), a wide variety of alter- ations was observed across all samples, with 1,579 unique alterations reported. Actionable Genomic Alterations Were Identified in a Large Number of Genes assay, highlighting the broad applicability of the approach. Given that matched normal specimens are not routinely collected in clinical practice, reporting focused on known sites of somatic mutation39, truncations or homozygous deletions of known tumor suppressor genes40, as well as known amplifications of oncogenes and gene fusions in genes known to be rearranged in solid tumors. Alterations were reported in 174/189 (92%) of tested genes, with an surprising to observe that current clinical testing paradigms compris- ing only mutation hotspots10,11,43 capture less than one-third of total actionable results (Fig. 6c). The therapeutic implications of the long tail were particularly notable for proven targets of therapy, as exemplified by ERBB2. Although ERBB2 is currently clinically validated only as an amplified or overexpressed drug target in breast and gastro-esophageal cancer, we observed ERBB2 ab Head & neck 4% Soft tissue, 6% Unknown, 9% Gene amplification, 33% Sub/indel, 8% Gene deletion, 8% Mutation hotspots, 31% Lung, 18% Rearrangement, 3% Truncation, 17% Breast, 14% Colon, 7%Pancreas, 5% Ovary, 5% Skin, 3% Liver, 3% Uterus, 3% Others, 26% Patientsamples(%) c 40 45 35 30 25 20 15 10 5 0 TP53KR AS APCM C L1 R B 1 N F1 B R C A2 AU R KAN KX2_1 KIT ESR 1 IG F1R R ET TSC 2 M SH 6 ALK EW SR 1 PD G FR A R U N X1 VH L FG FR 2 M AP2K4 TET2 C C N D 2 M ET C D K6 N F2 C C N D 3 FG FR 3 PIK3R 1 AKT1 B AP1 R PTO R C D H 1 ID H 1 AKT2 SM AR C A4 SO X2 KD M 6A D N M T3A N O TC H 1 N R AS LR P1B R IC TO R B R C A1 C TN N B 1 ATM FB XW 7 C C N E1 PTPR D STK11 SM AD 4 B R AF C D K4 FG FR 1 ER B B 2 M D M 2 EG FR C C N D 1 AR ID 1A PTEN C D KN 2B PIK3C AM YC C D KN 2A amples(%) d 30 25 20 15 e Lung (17) Unknown (2) Stomach (1) Pancreas (1) Ovary (1) Bladder (1) Duodenum (1)ERBB2 Furin-Like TM Tyrosine_KinaseFurin-Like R678Q(4) L755S(4) D769Y(3) V842I(4) Receptor_L Receptor_L Colon (2) Uterus (4) Breast (8) ollected somatic n tumor cogenes tumors. with an ing only mutation hotspots10,11,43 capture less than one-third of total actionable results (Fig. 6c). The therapeutic implications of the long tail were particularly notable for proven targets of therapy, as exemplified by ERBB2. Although ERBB2 is currently clinically validated only as an amplified or overexpressed drug target in breast and gastro-esophageal cancer, we observed ERBB2 nknown, 9% Gene amplification, 33% Sub/indel, 8% Gene deletion, 8% Mutation hotspots, 31% 18% Rearrangement, 3% Truncation, 17% Breast, 14% % c AU R KAN KX2_1 KIT ESR 1 IG F1R R ET TSC 2 M SH 6 ALK EW SR 1 PD G FR A R U N X1 VH L FG FR 2 M AP2K4 TET2 C C N D 2 M ET C D K6 N F2 C C N D 3 FG FR 3 PIK3R 1 AKT1 B AP1 R PTO R C D H 1 ID H 1 AKT2 SM AR C A4 SO X2 KD M 6A D N M T3A N O TC H 1 N R AS LR P1B R IC TO R R C A1 1 Lung (17) Unknown (2) Stomach (1) Pancreas (1) Ovary (1) Bladder (1) Duodenum (1) Furin-Like TM Tyrosine_Kinase R678Q(4) L755S(4) D769Y(3) P780_Y781insGSP(4) V842I(4) Receptor_L Colon (2) Uterus (4) Breast (8) Nat Biotechnol. 2013 Nov;31(11):1023-31.
  • 25. The Long Tail Comprehensive genomic profiling through WGS is necessary vs.Targeted Seq, SNP chips, Hotspot Panels, Single gene tests…
  • 26. Cell cycle DNA methylationGenome integrity HIPPO signalling Histone Histone modifier MAPK signalling Metabolism NFE2L Other PI(3)K signalling Protein phosphatase Proteolysis Ribosome RTK signalling Splicing TGF-β signalling TOR signalling Transcription factor/regulator Wnt/β-catenin signalling BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer MIR142 B4GALT3 EGR3 CRIPAK PRX LIFR AR EPPK1 HGF NPM1 USP9X NCOR1 POLQ ARHGAP35 MALAT1 LRRK2 NOTCH1 NAV3 STK11 MTOR RPL5 RPL22 PTPN11 PPP2R1A NFE2L3 NFE2L2 IDH2 IDH1 TET2 DNMT3A AJUBA CDH1 PCBP1 U2AF1 SF3B1 SPOP KEAP1 FBXW7 HIST1H2BD H3F3C HIST1H1C SOX17 TBL1XR1 AXIN2 CTNNB1 APC ACVR2A SMAD2 ACVR1B TGFBR2 SMAD4 AKT1 PIK3CG TLR4 PIK3R1 PTEN PIK3CA MAPK8IP1 MAP2K4 NRAS BRAF MAP3K1 NF1 KRAS CDKN2C CDKN1A CCND1 CDKN1B CDK12 RB1 CDKN2A FGFR3 KIT FGFR2 EPHB6 PDGFRA ERBB4 EPHA3 FLT3 EGFR ERCC2 RAD21 CHEK2 SMC3 SMC1A BRCA1 BAP1 STAG2 ATR BRCA2 ATRX ATM TP53 EZH2 ASXL1 ARID5B MLL4 KDM6A KDM5C SETBP1 NSD1 SETD2 PBRM1 ARID1A MLL2 MLL3 FOXA2 CEBPA VEZF1 ELF3 SOX9 CBFB PHF6 FOXA1 EIF4A2 WT1 SIN3A TBX3 MECOM RUNX1 TSHZ2 TAF1 CTCF EP300 TSHZ3 GATA3 VHL 0.0 0.1 0.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 0.2 0.0 0.1 0.5 0.0 0.0 0.2 0.0 0.0 1.2 0.0 0.9 0.2 1.0 0.3 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.0 0.4 0.3 2.0 0.3 0.0 0.3 1.0 0.5 0.0 5.3 0.0 0.0 0.4 0.7 5.1 0.5 0.5 0.7 1.7 1.2 0.5 0.4 1.2 0.3 1.3 0.9 1.0 0.8 5.2 0.0 2.7 0.5 0.0 0.9 1.7 0.6 1.7 1.2 1.0 0.7 2.1 0.0 2.3 0.5 0.0 1.8 3.5 0.3 3.5 1.2 2.0 0.3 0.0 2.8 2.7 0.7 0.0 3.1 4.0 0.3 3.0 1.4 1.0 0.5 0.0 0.3 2.7 0.2 0.0 10.5 5.8 0.6 1.3 1.7 0.0 0.0 0.0 0.3 0.3 0.0 27.0 0.9 0.0 0.0 0.4 1.8 3.1 1.2 0.0 0.7 4.3 1.0 0.5 5.3 4.6 0.3 6.5 2.1 8.2 3.9 0.5 0.7 3.3 0.7 0.0 2.6 3.5 0.3 1.3 2.2 7.1 0.8 0.5 1.0 4.3 1.2 0.0 5.7 9.2 1.0 3.9 2.4 5.1 0.9 0.5 0.7 3.7 1.2 0.5 4.0 5.8 1.6 10.0 2.5 15.3 1.1 0.0 0.0 6.3 1.9 0.0 9.7 5.8 1.0 0.0 2.7 5.1 0.7 2.6 1.0 5.0 1.4 0.0 6.6 11.5 2.9 3.5 2.8 5.1 0.4 0.0 0.0 19.3 1.0 0.5 3.1 8.1 0.6 1.7 3.1 5.1 1.4 2.1 1.0 7.3 1.4 0.0 21.5 19.0 1.3 5.2 4.6 0.0 0.3 0.0 0.0 0.3 0.2 0.0 8.8 1.7 0.0 0.4 0.9 2.0 1.4 3.6 1.4 1.3 6.0 0.0 7.5 4.6 1.9 5.2 3.0 0.0 0.4 0.0 2.8 0.0 1.4 0.0 0.4 1.2 0.0 0.9 0.7 0.0 0.0 0.0 0.3 0.7 0.5 0.0 0.4 0.0 0.0 10.9 1.0 0.0 0.1 1.0 1.7 0.3 0.2 4.5 2.6 1.7 0.3 0.9 1.0 1.0 0.1 1.6 0.0 1.3 1.2 0.0 1.3 4.6 1.3 8.7 1.5 3.1 0.8 0.0 0.3 1.3 0.2 0.0 0.0 2.3 0.3 1.7 0.8 9.2 0.1 0.0 0.0 5.3 1.2 0.0 2.2 14.9 0.0 5.2 2.3 0.0 0.0 1.6 0.0 0.0 0.0 10.0 0.4 0.0 0.0 0.4 0.8 3.1 0.3 0.0 5.2 0.3 0.5 9.5 0.9 1.2 0.0 0.9 1.5 3.1 0.4 0.0 0.7 0.3 1.9 8.5 3.1 2.3 0.0 2.2 1.6 0.0 0.5 1.0 0.0 1.7 1.2 25.5 4.0 4.0 1.0 1.3 2.8 2.0 0.1 0.0 0.3 6.0 0.5 0.0 0.9 0.0 0.0 0.0 0.8 5.1 7.0 0.5 0.3 1.3 0.5 0.0 1.3 1.7 0.3 3.0 2.5 1.0 0.0 2.6 0.0 0.0 0.2 0.0 0.4 0.0 0.0 0.9 0.3 1.0 0.3 0.5 0.0 1.3 0.0 4.0 2.6 0.0 0.0 0.9 0.8 4.1 1.8 1.0 0.7 0.7 1.0 0.5 2.2 2.3 0.0 2.2 1.3 1.0 0.1 0.0 0.0 1.0 0.0 0.0 0.4 0.6 0.3 6.5 0.7 3.1 0.1 0.0 0.0 4.0 0.5 0.0 17.1 12.1 0.3 1.3 2.6 9.2 0.8 11.4 0.3 5.0 0.2 0.0 1.3 5.2 1.0 11.7 3.0 1.0 0.0 0.0 0.0 1.3 0.0 0.0 0.0 1.2 0.3 2.6 0.4 0.0 0.0 0.0 0.7 0.7 0.0 0.0 1.8 1.2 0.0 0.9 0.4 1.0 0.4 1.0 0.7 1.3 0.2 0.0 0.4 0.6 1.3 0.0 0.6 0.0 0.0 0.5 0.3 0.3 0.0 0.0 0.4 0.0 0.0 3.0 0.3 2.0 1.1 0.0 0.0 1.0 0.7 0.0 2.2 1.2 0.3 1.3 0.8 3.1 0.1 3.6 0.3 1.7 0.2 0.0 0.9 0.6 0.3 2.6 0.9 2.0 0.1 4.7 0.3 0.7 0.2 0.0 3.5 1.7 0.6 28.3 2.9 4.1 0.5 81.9 0.3 4.0 1.4 0.0 9.2 4.0 2.2 5.7 7.3 1.0 0.5 2.6 0.0 0.7 0.2 0.0 0.9 1.2 0.0 0.4 0.6 1.0 0.5 5.7 0.0 1.0 0.5 0.0 0.9 1.2 0.0 1.3 0.9 0.0 0.7 3.6 0.0 1.3 1.0 0.0 2.2 1.2 0.3 1.7 1.0 3.1 0.4 2.6 0.7 3.0 0.2 0.0 0.9 1.7 1.0 1.3 1.1 2.0 0.4 9.8 0.3 2.0 0.5 0.0 3.1 2.9 0.0 0.0 1.4 0.0 2.5 0.0 0.3 0.7 0.5 0.0 0.0 0.6 0.0 1.3 0.9 2.0 0.4 0.5 2.4 2.7 0.7 0.0 5.3 7.5 1.0 1.3 1.7 2.0 1.2 0.0 0.3 2.0 0.5 0.5 11.4 5.8 1.0 0.4 1.9 1.0 2.5 2.1 11.4 1.7 0.5 0.0 1.3 0.6 0.3 30.9 4.4 3.1 3.8 1.0 30.7 1.3 4.3 0.0 2.2 8.1 0.6 63.5 9.7 17.4 33.6 17.6 11.0 20.6 2.9 0.0 4.4 14.9 0.6 52.2 17.8 2.0 0.3 2.1 0.7 0.7 0.5 0.0 1.8 1.2 0.3 0.4 0.7 0.0 4.1 2.6 0.0 0.3 0.0 0.0 1.3 0.6 0.3 1.3 1.4 2.0 0.1 8.8 0.3 0.0 0.0 7.5 1.8 0.6 0.6 2.6 1.5 2.0 0.4 3.6 2.1 1.0 0.2 0.0 6.6 4.6 0.6 0.9 1.5 3.1 7.2 0.0 2.1 1.0 1.2 0.0 1.8 1.7 0.3 3.5 2.7 7.1 2.5 1.0 11.0 2.7 1.7 1.0 11.8 10.3 3.8 3.5 4.4 0.0 0.8 45.1 0.7 0.3 0.2 4.0 26.3 1.2 0.6 20.0 6.7 0.0 0.0 0.0 1.0 0.0 0.2 0.0 0.0 0.6 0.6 0.0 0.2 12.2 0.0 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.3 0.0 0.6 2.0 0.1 0.0 0.0 0.3 0.0 0.0 0.9 0.6 0.0 5.2 0.6 2.0 0.9 1.0 0.3 0.7 0.0 0.0 1.8 0.0 0.3 0.9 0.7 4.1 0.9 1.6 0.3 1.7 1.4 0.0 3.1 0.6 2.9 2.2 1.5 14.3 1.8 0.5 8.3 3.0 0.2 0.0 5.3 6.9 1.9 3.9 3.2 4.1 0.0 0.5 0.7 21.3 1.0 0.0 6.6 14.9 0.0 0.4 3.6 8.2 0.1 0.5 1.4 1.7 1.4 0.0 0.4 2.3 0.3 0.4 1.0 1.0 0.5 1.0 1.0 1.0 0.7 4.0 1.8 3.5 1.9 2.2 1.4 2.0 0.9 0.0 0.3 0.7 0.2 0.0 3.1 2.3 0.0 10.4 1.5 3.1 0.4 0.0 1.4 1.3 1.2 0.0 9.7 3.5 0.3 1.7 1.6 6.1 0.4 1.0 3.8 1.0 1.4 0.5 6.6 4.0 1.0 1.3 1.9 2.0 0.8 3.6 0.3 4.3 1.4 0.0 7.5 5.2 0.0 2.6 2.1 1.0 0.5 3.1 1.0 3.7 0.5 0.5 8.8 6.3 1.0 2.2 2.1 2.0 0.4 0.0 1.7 0.7 0.5 26.5 4.0 4.0 1.0 0.9 2.7 1.0 0.7 1.6 26.6 4.7 1.7 1.0 11.4 2.9 1.9 1.3 4.6 12.2 0.1 0.5 0.0 0.3 0.2 0.0 1.3 0.0 0.3 0.4 0.7 2.0 0.5 1.0 0.3 1.0 0.0 2.5 2.6 1.2 0.3 0.9 0.9 2.0 0.4 0.0 1.7 2.3 0.7 0.0 0.9 1.2 0.3 1.3 0.9 1.0 0.4 0.0 1.4 1.7 1.2 3.5 2.6 2.3 0.3 0.4 1.2 3.1 0.8 1.6 1.7 1.0 0.5 3.5 1.3 0.6 1.3 4.4 1.5 4.1 1.6 0.0 1.0 2.7 1.0 0.0 3.5 5.2 3.5 0.9 1.9 4.1 0.3 0.0 0.7 1.0 10.1 0.0 1.3 0.6 0.6 2.2 2.0 10.2 0.9 1.0 4.1 0.7 1.7 3.0 2.6 3.5 1.0 3.9 2.2 4.1 0.8 2.1 1.4 5.3 1.2 0.0 5.7 4.0 0.6 7.0 2.4 6.1 1.7 1.6 1.4 3.7 1.9 0.0 5.7 5.8 3.2 4.4 2.7 8.2 1.2 1.0 5.5 4.3 1.9 0.0 6.1 5.8 0.6 3.0 2.8 11.2 2.1 5.7 1.4 2.7 2.9 0.0 7.9 4.0 1.3 6.5 3.3 50.0 32.9 58.6 28.3 69.8 2.2 7.5 51.8 79.3 94.6 27.8 42.0 1.0 0.1 0.0 1.0 0.3 0.7 1.5 2.2 2.3 0.0 1.7 0.8 3.1 0.4 1.6 0.0 3.0 1.0 2.5 1.3 5.2 0.0 0.9 1.3 3.1 0.4 0.0 0.3 3.3 0.7 0.0 2.2 1.7 0.6 9.6 1.6 7.1 0.7 2.1 2.1 2.7 1.0 0.0 1.8 4.0 0.3 8.3 2.0 26.5 1.1 0.0 1.0 2.7 1.0 1.5 0.9 4.0 0.0 0.9 2.0 1.0 0.5 0.5 0.7 1.0 6.5 0.0 4.8 2.9 1.9 2.2 2.0 2.0 0.4 1.6 1.4 3.0 1.4 1.0 12.7 5.2 0.0 2.2 2.2 6.1 0.3 0.5 0.3 10.6 1.0 0.0 3.1 5.2 0.6 5.7 2.4 6.1 1.2 2.6 1.7 2.3 11.5 0.5 7.9 2.9 1.9 2.6 3.6 6.1 0.4 0.0 0.7 2.3 32.9 0.0 1.8 3.5 0.3 2.6 5.4 27.6 2.0 5.7 0.7 3.0 2.9 0.5 6.1 6.3 1.0 30.0 5.4 25.5 1.6 1.6 1.7 17.9 3.1 0.5 8.8 20.1 0.6 8.3 5.9 24.5 6.4 2.6 3.1 7.3 3.6 0.5 18.4 15.5 1.9 5.2 6.6 1.0 0.0 0.5 0.0 0.0 0.0 0.0 0.0 0.0 0.6 4.8 0.5 0.0 0.0 0.0 0.0 0.0 0.2 6.5 0.0 0.6 0.0 0.0 0.5 2.0 0.9 0.0 0.7 0.7 0.0 0.0 0.9 1.7 0.0 0.0 0.6 8.2 0.1 3.6 0.0 0.3 0.0 0.0 0.4 0.0 0.3 0.4 0.6 0.0 0.1 4.2 1.0 0.7 0.7 0.0 1.3 0.6 0.0 0.4 0.7 1.0 2.1 0.0 0.0 0.0 0.2 1.0 0.4 0.6 0.0 0.4 0.7 3.1 0.4 0.0 0.3 0.3 0.5 3.0 0.9 1.2 0.3 1.3 0.8 4.1 1.7 0.0 1.0 0.7 0.0 0.0 0.4 0.6 0.0 0.0 0.8 2.0 0.5 2.6 0.0 0.0 0.7 0.0 1.8 1.2 0.6 1.3 0.8 0.0 0.1 1.0 0.7 0.0 0.7 6.0 3.5 2.3 0.0 0.4 1.0 1.0 0.5 0.5 0.7 0.7 0.5 0.0 1.8 2.9 0.6 5.2 1.1 3.1 2.4 1.0 0.0 0.7 0.0 0.0 4.4 2.9 1.0 1.3 1.4 5.1 0.5 1.0 1.4 1.7 1.0 0.0 3.5 4.6 0.6 3.0 1.5 1.0 3.3 1.0 0.0 0.7 0.0 9.0 0.4 0.0 0.0 1.3 1.6 4.1 0.9 3.1 2.4 1.3 0.7 0.0 6.6 3.5 1.0 1.7 1.8 2.0 1.1 1.6 1.4 2.3 1.2 0.0 4.0 6.9 1.6 8.7 2.3 2.0 2.4 1.6 0.0 3.3 0.5 0.5 1.3 0.0 0.3 16.5 2.4 17.4 0.8 2.1 0.3 8.0 1.4 0.0 0.9 4.6 0.3 5.2 2.5 2.0 0.7 3.1 0.7 1.3 1.2 0.5 14.9 6.3 1.0 3.9 2.6 1.0 10.6 1.0 0.0 2.0 0.0 0.0 2.6 2.9 0.3 0.4 3.2 0.0 0.0 0.0 0.0 0.0 52.3 0.0 0.0 0.6 0.0 0.9 6.9 Cell cycle DNA methylationme integrity HIPPO signalling Histone ne modifier MAPK signalling Metabolism NFE2L Other PI(3)K signalling Protein phosphatase Proteolysis Ribosome K signalling Splicing TGF-β signalling TOR signalling anscription or/regulator Wnt/β-catenin signalling BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer MIR142 B4GALT3 EGR3 CRIPAK PRX LIFR AR EPPK1 HGF NPM1 USP9X NCOR1 POLQ ARHGAP35 MALAT1 LRRK2 NOTCH1 NAV3 STK11 MTOR RPL5 RPL22 PTPN11 PPP2R1A NFE2L3 NFE2L2 IDH2 IDH1 TET2 DNMT3A AJUBA CDH1 PCBP1 U2AF1 SF3B1 SPOP KEAP1 FBXW7 HIST1H2BD H3F3C HIST1H1C SOX17 TBL1XR1 AXIN2 CTNNB1 APC ACVR2A SMAD2 ACVR1B TGFBR2 SMAD4 AKT1 PIK3CG TLR4 PIK3R1 PTEN PIK3CA MAPK8IP1 MAP2K4 NRAS BRAF MAP3K1 NF1 KRAS CDKN2C CDKN1A CCND1 CDKN1B CDK12 RB1 CDKN2A FGFR3 KIT FGFR2 EPHB6 PDGFRA ERBB4 EPHA3 FLT3 EGFR ERCC2 RAD21 CHEK2 SMC3 SMC1A BRCA1 BAP1 STAG2 ATR BRCA2 ATRX ATM TP53 EZH2 ASXL1 ARID5B MLL4 KDM6A KDM5C SETBP1 NSD1 SETD2 PBRM1 ARID1A MLL2 MLL3 FOXA2 CEBPA VEZF1 ELF3 SOX9 CBFB PHF6 FOXA1 EIF4A2 WT1 SIN3A TBX3 MECOM RUNX1 TSHZ2 TAF1 CTCF EP300 TSHZ3 GATA3 VHL 0.0 0.1 0.0 0.0 0.0 0.0 2.0 0.0 0.0 0.0 0.0 0.2 0.0 0.1 0.5 0.0 0.0 0.2 0.0 0.0 1.2 0.0 0.9 0.2 1.0 0.3 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.0 0.4 0.3 2.0 0.3 0.0 0.3 1.0 0.5 0.0 5.3 0.0 0.0 0.4 0.7 5.1 0.5 0.5 0.7 1.7 1.2 0.5 0.4 1.2 0.3 1.3 0.9 1.0 0.8 5.2 0.0 2.7 0.5 0.0 0.9 1.7 0.6 1.7 1.2 1.0 0.7 2.1 0.0 2.3 0.5 0.0 1.8 3.5 0.3 3.5 1.2 2.0 0.3 0.0 2.8 2.7 0.7 0.0 3.1 4.0 0.3 3.0 1.4 1.0 0.5 0.0 0.3 2.7 0.2 0.0 10.5 5.8 0.6 1.3 1.7 0.0 0.0 0.0 0.3 0.3 0.0 27.0 0.9 0.0 0.0 0.4 1.8 3.1 1.2 0.0 0.7 4.3 1.0 0.5 5.3 4.6 0.3 6.5 2.1 8.2 3.9 0.5 0.7 3.3 0.7 0.0 2.6 3.5 0.3 1.3 2.2 7.1 0.8 0.5 1.0 4.3 1.2 0.0 5.7 9.2 1.0 3.9 2.4 5.1 0.9 0.5 0.7 3.7 1.2 0.5 4.0 5.8 1.6 10.0 2.5 15.3 1.1 0.0 0.0 6.3 1.9 0.0 9.7 5.8 1.0 0.0 2.7 5.1 0.7 2.6 1.0 5.0 1.4 0.0 6.6 11.5 2.9 3.5 2.8 5.1 0.4 0.0 0.0 19.3 1.0 0.5 3.1 8.1 0.6 1.7 3.1 5.1 1.4 2.1 1.0 7.3 1.4 0.0 21.5 19.0 1.3 5.2 4.6 0.0 0.3 0.0 0.0 0.3 0.2 0.0 8.8 1.7 0.0 0.4 0.9 2.0 1.4 3.6 1.4 1.3 6.0 0.0 7.5 4.6 1.9 5.2 3.0 0.0 0.4 0.0 2.8 0.0 1.4 0.0 0.4 1.2 0.0 0.9 0.7 0.0 0.0 0.0 0.3 0.7 0.5 0.0 0.4 0.0 0.0 10.9 1.0 0.0 0.1 1.0 1.7 0.3 0.2 4.5 2.6 1.7 0.3 0.9 1.0 1.0 0.1 1.6 0.0 1.3 1.2 0.0 1.3 4.6 1.3 8.7 1.5 3.1 0.8 0.0 0.3 1.3 0.2 0.0 0.0 2.3 0.3 1.7 0.8 9.2 0.1 0.0 0.0 5.3 1.2 0.0 2.2 14.9 0.0 5.2 2.3 0.0 0.0 1.6 0.0 0.0 0.0 10.0 0.4 0.0 0.0 0.4 0.8 3.1 0.3 0.0 5.2 0.3 0.5 9.5 0.9 1.2 0.0 0.9 1.5 3.1 0.4 0.0 0.7 0.3 1.9 8.5 3.1 2.3 0.0 2.2 1.6 0.0 0.5 1.0 0.0 1.7 1.2 25.5 4.0 4.0 1.0 1.3 2.8 2.0 0.1 0.0 0.3 6.0 0.5 0.0 0.9 0.0 0.0 0.0 0.8 5.1 7.0 0.5 0.3 1.3 0.5 0.0 1.3 1.7 0.3 3.0 2.5 1.0 0.0 2.6 0.0 0.0 0.2 0.0 0.4 0.0 0.0 0.9 0.3 1.0 0.3 0.5 0.0 1.3 0.0 4.0 2.6 0.0 0.0 0.9 0.8 4.1 1.8 1.0 0.7 0.7 1.0 0.5 2.2 2.3 0.0 2.2 1.3 1.0 0.1 0.0 0.0 1.0 0.0 0.0 0.4 0.6 0.3 6.5 0.7 3.1 0.1 0.0 0.0 4.0 0.5 0.0 17.1 12.1 0.3 1.3 2.6 9.2 0.8 11.4 0.3 5.0 0.2 0.0 1.3 5.2 1.0 11.7 3.0 1.0 0.0 0.0 0.0 1.3 0.0 0.0 0.0 1.2 0.3 2.6 0.4 0.0 0.0 0.0 0.7 0.7 0.0 0.0 1.8 1.2 0.0 0.9 0.4 1.0 0.4 1.0 0.7 1.3 0.2 0.0 0.4 0.6 1.3 0.0 0.6 0.0 0.0 0.5 0.3 0.3 0.0 0.0 0.4 0.0 0.0 3.0 0.3 2.0 1.1 0.0 0.0 1.0 0.7 0.0 2.2 1.2 0.3 1.3 0.8 3.1 0.1 3.6 0.3 1.7 0.2 0.0 0.9 0.6 0.3 2.6 0.9 2.0 0.1 4.7 0.3 0.7 0.2 0.0 3.5 1.7 0.6 28.3 2.9 4.1 0.5 81.9 0.3 4.0 1.4 0.0 9.2 4.0 2.2 5.7 7.3 1.0 0.5 2.6 0.0 0.7 0.2 0.0 0.9 1.2 0.0 0.4 0.6 1.0 0.5 5.7 0.0 1.0 0.5 0.0 0.9 1.2 0.0 1.3 0.9 0.0 0.7 3.6 0.0 1.3 1.0 0.0 2.2 1.2 0.3 1.7 1.0 3.1 0.4 2.6 0.7 3.0 0.2 0.0 0.9 1.7 1.0 1.3 1.1 2.0 0.4 9.8 0.3 2.0 0.5 0.0 3.1 2.9 0.0 0.0 1.4 0.0 2.5 0.0 0.3 0.7 0.5 0.0 0.0 0.6 0.0 1.3 0.9 2.0 0.4 0.5 2.4 2.7 0.7 0.0 5.3 7.5 1.0 1.3 1.7 2.0 1.2 0.0 0.3 2.0 0.5 0.5 11.4 5.8 1.0 0.4 1.9 1.0 2.5 2.1 11.4 1.7 0.5 0.0 1.3 0.6 0.3 30.9 4.4 3.1 3.8 1.0 30.7 1.3 4.3 0.0 2.2 8.1 0.6 63.5 9.7 17.4 33.6 17.6 11.0 20.6 2.9 0.0 4.4 14.9 0.6 52.2 17.8 2.0 0.3 2.1 0.7 0.7 0.5 0.0 1.8 1.2 0.3 0.4 0.7 0.0 4.1 2.6 0.0 0.3 0.0 0.0 1.3 0.6 0.3 1.3 1.4 2.0 0.1 8.8 0.3 0.0 0.0 7.5 1.8 0.6 0.6 2.6 1.5 2.0 0.4 3.6 2.1 1.0 0.2 0.0 6.6 4.6 0.6 0.9 1.5 3.1 7.2 0.0 2.1 1.0 1.2 0.0 1.8 1.7 0.3 3.5 2.7 7.1 2.5 1.0 11.0 2.7 1.7 1.0 11.8 10.3 3.8 3.5 4.4 0.0 0.8 45.1 0.7 0.3 0.2 4.0 26.3 1.2 0.6 20.0 6.7 0.0 0.0 0.0 1.0 0.0 0.2 0.0 0.0 0.6 0.6 0.0 0.2 12.2 0.0 0.0 0.3 0.0 0.2 0.0 0.4 1.2 0.3 0.0 0.6 2.0 0.1 0.0 0.0 0.3 0.0 0.0 0.9 0.6 0.0 5.2 0.6 2.0 0.9 1.0 0.3 0.7 0.0 0.0 1.8 0.0 0.3 0.9 0.7 4.1 0.9 1.6 0.3 1.7 1.4 0.0 3.1 0.6 2.9 2.2 1.5 14.3 1.8 0.5 8.3 3.0 0.2 0.0 5.3 6.9 1.9 3.9 3.2 4.1 0.0 0.5 0.7 21.3 1.0 0.0 6.6 14.9 0.0 0.4 3.6 8.2 0.1 0.5 1.4 1.7 1.4 0.0 0.4 2.3 0.3 0.4 1.0 1.0 0.5 1.0 1.0 1.0 0.7 4.0 1.8 3.5 1.9 2.2 1.4 2.0 0.9 0.0 0.3 0.7 0.2 0.0 3.1 2.3 0.0 10.4 1.5 3.1 0.4 0.0 1.4 1.3 1.2 0.0 9.7 3.5 0.3 1.7 1.6 6.1 0.4 1.0 3.8 1.0 1.4 0.5 6.6 4.0 1.0 1.3 1.9 2.0 0.8 3.6 0.3 4.3 1.4 0.0 7.5 5.2 0.0 2.6 2.1 1.0 0.5 3.1 1.0 3.7 0.5 0.5 8.8 6.3 1.0 2.2 2.1 2.0 0.4 0.0 1.7 0.7 0.5 26.5 4.0 4.0 1.0 0.9 2.7 1.0 0.7 1.6 26.6 4.7 1.7 1.0 11.4 2.9 1.9 1.3 4.6 12.2 0.1 0.5 0.0 0.3 0.2 0.0 1.3 0.0 0.3 0.4 0.7 2.0 0.5 1.0 0.3 1.0 0.0 2.5 2.6 1.2 0.3 0.9 0.9 2.0 0.4 0.0 1.7 2.3 0.7 0.0 0.9 1.2 0.3 1.3 0.9 1.0 0.4 0.0 1.4 1.7 1.2 3.5 2.6 2.3 0.3 0.4 1.2 3.1 0.8 1.6 1.7 1.0 0.5 3.5 1.3 0.6 1.3 4.4 1.5 4.1 1.6 0.0 1.0 2.7 1.0 0.0 3.5 5.2 3.5 0.9 1.9 4.1 0.3 0.0 0.7 1.0 10.1 0.0 1.3 0.6 0.6 2.2 2.0 10.2 0.9 1.0 4.1 0.7 1.7 3.0 2.6 3.5 1.0 3.9 2.2 4.1 0.8 2.1 1.4 5.3 1.2 0.0 5.7 4.0 0.6 7.0 2.4 6.1 1.7 1.6 1.4 3.7 1.9 0.0 5.7 5.8 3.2 4.4 2.7 8.2 1.2 1.0 5.5 4.3 1.9 0.0 6.1 5.8 0.6 3.0 2.8 11.2 2.1 5.7 1.4 2.7 2.9 0.0 7.9 4.0 1.3 6.5 3.3 50.0 32.9 58.6 28.3 69.8 2.2 7.5 51.8 79.3 94.6 27.8 42.0 1.0 0.1 0.0 1.0 0.3 0.7 1.5 2.2 2.3 0.0 1.7 0.8 3.1 0.4 1.6 0.0 3.0 1.0 2.5 1.3 5.2 0.0 0.9 1.3 3.1 0.4 0.0 0.3 3.3 0.7 0.0 2.2 1.7 0.6 9.6 1.6 7.1 0.7 2.1 2.1 2.7 1.0 0.0 1.8 4.0 0.3 8.3 2.0 26.5 1.1 0.0 1.0 2.7 1.0 1.5 0.9 4.0 0.0 0.9 2.0 1.0 0.5 0.5 0.7 1.0 6.5 0.0 4.8 2.9 1.9 2.2 2.0 2.0 0.4 1.6 1.4 3.0 1.4 1.0 12.7 5.2 0.0 2.2 2.2 6.1 0.3 0.5 0.3 10.6 1.0 0.0 3.1 5.2 0.6 5.7 2.4 6.1 1.2 2.6 1.7 2.3 11.5 0.5 7.9 2.9 1.9 2.6 3.6 6.1 0.4 0.0 0.7 2.3 32.9 0.0 1.8 3.5 0.3 2.6 5.4 27.6 2.0 5.7 0.7 3.0 2.9 0.5 6.1 6.3 1.0 30.0 5.4 25.5 1.6 1.6 1.7 17.9 3.1 0.5 8.8 20.1 0.6 8.3 5.9 24.5 6.4 2.6 3.1 7.3 3.6 0.5 18.4 15.5 1.9 5.2 6.6 1.0 0.0 0.5 0.0 0.0 0.0 0.0 0.0 0.0 0.6 4.8 0.5 0.0 0.0 0.0 0.0 0.0 0.2 6.5 0.0 0.6 0.0 0.0 0.5 2.0 0.9 0.0 0.7 0.7 0.0 0.0 0.9 1.7 0.0 0.0 0.6 8.2 0.1 3.6 0.0 0.3 0.0 0.0 0.4 0.0 0.3 0.4 0.6 0.0 0.1 4.2 1.0 0.7 0.7 0.0 1.3 0.6 0.0 0.4 0.7 1.0 2.1 0.0 0.0 0.0 0.2 1.0 0.4 0.6 0.0 0.4 0.7 3.1 0.4 0.0 0.3 0.3 0.5 3.0 0.9 1.2 0.3 1.3 0.8 4.1 1.7 0.0 1.0 0.7 0.0 0.0 0.4 0.6 0.0 0.0 0.8 2.0 0.5 2.6 0.0 0.0 0.7 0.0 1.8 1.2 0.6 1.3 0.8 0.0 0.1 1.0 0.7 0.0 0.7 6.0 3.5 2.3 0.0 0.4 1.0 1.0 0.5 0.5 0.7 0.7 0.5 0.0 1.8 2.9 0.6 5.2 1.1 3.1 2.4 1.0 0.0 0.7 0.0 0.0 4.4 2.9 1.0 1.3 1.4 5.1 0.5 1.0 1.4 1.7 1.0 0.0 3.5 4.6 0.6 3.0 1.5 1.0 3.3 1.0 0.0 0.7 0.0 9.0 0.4 0.0 0.0 1.3 1.6 4.1 0.9 3.1 2.4 1.3 0.7 0.0 6.6 3.5 1.0 1.7 1.8 2.0 1.1 1.6 1.4 2.3 1.2 0.0 4.0 6.9 1.6 8.7 2.3 2.0 2.4 1.6 0.0 3.3 0.5 0.5 1.3 0.0 0.3 16.5 2.4 17.4 0.8 2.1 0.3 8.0 1.4 0.0 0.9 4.6 0.3 5.2 2.5 2.0 0.7 3.1 0.7 1.3 1.2 0.5 14.9 6.3 1.0 3.9 2.6 1.0 10.6 1.0 0.0 2.0 0.0 0.0 2.6 2.9 0.3 0.4 3.2 0.0 0.0 0.0 0.0 0.0 52.3 0.0 0.0 0.6 0.0 0.9 6.9 Nature. 2013 Oct 17;502(7471):333-9. Mutational landscape and significance across 12 major cancer types. Kandoth C et. al. • 120가지의 주요 암 유전자들이 12가지 주요 암종에서 유전 변이가 발견되는 빈도를 총 3,281 환자 샘플(TCGA) 에서 조사
  • 27.
  • 28. NCCN Guidelines Index NSCLC Table of Contents Discussion Version 4.2014, 06/05/14 © National Comprehensive Cancer Network, Inc. 2014, All rights reserved. The NCCN Guidelines® and this illustration may not be reproduced in any form without the express written permission of NCCN® . UPDATES NCCN Guidelines Version 4.2014 Updates Non-Small Cell Lung Cancer Updates in the 1.2014 version of the Guidelines for Non-Small Cell Lung Cancer from the 2.2013 version include: NSCL-6 • • Surgery as initial treatment, margins positive: R1 resection separated out with the following recommendations: resection + chemotherapy or chemoradiation (sequential or concurrent). R2 resection separated out with the following recommendations: resection + chemotherapy or concurrent chemoradiation. NSCL-8 • T1-3, N0-1: unresectable changed to medically inoperable. • Surgery as initial treatment, margins positive: R1 resection separated out with the following recommendations: chemoradiation (sequential or concurrent). R2 resection separated out with the following recommendations: concurrent chemoradiation. • Footnote “s” is new to the page: Patients likely to receive adjuvant chemotherapy may be treated with induction chemotherapy as an alternative. NSCL-9 • Surgery as initial treatment, margins positive: R1 resection separated out with the following recommendations: chemoradiation (sequential or concurrent). R2 resection separated out with the following recommendations: concurrent chemoradiation. NSCL-10 • (eg, small subsolid nodules with slow growth). However, if the lesion(s) becomes symptomatic or becomes high risk for producing symptoms (eg, subsolid nodules with accelerating growth or increasing solid component or increasing FDG uptake, even while small), treatment should be considered. NSCL-13 • T1-2, N0-1; T3, N0: SABR of the lung lesion added as a treatment option after chemotherapy. NSCL-14 • H&P and chest CT recommendations in surveillance changed from a category 2B to a category 2A. NSCL-15 • Mediastinal lymph node recurrence: treatment recommendations listed according to prior treatment with RT. If patients received prior RT, the recommendation of systemic chemotherapy added. NSCL-16 • Establish histologic subtype with adequate tissue for molecular testing: “consider rebiopsy if appropriate” added. • “Integrate palliative care” added with footnote “b”. A link to the NCCN Guidelines for Palliative Care added. • Adenocarcinoma, large cell, NSCLC NOS; the following added: Category 1 added to ALK testing. EGFR ± ALK testing should be conducted as part of a multiplex/next-generation sequencing. • Consider EGFR mutation and ALK testing are not routinely recommended except especially in never smokers and or small biopsy specimens, or mixed histology. EGFR ± ALK testing should be conducted as part of a multiplex/next-generation sequencing. • Footnote “cc” added with direction to a new page, Targeted Agents for Patients with Other Genetic Alterations (NSCL-H). • EGFR mutation and ALK negative: “or unknown” added. Printed by yoon sup choi on 6/19/2014 8:23:15 PM. For personal use only. Not approved for distribution. Copyright © 2014 National Comprehensive Cancer Network, Inc., All Rights Reserved.
  • 29. NCCN Guidelines Version 4.2014 Non-Small Cell Lung Cancer NCCN Guidelines Index NSCLC Table of Contents Discussion Version 4.2014, 06/05/14 © National Comprehensive Cancer Network, Inc. 2014, All rights reserved. The NCCN Guidelines® and this illustration may not be reproduced in any form without the express written permission of NCCN® . Note: All recommendations are category 2A unless otherwise indicated. Clinical Trials: NCCN believes that the best management of any cancer patient is in a clinical trial. Participation in clinical trials is especially encouraged. NSCL-16 aSee Principles of Pathologic Review (NSCL-A). bTemel JS, Greer JA, Muzikansky A, et al. Early palliative care for patients with metastatic non-small-cell lung cancer. N Engl J Med 2010;363:733-742. ccSee Targeted Agents for Patients with Other Genetic Alterations (NSCL-H). ddIn patients with squamous cell carcinoma, the observed incidence of EGFR mutations is 2.7% with a confidence that the true incidence of mutations is less than 3.6%. This frequency of EGFR mutations does not justify routine testing of all tumor specimens. Forbes SA, Bharma G, Bamford S, et al. The catalogue of somatic mutations in cancer (COSMIS). Curr Protoc Hum Genet 2008;chapter 10:unit 10.11. eePaik PK, Varghese AM, Sima CS, et al. Response to erlotinib in patients with EGFR mutant advanced non-small cell lung cancers with a squamous or squamous-like component. Mol Cancer Ther 2012;11:2535-2540. ffConsider ROS1 testing; if positive, may treat with crizotinib. Bergethon K, Shaw AT, Ou SH, et al. ROS1 rearrangements define a unique molecular class of lung cancers. J Clin Oncol 2012;30:863-870. SYSTEMIC THERAPY FOR METASTATIC DISEASE HISTOLOGIC SUBTYPE Metastatic Disease • Establish histologic subtypea with adequate tissue for molecular testing (consider rebiopsy if appropriate) • Smoking cessation counseling • Integrate palliative careb (See NCCN Guidelines for Palliative Care) • Adenocarcinoma • Large Cell • NSCLC not otherwise Squamous cell carcinoma • EGFR mutation testinga (category 1)a • ALK testing (category 1)a • EGFR ± ALK testing should be conducted as part of multiplex/next-generation sequencingcc • Consider EGFR mutation and ALK testingdd especially in never smokers or small biopsy specimens, or mixed histologyee • EGFR ± ALK testing should be conducted as part of multiplex/next- generation sequencingcc Sensitizing EGFR mutation positive ALK positive Sensitizing EGFR mutation and ALK negative or unknownff See First-Line Therapy (NSCL-17) See First-Line Therapy (NSCL-18) See First-Line Therapy (NSCL-19) See First-Line Therapy (NSCL-20) Printed by yoon sup choi on 6/19/2014 8:23:15 PM. For personal use only. Not approved for distribution. Copyright © 2014 National Comprehensive Cancer Network, Inc., All Rights Reserved.
  • 30. Implementing Personalize Oncology the case of Foundation Medicine
  • 31. Analyzed cancer genome in 2011 spending $100,000 at Broad Institute
  • 32. • 암환자의 FFPE 시료를 이용, 315 개의 암 관련 ‘actionable gene’ 변이를 한 번에 분석 • 이를 기반으로, 환자의 유전자 변이를 표적으로 하는 치료제 정보를 의사에게 제공 • Broad Institute 에서 spin-off , GoogleVentures와 빌게이츠 투자 • 2012년에 서비스를 시작, 2013년 9월에 나스닥 IPO • 분석 가격: $5,800 • 2014년 3사 분기: 6,428 회 분석 (149% 성장), 2014년 22,000-25,000 회 분석 예상 http://www.foundationmedicine.com/
  • 33. ©2013NatureAmerica,Inc.Allrig sensitivity, specificity, accuracy and precision across the reportable range of the assay, in line with guidelines established by the Next Generation Sequencing: Standardization of Clinical Testing work- group25. Relevant sample types were represented, including FFPE. Base substitutions, indels, focal gene amplifications and homozygous gene deletions were tested. We report our experience with the first 2,221 patient tumor FFPE specimens submitted to our Clinical Laboratory Improvement Amendments (CLIA)-certified and College In contrast to diagnostic assays for a limited number of genomic sites, analytical validation of an NGS-based genomic profiling test assaying ~1.5 Mb of target sequence is a complex challenge. A single tumor spec- imen can harbor multiple types of genomic alterations, at any position in the tested region, at a wide range of mutant allele frequencies (MAF) or copy number levels. Reference specimens containing all possible somatic alterations in all cancer-related genes do not exist. We therefore developed a representative validation approach with reference samples a b c dFFPE tumor sample Sequencing library preparation Analysis pipeline Clinical report OR Genomic DNA Sequencing library Biotinylated DNA baits Hybridization capture DNA Extraction Sequencing Base substitutions Bayesian algorithm Short insertions/deletions Local assembly Copy number alterations Comparison with process- matched normal control Gene fusions Analysis of chimeric read pairs Analysis & interpretation Sample requirements Surface area: ≥25 mm2 Sample volume: ≥1 mm3 Nucleated cellularity: ≥80% or ≥30,000 cells Tumor content: ≥20% Fraction of patients with tissue insufficient for analysis: 10–15% Laboratory process highlights Requires ≥50 ng of dsDNA (quantified by PicoGreen) Fragmentation by sonication (Covaris) and ‘with-bead’ library construction Hybridization capture with biotinylated DNA oligonucleotides 49 × 49 paired-end sequencing on the Illumina HiSeq platform to >500× average unique coverage, with >100× at >99% of exons Analysis methods highlights Sensitivity to variants present at any mutant allele frequency Detection of long (1–40 bp) indel variants using de Bruijn graph–based local assembly CGH-like analysis of read- depth for CNAs assessment Reporting approach Interpretation without a matched normal Germline variants from 1000 Genomes Project (dbSNP135) removed Known driver alterations (COSMIC v62) highlighted as biologically significant A concise summary of the biomedical literature and current clinical trials is provided for each highlighted alteration Figure 1 NGS-based cancer genomic profiling test workflow. (a) DNA is extracted from routine FFPE biopsy or surgical specimens. (b) 50–200 ng of DNA undergoes whole-genome shotgun library construction and hybridization-based capture of 4,557 exons of 287 cancer-related genes and 47 introns of 19 genes frequently rearranged in solid tumors. Hybrid-capture libraries are sequenced to high depth using the Illumina HiSeq2000 platform. (c) Sequence data are processed using a customized analysis pipeline designed to accurately detect multiple classes of genomic alterations: base substitutions, short insertions/deletions, copy-number alterations and selected gene fusions. (d) Detected mutations are annotated according to clinical significance and reported. Nat Biotechnol. 2013 Nov;31(11):1023-31. NGS-based cancer genomic profiling test workflow
  • 34. 315 cancer related genes & introns from 28 genes often rearranged or altered in cancer Current as of August 4, 2014 th high accuracy. The test simultaneously sequences anged or altered in cancer to a typical median depth of ter than 500X. Each covered read represents a unique tions that occur at low frequencies due to tumor w tumor purity and small tissue samples. FoundationOne s of genomic alterations, including base substitutions, letions (indels), copy number alterations (CNAs) and using a small, routine FFPE sample (including core or rovided in an interpretive report, both in hard copy and 4 ation is found in any one of the genes on the current ort will identify the gene and alteration and will provide an on the front page of the report are found to have one or evant alterations. All other genes are not found to have vant alterations. In some cases, pertinent negatives the front of the report; these are genes that have no ancer, EGFR in lung cancer). The complete list of genes ppears in the “Current Gene List” table to the right, in the ation is detected in one of the genes included on in the report so that they may be acted upon in the clinical evidence emerge. of the estimated tumor DNA. One Includes Genes That Are Commonly n All Solid Tumors l classes of actionable alterations, including those in One report often reveals alterations that may lead to ent options for physicians and their patients to consider. *As measured from the date the Foundation Medicine laboratory receives a sample that meets requirements. Current Gene List4 clinical literature. CURRENT GENE LIST FANCC GATA3 MITF STAT4 GATA4 JAK3 PDGFRA RET STK11 CIC FANCE GATA6 JUN MPL RICTOR SUFU AKT1 FANCF GID4 (C17orf39) KAT6A (MYST3) MRE11A PDK1 RNF43 SYK CRKL FANCG GLI1 KDM5A ROS1 TAF1 AKT3 FANCL GNA11 KDM5C PIK3CA RPTOR ALK CSF1R FAS GNA13 KDM6A MTOR RUNX1 TERC AMER1 C11orf30 (EMSY) CTCF FAT1 GNAQ KDR PIK3CG RUNX1T1 TERT (promoter only) APC CARD11 CTNNA1 GNAS KEAP1 MYC PIK3R1 AR FGF10 KEL MYCL (MYCL1) ARAF CUL3 FGF14 KIT MYCN TNFAIP3 ARFRP1 CCND1 CYLD FGF19 GRM3 TNFRSF14 ARID1A DAXX (MLL) NF1 POLD1 TOP1 CCND3 FGF3 (MLL3) POLE CCNE1 DICER1 FGF4 TP53 ASXL1 DNMT3A FGF6 KRAS PRDM1 TSC1 ATM CD79A DOT1L FGFR1 LMO1 SMAD3 ATR EGFR PRKAR1A SMAD4 ATRX CDC73 EP300 FGFR3 LYN PRKCI SMARCA4 AURKA FGFR4 LZTR1 PRKDC VEGFA NPM1 SMO AXIN1 CDK4 FLCN IGF1R NRAS SNCAIP AXL CDK6 FLT1 NSD1 PTEN SOCS1 FLT3 NTRK1 PTPN11 SOX10 XPO1 CDKN1A FLT4 IKZF1 MAP3K1 QKI IL7R MCL1 NTRK3 RAC1 SOX9 ERG FOXP1 NUP93 RAD50 SPEN ZNF703 ERRFI1 MDM4 PAK3 RAD51 SPOP ESR1 RAF1 SPTA1 IRF4 SRC FAM46C GATA1 MEN1 PAX5 RARA FANCA JAK1 MET STAT3 SELECT REARRANGEMENTS ALK ETV4 FGFR1 KIT MYC RARA EGFR ETV5 PDGFRA RET ETV1 ETV6 FGFR3 NTRK1 RAF1 ROS1 1 and established the performance - ndationOne. This updated version of FoundationOne met these performance -
  • 35. e anatomic Increasingly, c alterations, ns, cancer pes of us drivers equences an depth of s a unique mor undationOne stitutions, Technical Information Base Substitutions1 Indels1 Copy Number Alterations1 Rearrangements Sensitivity >99% MAF 5% >97% MAF 10% >95% CN 8 or 0 30% tumor nuclei 2 >99% for ALK fusion3 20% tumor nuclei >99% >99% >99% >99% (each covered read is of a unique DNA fragment to enable detection of alterations at low frequency) 5001 14 day average* *As measured from the date the Foundation Medicine laboratory receives a sample that meets requirements. Technical Information and Test Overview Current Gene List4 Technical Information of FoundationOne
  • 36. Number of Samples 441 Number of failed samples 4% (16) Number of samples analyzed 96% (425) Number of samples  analyzed with at least one actionable alteration 77% (325) Number of samples analyzed with at least one actionable alteration not detectable by hotspot tests1 59% (251) Number of alterations per analyzed sample 2.74 (range 0-9) Number of actionable alterations per analyzed sample 1.40 (range 0-5) Actionability for Cancer Samples • At least one actionable alteration was found from 77% of samples. • On average,1.4 actionable alterations was found from one sample.
  • 37. Lung Breast Colorectal Number of samples 82 70 44 Number of failed samples 5% (4) 4% (3) 0% (0) Number of samples analyzed 95% (78) 86% (67) 100% (44) Samples with at least one actionable alteration 86% (67) 85% (57) 86% (38) Alterations per sample 2.7 (range 0-6) 2.9 (range 0-7) 3.8 (range 1-7) Actionable alterations per sample 1.6 (range 0-5) 1.6 (range 0-4) 1.5 (range 0-3) Actionability for Lung, Colon, and Breast Cancers was High The three major tumor subtypes, lung, breast, and colorectal, accounted for 196 out of the 441 samples (44%). The percentage of samples with at least one actionable alteration was 86%, 85%, and 86% respectively.
  • 38. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 1 of 11 Date of Birth 09 August 1948 Client ASAN Medical Center Specimen Received 04 February 2013 Gender Male Ordering Physician Kim, Kyu-pyo Specimen Site Lymph Node FMI Case # TRF007878 Additional Recipient C. Anthony Blau Date of Collection 04 January 2013 Medical Record # Not Given FMI Client # 200535 Specimen Type Slide Specimen ID S-13-132 A Pathologist Sejin Jang ABOUT THE TEST: FoundationOne™ is a next-generation sequencing (NGS) based assay which identifies genomic alterations within hundreds of cancer-related genes. PATIENT RESULTS TUMOR TYPE: SOFT TISSUE SARCOMA (NOS) 7 genomic alterations Genomic Alterations Identified† NF2 W74* CCND2 amplification KRAS G13D, amplification TP53 R282W FGF23 amplification FGF6 amplification 3 therapies associated with potential clinical benefit 0 therapies associated with lack of response 6 clinical trials † For a complete list of the genes assayed, please refer to the Appendix THERAPEUTIC IMPLICATIONS Genomic Alterations Detected FDA Approved Therapies (in patient’s tumor type) FDA Approved Therapies (in another tumor type) Potential Clinical Trials NF2 W74* None Everolimus Lapatinib Temsirolimus Yes, see clinical trials section CCND2 amplification None None Yes, see clinical trials section KRAS G13D, amplification None None Yes, see clinical trials section TP53 R282W None None None FGF23 amplification None None None FGF6 amplification None None None Note: Genomic alterations detected may be associated with activity of certain FDA approved drugs; however, the agents listed in this report may have varied clinical evidence in the patient’s tumor type. Neither the therapeutic agents nor the trials identified are ranked in order of potential or predicted efficacy for this patient, nor are they ranked in order of level of evidence for this patient’s tumor type. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 2 of 11 GENOMIC ALTERATIONS GENE ALTERATION INTERPRETATION NF2 W74* Merlin, encoded by NF2, functions by coordinating signaling of receptor tyrosine kinases (RTKs) such as the epidermal growth factor receptor (Egfr) with cell contact (Curto and McClatchey, 2008; 17971776). The inactivation of Merlin in cancer disrupts this mechanism and leads to unrestrained RTK signaling despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. KRAS G13D, amplification The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; 22016105, Feldmann et al., 2007; 17520196, Han et al., 2011; 22011285). Activating mutations in RAS genes can cause uncontrolled cell proliferation and tumor formation (Pylayeva-Gupta et al., 2011; 21993244, Kahn et al., 1987; 3310850). The G13D mutation lies within the first "G box" domain of the KRAS protein, one of several conserved regions (Colicelli, 2004; 15367757). Disruption of this region creates a protein that is defective for GTP hydrolysis and therefore constitutively active. KRAS alterations have been reported variously from 0-44% in soft tissue sarcoma (COSMIC, The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013), perhaps dependent on country of origin (Yoo et al., 1999; 10463479, Yoo and Robinson, 1999; 10391564, Barretina et al., 2010; 20601955, Jin et al., 2010; 20150643). KRAS amplification has been reported in 4/207 (2%) soft tissue sarcomas in the Sarcoma Genome Project dataset (The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013). Constitutive activation of KRAS leads to activation of the RAF/MEK/ERK pathway, leading to tumorigenesis (Pylayeva-Gupta et al., 2011; 21993244). Therefore, tumors with activating mutations in KRAS may be sensitive to inhibitors of this pathway. Both the KRAS-targeting reovirus Reolysin and specific MEK inhibitors are under investigation for tumors bearing KRAS mutations. Activating mutations in KRAS have been associated with resistance to Egfr inhibitors in colorectal carcinoma; however, this relationship has not been a significant subject of study in soft tissue sarcoma (Lièvre et al., 2006; 16618717, De Roock et al., 2011; 21163703). Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 4 of 11 THERAPIES There are no therapies FDA approved in this patient's tumor type that are specific to the reported genomic alterations. ADDITIONAL THERAPIES – FDA APPROVED IN OTHER TUMOR TYPES THERAPY RATIONALE Everolimus Everolimus is an orally available mTOR inhibitor that has been approved for use in renal cell carcinoma, pancreatic neuroendocrine tumors, subependymal giant cell astrocytoma associated with TSC, and hormone receptor positive, HER2 negative advanced breast cancer. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to everolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Everolimus is currently being tested in clinical trials in several tumor types. A Phase 1 trial of everolimus and figitumumab, an IGF-1R inhibitor, in sarcomas and other solid tumors showed that the combination was safe and well- tolerated, with a partial response in 1/18 patients and stable disease in 15/18 patients (Quek et al., 2011; 21177764). Lapatinib Lapatinib is a dual tyrosine kinase inhibitor, targeting both Egfr and Her2 (Erbb2). It has been approved for use in metastatic breast cancer. Mutation of NF2 may lead to Egfr and/or Erbb2 activation; lapatinib inhibits Egfr and Erbb2 and has shown preclinical activity in NF2 deficient vestibular schwannoma (Ammoun et al., 2010; 20511180). Lapatinib is currently in clinical trials in multiple solid tumor types. Temsirolimus Temsirolimus is an intravenous mTOR inhibitor that has been approved for use in advanced renal cell carcinoma. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to temsirolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Temsirolimus is currently being tested in clinical trials in several tumor types. A Phase 2 trial of temsirolimus as single agent in soft tissue sarcoma reported limited efficacy and moderate toxicity, with a partial response exhibited in 2 of 40 evaluable patients (Okuno et al., 2011; 21287536). A Phase 1 trial of temsirolimus combined with liposomal doxorubicin in recurrent and refractory bone and soft tissue sarcoma patients reported that the combination treatment is safe and demonstrates sufficient preliminary efficacy to pursue the Phase 2 portion of the study (Thornton et al., 2013; 23382028). Genomic alterations detected may be associated with activity of certain FDA approved drugs, however the agents listed in this report may have little or no evidence in the patient’s tumor type Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 5 of 11 CLINICAL TRIALS TO CONSIDER IMPORTANT: While every effort is made to ensure the accuracy of the information contained below, the information available in the public domain is continuously updated and should be investigated by the physician or research staff. This is not meant to be a complete list of available trials. In order to conduct a more thorough search, please go to www.clinicaltrials.gov and use the search terms provided below. For more information about a specific clinical trial, type the NCT ID of the trial indicated below into the search bar. GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS NF2 W74* Mutation or loss of NF2 results in the dysregulation of RTK and mTOR signaling. Therefore, RTK or mTOR inhibitors may be relevant for patients with NF2 mutations. A search of the trial website clinicaltrials.gov, using terms such as “NF2”, "lapatinib", "mTOR" and/or "solid tumor" retrieves more than 10 trials that may be relevant for this patient's tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID An Open-label, Multi-center Phase I Dose- finding Study of RAD001 (Everolimus, Afinitor®) in Combination With BEZ235 in Patients With Advanced Solid Tumors Phase 1 MTOR, PI3K Missouri, Auckland (New Zealand), Barcelona (Spain), Bordeaux Cedex (France), Montpellier Cedex 5 (France), Newcastle Upon Tyne (United Kingdom), Seoul (Korea, Republic of), Verona (Italy), Wilrijk (Belgium) NCT01482156 A Phase I Study of the HER1, HER2 Dual Kinase Inhibitor, Lapatinib Plus the Proteosomal Inhibitor Bortezomib in Patients With Advanced Malignancies Phase 1 EGFR, Her2/neu, proteasome District of Columbia NCT01497626
  • 39. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 1 of 11 Date of Birth 09 August 1948 Client ASAN Medical Center Specimen Received 04 February 2013 Gender Male Ordering Physician Kim, Kyu-pyo Specimen Site Lymph Node FMI Case # TRF007878 Additional Recipient C. Anthony Blau Date of Collection 04 January 2013 Medical Record # Not Given FMI Client # 200535 Specimen Type Slide Specimen ID S-13-132 A Pathologist Sejin Jang ABOUT THE TEST: FoundationOne™ is a next-generation sequencing (NGS) based assay which identifies genomic alterations within hundreds of cancer-related genes. PATIENT RESULTS TUMOR TYPE: SOFT TISSUE SARCOMA (NOS) 7 genomic alterations Genomic Alterations Identified† NF2 W74* CCND2 amplification KRAS G13D, amplification TP53 R282W FGF23 amplification FGF6 amplification 3 therapies associated with potential clinical benefit 0 therapies associated with lack of response 6 clinical trials † For a complete list of the genes assayed, please refer to the Appendix THERAPEUTIC IMPLICATIONS Genomic Alterations Detected FDA Approved Therapies (in patient’s tumor type) FDA Approved Therapies (in another tumor type) Potential Clinical Trials NF2 W74* None Everolimus Lapatinib Temsirolimus Yes, see clinical trials section CCND2 amplification None None Yes, see clinical trials section KRAS G13D, amplification None None Yes, see clinical trials section TP53 R282W None None None FGF23 amplification None None None FGF6 amplification None None None Note: Genomic alterations detected may be associated with activity of certain FDA approved drugs; however, the agents listed in this report may have varied clinical evidence in the patient’s tumor type. Neither the therapeutic agents nor the trials identified are ranked in order of potential or predicted efficacy for this patient, nor are they ranked in order of level of evidence for this patient’s tumor type.
  • 40. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 2 of 11 GENOMIC ALTERATIONS GENE ALTERATION INTERPRETATION NF2 W74* Merlin, encoded by NF2, functions by coordinating signaling of receptor tyrosine kinases (RTKs) such as the epidermal growth factor receptor (Egfr) with cell contact (Curto and McClatchey, 2008; 17971776). The inactivation of Merlin in cancer disrupts this mechanism and leads to unrestrained RTK signaling despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. KRAS G13D, amplification The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; 22016105, Feldmann et al., 2007; 17520196, Han et al., 2011; 22011285). Activating mutations in RAS genes can cause uncontrolled cell proliferation and tumor formation (Pylayeva-Gupta et al., 2011; 21993244, Kahn et al., 1987; 3310850). The G13D mutation lies within the first "G box" domain of the KRAS protein, one of several conserved regions (Colicelli, 2004; 15367757). Disruption of this region creates a protein that is defective for GTP hydrolysis and therefore constitutively active. KRAS alterations have been reported variously from 0-44% in soft tissue sarcoma (COSMIC, The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013), perhaps dependent on country of origin (Yoo et al., 1999; 10463479, Yoo and Robinson, 1999; 10391564, Barretina et al., 2010; 20601955, Jin et al., 2010; 20150643). KRAS amplification has been reported in 4/207 (2%) soft tissue sarcomas in the Sarcoma Genome Project dataset (The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013). Constitutive activation of KRAS leads to activation of the RAF/MEK/ERK pathway, leading to tumorigenesis (Pylayeva-Gupta et al., 2011; 21993244). Therefore, tumors with activating mutations in KRAS may be sensitive to inhibitors of this pathway. Both the KRAS-targeting reovirus Reolysin and specific MEK inhibitors are under investigation for tumors bearing KRAS mutations. Activating mutations in KRAS have been associated with resistance to Egfr inhibitors in colorectal carcinoma; however, this relationship has not been a significant subject of study in soft tissue sarcoma (Lièvre et al., 2006; 16618717, De Roock et al., 2011; 21163703).
  • 41. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) GENOMIC ALTERATIONS GENE ALTERATION INTERPRETATION NF2 W74* Merlin, encoded by NF2, functions by coordinating signaling of receptor tyrosine kinases (RTKs) such as the epidermal growth factor receptor (Egfr) with cell contact (Curto and McClatchey, 2008; 17971776). The inactivation of Merlin in cancer disrupts this mechanism and leads to unrestrained RTK signaling despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; • 유전자(단백질)의 기능 및 암 발병에서 메커니즘 소개 • NF2 유전자에서 나오는 Merlin은 EGFR과 같은 RTKs를 조절하는 기능을 가짐 • Merlin의 비활성화는 이런 메커니즘을 망가뜨려, RTKs 신호를 조절하지 못하게 됨 • 유전 변이가 단백질/메커니즘에 어떠한 영향을 미치는지 설명 • NF2 의 W74*는 Merlin의 premature termination을 통해 단백질의 비활성화를 야기함 • 유전 변이가 해당 암종에 대해 DB/논문에 어떻게 보고 되어 있는지 설명 • cBio Cancer Genomics Portal: 207개의 sarcoma 샘플에는 NF2 loss 데이터는 없음 • Quezado et al.: Epithelial sarcoma 에서 NF2가 위치한 염색체의 loss of heterozygosity 가 보고된 바 있음 • COSMIC: NF2의 변이(W74* ?)가 41%의 soft tissue tumor 에서 보고된 바 있으며, 샘플의 대부분은 schwannoma • 유전 변이에 효과가 있는 약물 (승인/임상)에 대한 간략한 소개 • NF2 loss 변이를 직접 표적으로 하는 승인 받은 약은 없음 • 전임상 결과에 따르면 TKI lapatinib과 mTOR 저해제가 효과 있을 수도 있음 • Lapatinib과 mTOR 저해제는 다른 암종에 대해서 승인 받았으며, solid tumor에 대하여 임상 중임 • Lapatinib은 NF2 변이 vestibular schwannoma 환자에 대한 임상에서 효능을 보임
  • 42. NF2 W74* despite cell contact (Curto and McClatchey, 2008; 17971776). NF2 W74* results in the premature termination of the 595 amino acid merlin protein, truncating the majority of the protein, and is therefore predicted to be inactivating. Loss of NF2 has not been reported in a collection of 207 sarcoma samples reported in the cBio Cancer Genomics Portal (cbioportal.org, Feb 2013). However, loss of heterozygosity for chromosome 22q (where the NF2 gene resides) has been reported in 6/10 epithelioid sarcomas (Quezado et al., 1998; 9635681). Additionally, NF2 mutations have been reported in 41% (271/669) of all soft tissue tumors analyzed in the COSMIC database (COSMIC, Dec 2012). The majority of those analyzed were schwannoma, which had an NF2 mutation rate of 43% (COSMIC, Dec 2012). At present there are no approved therapies that directly target NF2 loss. However, preclinical studies in models of NF2 loss have suggested that the TKI lapatinib and mTOR inhibitors may be a relevant approach (Ammoun et al., 2010; 20511180, López-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Lapatinib and the mTOR inhibitors everolimus and temsirolimus have received FDA approval in other cancer types and are under clinical investigation in solid tumors. Clinical studies of lapatinib in NF2 patients with progressive vestibular schwannoma reported efficacy (Karajannis et al., 2012; 22844108). CCND2 amplification CCND2 encodes the protein cyclin D2, which binds and regulates the cyclin-dependent kinases that control cell cycle progression, and is a downstream target of cancer signaling pathways including hedgehog and PI-3-kinase (Katoh and Katoh, 2009; 19860666, White et al., 2006; 16301994). CCND2 amplification has been reported in 2.4% of sarcomas (The cBio Cancer Genomics Portal, http://www.cbioportal.org/, Feb 2013) (Höglund et al., 1996; 8547659). CCND2 alterations have not been reported in soft tissue sarcomas in the literature (PubMed, Feb 2013). Overexpression of Cyclin D2 has been reported in several types of sarcomas, including endometrial stromal sarcoma and rhabdomyosarcoma (Davidson et al., 2013; 23178314, Li et al., 2012; 22330340). Loss of expression of Cyclin D2 in stage III NSCLC, but not stage II or IV, has been associated with decreased recurrence free survival (Ko et al., 2012; 22534667). CCND2 expression has been associated with decreased metastasis in one study of 13 metastatic and 18 non-metastatic neuroendocrine tumors (Lee et al., 2012; 22485171). There are no approved therapies that specifically target CCND2 amplification; however, several preclinical studies suggest that cyclin D2 may associate with Cdk4 in cancer cells, and that Cyclin D2- overexpressing cells may be sensitive to Cdk4/6 inhibitors (Decker et al., 2002; 11896535, Cole et al., 2010; 20736363). Clinical trials of Cdk4/6 inhibitors are currently underway in multiple tumor types. KRAS G13D, amplification The KRAS gene is one of the most commonly mutated genes in human malignancies (Farber et al., 2011; 22016105, Feldmann et al., 2007; 17520196, Han et al., 2011; 22011285). Activating mutations in RAS genes can cause uncontrolled cell proliferation and tumor formation (Pylayeva-Gupta et al., 2011; 21993244, Kahn et al., 1987; 3310850). The G13D mutation lies within the first "G box" domain of the KRAS protein, one of several conserved regions (Colicelli, 2004; 15367757). Disruption of this region creates a protein that is defective for GTP hydrolysis and therefore constitutively active. KRAS alterations have been reported variously from 0-44% in soft tissue sarcoma (COSMIC, The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013), perhaps dependent on country of origin (Yoo et al., 1999; 10463479, Yoo and Robinson, 1999; 10391564, Barretina et al., 2010; 20601955, Jin et al., 2010; 20150643). KRAS amplification has been reported in 4/207 (2%) soft tissue sarcomas in the Sarcoma Genome Project dataset (The cBio Cancer Genomics Portal, http://www.cbioportal.org, Feb 2013). Constitutive activation of KRAS leads to activation of the RAF/MEK/ERK pathway, leading to tumorigenesis (Pylayeva-Gupta et al., 2011; 21993244). Therefore, tumors with activating mutations in KRAS may be sensitive to inhibitors of this pathway. Both the KRAS-targeting reovirus Reolysin and specific MEK inhibitors are under investigation for tumors bearing KRAS mutations. Activating mutations in KRAS have been associated with resistance to Egfr inhibitors in colorectal carcinoma; however, this relationship has not been a significant subject of study in soft tissue sarcoma (Lièvre et al., 2006; • 유전자(단백질)의 기능 및 암 발병에서 메커니즘 소개 • CCND2는 cell cycle 조절 단백질인 cyclin-dependent kinase을 조절하는 cyclin D2를 발현 • PI-3-kinase의 cancer signaling pathway 의 downstream target 임 (레퍼런스) • 유전 변이가 해당 암종에 대해 DB/논문에 어떻게 보고 되어 있는지 설명 • cBio Cancer Genomics Portal: sarcomas의 2.4%에서 CCND2 amplification이 보고 됨 • 논문 • CCND2 변이가 sarcomas와 관련하여 논문에서 보고된 바 없음 • Cyclin D2의 과발현은 몇가지 종류의 sarcomas에 대하여 보고된 바 있음 (레퍼런스) • 유전 변이가 단백질/메커니즘에 어떠한 영향을 미치는지 설명 • Cyclin D2의 발현저하는 NSCLC stage III에서 생존률을 떨어뜨림 (레퍼런스) • CCND2의 발현은 13 metastatic & 18 non-metastatic neuroendocrine tumors의 전이성 저하에 • 유전 변이에 효과가 있는 약물 (승인/임상)에 대한 간략한 소개 • CCND2 amplification을 타겟으로 하는 승인 받은 약물은 없음 • 몇몇 preclinical study가 cyclin D2가 CDK4와 관련이 있고, CDK4/6 저해제에 효과가 있을 수도 있음 • CDK4/6 저해제는 몇몇 암종에 대하여 임상 시험이 진행 중임
  • 43. • 유전자(단백질)의 기능 및 암 발병에서 메커니즘 소개 • ARID1A는 SWI/SNF chromatin remodeling complex의 단백질을 encoding 함 • ARID1A 는 tumor suppressor 로 생각되며, 이 유전자의 deletion이나 비활성화는 종양 형성을 유발 • 유전 변이가 단백질/메커니즘에 어떠한 영향을 미치는지 설명 • ARID1A Q633* 는 단백질의 premature truncation을 유도하며, PPI에 중요한 LXXLL motifs의 loss유도 • 따라서, 이 유전변이는 단백질의 비활성화를 유도할 것으로 예측됨 (레퍼런스) • 유전 변이가 해당 암종에 대해 DB/논문에 어떻게 보고 되어 있는지 설명 • COSMIC:ARID1A 변이가 6%의 폐암에서 보고 됨 (6% lung adenocarcinoma, 7% lung squamous cell carcinoma) • 유전 변이에 효과가 있는 약물 (승인/임상)에 대한 간략한 소개 • Preclinical Data에 의하면 ARID1A는 tumor suppressor 의 기능을 한다는 것을 뒷받침 • 몇몇 암종에서는 ARID1A의 발현 감소가 세포독성치료의 저항성과 관련이 있음 (레퍼런스) • 현재,ARID1A의 loss를 표적으로 하는 표적치료제는 없음
  • 44. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 4 of 11 THERAPIES There are no therapies FDA approved in this patient's tumor type that are specific to the reported genomic alterations. ADDITIONAL THERAPIES – FDA APPROVED IN OTHER TUMOR TYPES THERAPY RATIONALE Everolimus Everolimus is an orally available mTOR inhibitor that has been approved for use in renal cell carcinoma, pancreatic neuroendocrine tumors, subependymal giant cell astrocytoma associated with TSC, and hormone receptor positive, HER2 negative advanced breast cancer. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to everolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Everolimus is currently being tested in clinical trials in several tumor types. A Phase 1 trial of everolimus and figitumumab, an IGF-1R inhibitor, in sarcomas and other solid tumors showed that the combination was safe and well- tolerated, with a partial response in 1/18 patients and stable disease in 15/18 patients (Quek et al., 2011; 21177764). Lapatinib Lapatinib is a dual tyrosine kinase inhibitor, targeting both Egfr and Her2 (Erbb2). It has been approved for use in metastatic breast cancer. Mutation of NF2 may lead to Egfr and/or Erbb2 activation; lapatinib inhibits Egfr and Erbb2 and has shown preclinical activity in NF2 deficient vestibular schwannoma (Ammoun et al., 2010; 20511180). Lapatinib is currently in clinical trials in multiple solid tumor types. Temsirolimus Temsirolimus is an intravenous mTOR inhibitor that has been approved for use in advanced renal cell carcinoma. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to temsirolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Temsirolimus is currently being tested in clinical trials in several tumor types. A Phase 2 trial of temsirolimus as single agent in soft tissue sarcoma reported limited efficacy and moderate toxicity, with a partial response exhibited in 2 of 40 evaluable patients (Okuno et al., 2011; 21287536). A Phase 1 trial of temsirolimus combined with liposomal doxorubicin in recurrent and refractory bone and soft tissue sarcoma patients reported that the combination treatment is safe and demonstrates sufficient preliminary efficacy to pursue the Phase 2 portion of the study (Thornton et al., 2013; 23382028). Genomic alterations detected may be associated with activity of certain FDA approved drugs, however the agents listed in this report may have little or no evidence in the patient’s tumor type
  • 45. • 약의 유형 및 표적 소개 • Erlotinib 은 저분자 화합물 (small molecule) 약으로 • EGFR의 타이로신 활성효소 억제제 (tyrosine kinase inhibitor)임 • 약의 FDA 승인 적응증 • NSCLC (비세포성 폐암) 및 췌장암에 승인 되었음 • 해당 유전 변이에 대한 약의 효과 설명 • EGFR 활성화 유전변이가 있는 환자들에게서, erlotinib 의 투여는 암의 진행 속도를 늦추는 효과를 나타냄 (ref) • (폐암에 대한) 약의 임상 시험 과정 및 결과 • NSCLC에 대한 erlotinib의 승인은 무작위 임상 3상에서 표준항암치료에 비해 생존기간(OS)의 연장에 근거하였음 (ref) • 몇번의 무작위 임상 3상에서 EGFR 양성 환자들에 대하여, 무진행 생존률(PFS)이 표준치료에 비해 유의미하게 연장됨 (ref) • 해당 유전 변이의 약에 대한 저항성 설명 • 다른 EGFR 활성화 변이와는 달리, 어떤 exon 20 변이는 (전)임상 시험에서 EGFR 타이로신 활성효소 억제제에 대한 저항성을 보였다. • Exon 20 insertion 변이의 경우 어떤 환자들에게서는 EGFR 저해제를 투여했을 경우 질병이 더 진행되지 않았다.
  • 46. • (폐암에 대한) 약의 임상 시험 과정 및 결과 • 처음 임상시험에서는 무작위 NSCLC 환자에 대하여 위약 대비 생존율에 대한 유의미한 효과를 보이지 못하여, 임상 실패 • 하지만, 추우에 EGFR 변이 환자들에게 항암요법과 병용투여하였을 경우 생존율에 유의미한 차이를 보인 결과 (승인 받음)
  • 47. Patient Name Lee, Cheol Report Date 26 February 2013 Soft tissue sarcoma (NOS) THERAPIES There are no therapies FDA approved in this patient's tumor type that are specific to the reported genomic alterations. ADDITIONAL THERAPIES – FDA APPROVED IN OTHER TUMOR TYPES THERAPY RATIONALE Everolimus Everolimus is an orally available mTOR inhibitor that has been approved for use in renal cell carcinoma, pancreatic neuroendocrine tumors, subependymal giant cell astrocytoma associated with TSC, and hormone receptor positive, HER2 negative advanced breast cancer. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to everolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Everolimus is currently being tested in clinical trials in several tumor types. A Phase 1 trial of everolimus and figitumumab, an IGF-1R inhibitor, in sarcomas and other solid tumors showed that the combination was safe and well- tolerated, with a partial response in 1/18 patients and stable disease in 15/18 patients (Quek et al., 2011; 21177764). Lapatinib Lapatinib is a dual tyrosine kinase inhibitor, targeting both Egfr and Her2 (Erbb2). It has been approved for use in metastatic breast cancer. Mutation of NF2 may lead to Egfr and/or Erbb2 activation; lapatinib inhibits Egfr and Erbb2 and has shown preclinical activity in NF2 deficient vestibular schwannoma (Ammoun et al., 2010; 20511180). Lapatinib is currently in clinical trials in multiple solid tumor types. Temsirolimus Temsirolimus is an intravenous mTOR inhibitor that has been approved for use in advanced renal cell carcinoma. Preclinical data suggests that NF2 loss may be associated with sensitivity to rapamycin, which is similar in mechanism of action to temsirolimus (Lopez-Lago et al., 2009; 19451229, James et al., 2009; 19451225). Temsirolimus is currently being tested in clinical trials in several tumor types. A Phase 2 trial of temsirolimus as single agent in soft tissue sarcoma reported limited efficacy and moderate toxicity, with a partial response exhibited in 2 of 40 evaluable patients (Okuno et al., 2011; 21287536). A Phase 1 trial of temsirolimus combined with liposomal doxorubicin in recurrent and refractory bone and soft tissue sarcoma patients reported that the combination treatment is safe and demonstrates sufficient preliminary efficacy to pursue the Phase 2 portion of the study (Thornton et al., 2013; 23382028). Genomic alterations detected may be associated with activity of certain FDA approved drugs, however the agents listed in this report may have little or no evidence in the patient’s tumor type • 약의 유형 및 표적 소개 • Everolimus는 경구 투여 가능한 mTOR 저해제이다. • 약의 FDA 승인 적응증 • 신장암, 췌장암, HER2 음성 유방암 등에 승인 받음 • 해당 유전 변이에 대한 약의 효과 설명 • 전임상시험 데이터는 NF2 loss 변이는 everolimus와 유사한 메커니즘을 가진 rapamycin에 반응한다는 결과를 보여준다 • (폐암에 대한) 약의 임상 시험 과정 및 결과 • Everolimus는 현재 여러 암종에 대해서 임상 시험 중에 있다. • Everolimus 와 IGF-1 수용체 저해제인 figitumumab를 병용투여했을 경우 총 18명의 환자 중, • 1명은 부분적으로 암이 줄어들었고, 5명은 안정하게 유지되었다. (ref)
  • 48. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) Electronically Signed by Jeffrey S. Ross M.D., Medical Director | CLIA Number: 22D2027531 | 26 February 2013 Foundation Medicine, Inc., One Kendall Square Ste B3501, Cambridge MA | 1.888.988.3639 page 5 of 11 CLINICAL TRIALS TO CONSIDER IMPORTANT: While every effort is made to ensure the accuracy of the information contained below, the information available in the public domain is continuously updated and should be investigated by the physician or research staff. This is not meant to be a complete list of available trials. In order to conduct a more thorough search, please go to www.clinicaltrials.gov and use the search terms provided below. For more information about a specific clinical trial, type the NCT ID of the trial indicated below into the search bar. GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS NF2 W74* Mutation or loss of NF2 results in the dysregulation of RTK and mTOR signaling. Therefore, RTK or mTOR inhibitors may be relevant for patients with NF2 mutations. A search of the trial website clinicaltrials.gov, using terms such as “NF2”, "lapatinib", "mTOR" and/or "solid tumor" retrieves more than 10 trials that may be relevant for this patient's tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID An Open-label, Multi-center Phase I Dose- finding Study of RAD001 (Everolimus, Afinitor®) in Combination With BEZ235 in Patients With Advanced Solid Tumors Phase 1 MTOR, PI3K Missouri, Auckland (New Zealand), Barcelona (Spain), Bordeaux Cedex (France), Montpellier Cedex 5 (France), Newcastle Upon Tyne (United Kingdom), Seoul (Korea, Republic of), Verona (Italy), Wilrijk (Belgium) NCT01482156 A Phase I Study of the HER1, HER2 Dual Kinase Inhibitor, Lapatinib Plus the Proteosomal Inhibitor Bortezomib in Patients With Advanced Malignancies Phase 1 EGFR, Her2/neu, proteasome District of Columbia NCT01497626
  • 49. CLINICAL TRIALS TO CONSIDER IMPORTANT: While every effort is made to ensure the accuracy of the information contained below, the information available in the public domain is continuously updated and should be investigated by the physician or research staff. This is not meant to be a complete list of available trials. In order to conduct a more thorough search, please go to www.clinicaltrials.gov and use the search terms provided below. For more information about a specific clinical trial, type the NCT ID of the trial indicated below into the search bar. GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS NF2 W74* Mutation or loss of NF2 results in the dysregulation of RTK and mTOR signaling. Therefore, RTK or mTOR inhibitors may be relevant for patients with NF2 mutations. A search of the trial website clinicaltrials.gov, using terms such as “NF2”, "lapatinib", "mTOR" and/or "solid tumor" retrieves more than 10 trials that may be relevant for this patient's tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID An Open-label, Multi-center Phase I Dose- finding Study of RAD001 (Everolimus, Afinitor®) in Combination With BEZ235 in Patients With Advanced Solid Tumors Phase 1 MTOR, PI3K Missouri, Auckland (New Zealand), Barcelona (Spain), Bordeaux Cedex (France), Montpellier Cedex 5 (France), Newcastle Upon Tyne (United Kingdom), Seoul (Korea, Republic of), Verona (Italy), Wilrijk (Belgium) NCT01482156 A Phase I Study of the HER1, HER2 Dual Kinase Inhibitor, Lapatinib Plus the Proteosomal Inhibitor Bortezomib in Patients With Advanced Malignancies Phase 1 EGFR, Her2/neu, proteasome District of Columbia NCT01497626 • 이 임상시험들이 권장되는 이유 • NF2 유전자 변이나 loss는 RTK 와 mTOR 신호전달을 활성화시킨다. • 그러므로 RTK, 혹은 mTOR 저해제가 NF2 변이 환자들에게 적용될 수 있다. • Clinicaltrial.gov 는 NF2, lapatinib, mTOR와 solid tumor 등의 키워드에 대하여 10개가 넘는 임상시험을 보여준다.
  • 50. Patient Name Lee, Cheol Report Date 26 February 2013 Diagnosis Soft tissue sarcoma (NOS) CLINICAL TRIALS TO CONSIDER (CONT.) GENE RATIONALE FOR POTENTIAL CLINICAL TRIALS KRAS G13D, amplification Activating mutations in KRAS may result in activation of downstream pathways, including the MAPK pathway. Therefore, inhibitors of MAPK pathway components, including the protein MEK, may be of use in a tumor with a KRAS activating mutation. Additionally, the engineered reovirus Reolysin is under investigation in clinical trials for its ability to specifically target cells bearing activated KRAS. A search of the trial website clinicaltrials.gov, using terms such as "KRAS", "MEK", "sarcoma", and/or "solid tumor", retrieves more than 10 trials that may be relevant for this patient’s tumor. Examples of these trials are shown below. TITLE PHASE TARGETS LOCATIONS NCT ID A Phase Ib, Open-Label, Dose-Escalation Study Evaluating the Safety, Tolerability and Pharmacokinetics of GDC-0973 in Combination With GDC-0941 When Administered in Patients With Locally Advanced or Metastatic Solid Tumors Phase 1 MEK, PI3K Massachusetts, Michigan, Tennessee NCT00996892 A Phase Ib, Open-label, Multi-center, Dose- escalation and Expansion Study of an Orally Administered Combination of BEZ235 Plus MEK162 in Adult Patients With Selected Advanced Solid Tumors Phase 1 MEK, MTOR, PI3K Massachusetts, Texas, Wisconsin, Ontario (Canada), Barcelona (Spain), Cologne (Germany), Essen (Germany), Victoria (Australia), Villejuif (France) NCT01337765 • 이 임상시험들이 권장되는 이유 • KRAS의 활성화 변이는 MAPK pathway 등의 downstream pathway를 활성화시킨다. • 그러므로 MEK를 포함한 MAPK pathway 의 구성요소들을 저해하는 약은 KRAS 활성화 변이에 대해 사용될 수 있다. • 또한, 임상시험 중인 reovirus Reolysin 은 활성화된 KRAS 를 가지고 있는 세포만을 저해하는 기능으로 연구되고 있다. • Clinialtrial.gov 에는 KRAS, MEK, sarcoma, solid tumor 등으로 10개가 넘는 임상시험을 찾을 수 있다.
  • 52. Wed Nov 5, 2014 “Google will soon start covering the cost of Foundation Medicine's DNA tests for employees and their family-members suffering from cancer, as part of its health benefits portfolio.”
  • 53. Oct 16, 2014 “Priority Health has begun coverage of Foundation Medicine's genomic profiling services for cancer, making the health plan the first in the country to provide such coverage”
  • 55. vs. Steve Jobs Apple CEO Pancreatic Cancer Dead Dr. Lukas Wartman Geneticist,Washington Univ. Acute Lymphoblastic Leukemia Survived Found Nothing Actionable from Genome Found Something Actionable from Genome
  • 56. • He developed Acute Lymphoblastic Leukemia, which he studied himself. • Recurred, 5 years after the bone-marrow transplant • Whole genome sequencing +Transcriptome analysis • Overexpression of FLT3 was found (FLT3: cell growth, proliferation) • Sutent (sunitinib), which was approved for Kidney cancer, inhibits FLT3 • ALL was successfully treated by Sutent, the Kidney cancer drug. Dr. Lukas Wartman http://www.nytimes.com/2012/07/08/health/in-gene-sequencing-treatment-for-leukemia-glimpses-of-the-future.html?pagewanted=all&_r=0
  • 57. ‹› • June, 2010: 53 y.o. female diagnosed with metastatic inflammatory breast cancer (IBC) involving liver and bone • Initial therapies: docetaxel, carboplatin and trastuzumab – achieved some improvement • Disease progression within 12 months • April - November, 2011: Numerous additional drug regimens attempted • November, 2011: Rapid progression of disease 24 Case Presentation 2: FMI vs ‘Limited’  Testing Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
  • 58. ‹› FoundationOne® Report – Profiling the Genome 25 Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
  • 59. ‹›“Common”  Mutation  Identified • EGFR Exon 21 L858R point mutation identified – Associated with unprecedented sensitivity to EGFR-TKIs such as gefitinib (Iressa) and erlotinib (Tarceva) • Present in 10% of lung adenocarcinomas • NOT reported with reproducible frequency in other tumor  types  →  NO clinical testing done • Broad based, highly sensitive NGS test (FoundationOne) identifies a transforming lesion in this advanced IBC 26 Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
  • 60. Cell cycle enome integrity RTK signalling RB1 CDKN2A FGFR3 KIT FGFR2 EPHB6 PDGFRA ERBB4 EPHA3 FLT3 EGFR ERCC2 RAD21 CHEK2 SMC3 SMC1A BRCA1 BAP1 STAG2 ATR BRCA2 ATRX ATM TP53 14.3 1.8 0.5 8.3 3.0 0.2 0.0 5.3 6.9 1.9 3.9 3.2 4.1 0.0 0.5 0.7 21.3 1.0 0.0 6.6 14.9 0.0 0.4 3.6 8.2 0.1 0.5 1.4 1.7 1.4 0.0 0.4 2.3 0.3 0.4 1.0 1.0 0.5 1.0 1.0 1.0 0.7 4.0 1.8 3.5 1.9 2.2 1.4 2.0 0.9 0.0 0.3 0.7 0.2 0.0 3.1 2.3 0.0 10.4 1.5 3.1 0.4 0.0 1.4 1.3 1.2 0.0 9.7 3.5 0.3 1.7 1.6 6.1 0.4 1.0 3.8 1.0 1.4 0.5 6.6 4.0 1.0 1.3 1.9 2.0 0.8 3.6 0.3 4.3 1.4 0.0 7.5 5.2 0.0 2.6 2.1 1.0 0.5 3.1 1.0 3.7 0.5 0.5 8.8 6.3 1.0 2.2 2.1 2.0 0.4 0.0 1.7 0.7 0.5 26.5 4.0 4.0 1.0 0.9 2.7 1.0 0.7 1.6 26.6 4.7 1.7 1.0 11.4 2.9 1.9 1.3 4.6 12.2 0.1 0.5 0.0 0.3 0.2 0.0 1.3 0.0 0.3 0.4 0.7 2.0 0.5 1.0 0.3 1.0 0.0 2.5 2.6 1.2 0.3 0.9 0.9 2.0 0.4 0.0 1.7 2.3 0.7 0.0 0.9 1.2 0.3 1.3 0.9 1.0 0.4 0.0 1.4 1.7 1.2 3.5 2.6 2.3 0.3 0.4 1.2 3.1 0.8 1.6 1.7 1.0 0.5 3.5 1.3 0.6 1.3 4.4 1.5 4.1 1.6 0.0 1.0 2.7 1.0 0.0 3.5 5.2 3.5 0.9 1.9 4.1 0.3 0.0 0.7 1.0 10.1 0.0 1.3 0.6 0.6 2.2 2.0 10.2 0.9 1.0 4.1 0.7 1.7 3.0 2.6 3.5 1.0 3.9 2.2 4.1 0.8 2.1 1.4 5.3 1.2 0.0 5.7 4.0 0.6 7.0 2.4 6.1 1.7 1.6 1.4 3.7 1.9 0.0 5.7 5.8 3.2 4.4 2.7 8.2 1.2 1.0 5.5 4.3 1.9 0.0 6.1 5.8 0.6 3.0 2.8 11.2 2.1 5.7 1.4 2.7 2.9 0.0 7.9 4.0 1.3 6.5 3.3 50.0 32.9 58.6 28.3 69.8 2.2 7.5 51.8 79.3 94.6 27.8 42.0 Transcription factor/regulator BLCA BRCA COAD/READ GBM HNSC KIRC AML LUAD LUSC OV UCEC Pan−Cancer SIN3A TBX3 MECOM RUNX1 TSHZ2 TAF1 CTCF EP300 TSHZ3 GATA3 VHL 1.0 0.5 0.5 0.7 0.7 0.5 0.0 1.8 2.9 0.6 5.2 1.1 3.1 2.4 1.0 0.0 0.7 0.0 0.0 4.4 2.9 1.0 1.3 1.4 5.1 0.5 1.0 1.4 1.7 1.0 0.0 3.5 4.6 0.6 3.0 1.5 1.0 3.3 1.0 0.0 0.7 0.0 9.0 0.4 0.0 0.0 1.3 1.6 4.1 0.9 3.1 2.4 1.3 0.7 0.0 6.6 3.5 1.0 1.7 1.8 2.0 1.1 1.6 1.4 2.3 1.2 0.0 4.0 6.9 1.6 8.7 2.3 2.0 2.4 1.6 0.0 3.3 0.5 0.5 1.3 0.0 0.3 16.5 2.4 17.4 0.8 2.1 0.3 8.0 1.4 0.0 0.9 4.6 0.3 5.2 2.5 2.0 0.7 3.1 0.7 1.3 1.2 0.5 14.9 6.3 1.0 3.9 2.6 1.0 10.6 1.0 0.0 2.0 0.0 0.0 2.6 2.9 0.3 0.4 3.2 0.0 0.0 0.0 0.0 0.0 52.3 0.0 0.0 0.6 0.0 0.9 6.9 Nature. 2013 Oct 17;502(7471):333-9. Mutational landscape and significance across 12 major cancer types. Kandoth C et. al.
  • 61. ‹› Left Supraclavicular Lesion: PET-CT Sept, 2012 Nov, 2012 Response Assessment After Starting Erlotinib 27 Foundation Medicine,“Next Generation Sequencing in the Clinic - The First 2200+ Cases Lessons Learned”
  • 62. How to Implement Personalized Cancer Medicine In a Clinical Setting The Case of MI-ONCOSEQ
  • 63. Genomics WGS, WES Transcriptomics RNA-Seq Epigenomics Bisulfite-Seq ChIP-Seq Smallindels point mutation Copy number variation Structural variation Differential expression Gene fusion Alternative splicing RNA editing Methylation Histone modification Transcription Factor binding Functional effect of mutation Network and pathway analysis Integrative analysis Furtherunderstandingofcancerandclinicalapplications Technologies Data Analysis Integration and interpretationPatient Figure 1 The workflow of integrating omics data in cancer research and clinical application. NGS technologies detect the genomic, transcriptomic and epigenomic alternations including mutations, copy number variations, structural variants, differentially expressed genes, fusion Shyr and Liu Biological Procedures Online 2013, 15:4 Page 2 of 11 http://www.biologicalproceduresonline.com/content/15/1/4 The workflow of integrating omics data in cancer research and clinical application Shyr D, Liu Q. Biol Proced Online. 2013 Feb 13;15(1):4.
  • 64. C A N C E R Personalized Oncology Through Integrative High-Throughput Sequencing: A Pilot Study Sameek Roychowdhury,1,2 * Matthew K. Iyer,1,3 * Dan R. Robinson,1,4 * Robert J. Lonigro,1,3 Yi-Mi Wu,1,4 Xuhong Cao,1,4,5 Shanker Kalyana-Sundaram,1,4,6 Lee Sam,1,3 O. Alejandro Balbin,1,3 Michael J. Quist,1,4 Terrence Barrette,1,4 Jessica Everett,7 Javed Siddiqui,1,4 Lakshmi P. Kunju,1,4 Nora Navone,8 John C. Araujo,8 Patricia Troncoso,8 Christopher J. Logothetis,8 Jeffrey W. Innis,9 David C. Smith,2,10 Christopher D. Lao,2,10 Scott Y. Kim,11 J. Scott Roberts,11,12 Stephen B. Gruber,2,10 Kenneth J. Pienta,1,2,10,13 Moshe Talpaz,2,10 Arul M. Chinnaiyan1,3,4,5,13† Individual cancers harbor a set of genetic aberrations that can be informative for identifying rational therapies cur- rently available or in clinical trials. We implemented a pilot study to explore the practical challenges of applying high-throughput sequencing in clinical oncology. We enrolled patients with advanced or refractory cancer who were eligible for clinical trials. For each patient, we performed whole-genome sequencing of the tumor, targeted whole-exome sequencing of tumor and normal DNA, and transcriptome sequencing (RNA-Seq) of the tumor to identify potentially informative mutations in a clinically relevant time frame of 3 to 4 weeks. With this approach, we detected several classes of cancer mutations including structural rearrangements, copy number alterations, point mutations, and gene expression alterations. A multidisciplinary Sequencing Tumor Board (STB) deliberated on the clinical interpretation of the sequencing results obtained. We tested our sequencing strategy on human prostate cancer xenografts. Next, we enrolled two patients into the clinical protocol and were able to review the results at our STB within 24 days of biopsy. The first patient had metastatic colorectal cancer in which we identified somatic point mutations in NRAS, TP53, AURKA, FAS, and MYH11, plus amplification and overexpression of cyclin-dependent kinase 8 (CDK8). The second patient had malignant melanoma, in which we identified a somatic point mutation in HRAS and a structural rearrangement affecting CDKN2C. The STB identified the CDK8 amplification and Ras mutation as providing a rationale for clinical trials with CDK inhibitors or MEK (mitogen- activated or extracellular signal–regulated protein kinase kinase) and PI3K (phosphatidylinositol 3-kinase) inhibitors, respectively. Integrative high-throughput sequencing of patients with advanced cancer generates a comprehensive, individual mutational landscape to facilitate biomarker-driven clinical trials in oncology. INTRODUCTION The management of patients with cancer is well suited to a personal- ized approach, as reinforced by recent genomic studies that reveal a disease composed of numerous heterogeneous mutations. Although hallmark mutations such as inactivation of TP53 or activation of BRAF occur frequently, they often appear in concert with a host of uncommon oncogenic events. Further, expanding catalogs of cancer mutations dispel the notion that cancer mutations are tissue-specific (1–7). For example, activating BRAF mutations have in more than 50% of cutaneous melanoma and papilla cinoma, and the mutant proteins are potential tar inhibitors (8, 9). However, BRAF mutations also occur quency (5 to 20%) in multiple myeloma, lung cancer cinoma, and testicular cancer (10, 11). Moreover, a lo fraction of major targetable kinases—including PIK3C dermal growth factor receptor), and ERBB2—may R E S E A R C H A R T I C L E Michigan Oncology Sequencing Project (MI-ONCOSEQ) Roychowdhury S et al. Sci Transl Med. 2011 Nov 30;3(111):111ra121
  • 65. Sequencing Buccal swab or Blood Sequencing Tumor Board Disclosure of Results Genetic Counselor Analysis 1) Actionable Results? 2) Incidental Results? Informed Consent Tumor Biopsy Genetic Counseling MI-ONCOSEQ: The Michigan Oncology Sequencing Center Precision Medicine Tumor Board Clinically RelevantTimeframe FromTissue Biopsy to Sequencing Results Day 0 Day 27-30