SlideShare ist ein Scribd-Unternehmen logo
1 von 28
Chelonian
Diagnostics,
Pathology, and
Treatment
Matt Allender, DVM, MS, PhD, Diplomate ACZM
Ranavirus Symposium
July 2013
@Turtle_Doc
#RV13
Ranavirus epidemiology
 Disease events are often clustered in local epizootics
 Some occur on annual basis
 Several sources report a significant threat to
biodiversity
 Population density mortality in salamander studies
 Environmental factors change prevalence
 Restoration efforts
Quantitative PCR
 TaqMan primer-probes were designed using Primer
Express targeting a portion of the MCP that was
contained within the 531 bp product
 Forward: AACGCCGACCGAAAACTG
 Reverse: GCTGCCAAGATGTCGGGTAA
 Probe: CCGGCTTTCGGGC
 Resultant segment was a 54 bp product
Conventional PCR
Level of Detection:
529,000 viral
copies
52 viral copies
Quantitative PCR
Epidemiologic evidence
Category Institution FV3 positive FV3
negative
Prevalence 95% CI
Free-living* OR
1 308 0.3% 0 – 1.8 %
Rehabilitation* 7 217 3.13% 1.5 – 6.3%
UT 3 35 7.9% 2.7 – 20.1 %
WCV 2 120 1.6% 0.4 – 5.9 %
NCSU 0 46 0.00% 0 – 7.7 %
AWC 2 14 14.3% 4.0 – 39.9 %
UGA 0 9 0.00% 0 – 29.9 %
Total 8 525 1.5% 0.8 – 2.9%
* Significant difference between prevalence in free-living population and
rehabilitation populations, p=0.01, one-tailed
Results
Variable FV3 positive FV3 negative Prevalence 95% CI
Female 3 168 1.8 % 0.6 – 5.0 %
Male 0 218 0.00% 0 – 1.7 %
Adult 2 398 0.5 % 0.1 – 1.8 %
Juvenile 2 55 3.5 % 0.9 – 11.9 %
Sex: p=0.157, observed power = 0.73
Age: p=0.081, observed power = 0.91
Housing
 Environmental chamber within Division of Animal
Resources at UI-CVM
 15’9” x 12”
 Temperature was acclimated for 1 week prior to
beginning study
 Recorded daily and maintained +/- 1°C throughout
duration of study
 Adult female red-eared sliders maintained in 45 or 50
gallon plastic enclosures with ~20 gallons freshwater
and basking spot
Virus
 Ranavirus isolated from infected eastern box turtle
 100% sequence homology to MCP of FV3
 Grown to confluence in TH-1
 Divided into aliquots of 5 x 105 TCID50
 Quantitative PCR performed on virus
 Four animal in each temperature group were
administered 1 aliquot (0.67 ml) in the right forelimb
muscle
 Uninfected controls administered same volume crude
cell lysate
Sample collection
 Weight, whole blood, oral and cloacal swabs collected
twice prior to inoculation to confirm negative status, then
twice weekly throughout duration of study
 PCV, TS, WBC, differential performed each sample
 Clinical signs were recorded daily
 Animals were euthanized when clinical signs were
severe (as described in IACUC) or at 30 days post-
inoculation
 Control animal was euthanized at same time as inoculated
animal
 Gross necropsy performed within 48 hours
 Histopathology of 8 tissues
 qPCR of necropsy tissues
Results
 Survival
 22°C – all inoculated turtles
were euthanized due to
severity of signs
 28°C – only 2 turtles were
euthanized due to clinical
signs
 One uninfected control
died of sepsis
 Median survival times
 22°C = 24 days (14 -30)
 28°C = 30 days (17-30)
22C
28C
Results
 *Significant increase over time (F=11.1, p=0.045)
 Significant difference between control and inoculated turtles
(p=0.035)
 #Significant increase over time (F=7.13, p=0.026)
Time 22°C
Weight
28°C
Weight
Pre-inoculation 1693.5625* 2063.1250#
Initial post-
inoculation
1692.50* 2082.50#
Terminal 1802.50* 2159.50#
Results
Tissue Parameter 22C
Viral Copies
28C
Viral Copies
Tongue Mean/median* 1.25 x 109* 5.94 x 106*
Skeletal
Muscle
Mean/median* 3.7 x 1010* 3.64 x 108*
Lung Mean/median* 6.29 x 109* 5.01 x 109*
Heart# Mean/median* 2.92 x 1010 1.27 x 109*
Liver^ Mean/median* 2.15 x 109 1.70 x 107*
Spleen Mean/median* 2.23 x 1010* 5.44 x 107*
Ovary Mean/median* 8.93 x 109* 9.06 x 106*
Kidney Mean/median* 3.46 x 1010* 2.54 x 108*
# Significant difference between environmental temperatures, p=0.012
^ Significant difference between environmental temperatures, p=0.011
Results
Temperature evidence
 Mortality
 22°C
 Significant association between inoculation and disease
(p=0.014)
 28°C
 No significant association between inoculation and
disease (p=0.214)
 Non-significant mortality was seen at lower
temperature (100%) than higher temperature (50%)
 Power = 0.34
Temperature evidence
 qPCR
 Viral copies quickly went from undetectable to
millions/billions of copies
 All positive turtles had between 2 and 4 positive samples
prior to death
 Highest in whole blood, lowest in cloacal swab (non-
significant) at 22°C
 Specificity and Sensitivity
 Whole blood
 100% specific and 100% sensitive
 Oral swab and cloacal swab
 100% specific and 83% sensitive
Results
Conclusions
 Prevalence in surveys of free-ranging populations are
low
 Are chelonians a spill-over host?
 Natural history characteristics make it difficult to identify
mortality events?
 Are chelonians a reservoir host and fail to develop signs?
 Are mechanisms of transmission different in chelonians
which provide natural protection?
Conclusions
 Environmental temperature leads to differences in
mortality in red-eared sliders
 Both host and pathogen factors that may lead to
protection at higher temperatures
 May play a role in persistence or transmission
 Do other species have similar response to changes in
temperature?
 Opportunity for therapeutic intervention
Funding Sources
 Morris Animal Foundation
 qPCR development and prevalence study
 CRESO
 Prevalence study
 Fluker’s Farms/Cox Pharmacology lab
 PK study
Questions?

Weitere ähnliche Inhalte

Was ist angesagt?

2008Phylogenetic Analysis and Isolation of CDV
2008Phylogenetic Analysis and Isolation of CDV2008Phylogenetic Analysis and Isolation of CDV
2008Phylogenetic Analysis and Isolation of CDVDavid Chung -Tiang Liang
 
Protein biomarker capabilities for Nanosphere
Protein biomarker capabilities for NanosphereProtein biomarker capabilities for Nanosphere
Protein biomarker capabilities for NanosphereWinton Gibbons
 
Elucidating the role of the Chromosomal Type III Secretion System structural ...
Elucidating the role of the Chromosomal Type III Secretion System structural ...Elucidating the role of the Chromosomal Type III Secretion System structural ...
Elucidating the role of the Chromosomal Type III Secretion System structural ...Jackson Osaghae-Nosa
 
A pathogen lurking in the darkness
A pathogen lurking in the darknessA pathogen lurking in the darkness
A pathogen lurking in the darknessmgray11
 
Survival of-newcastle-disease-virus-j.guan
Survival of-newcastle-disease-virus-j.guan Survival of-newcastle-disease-virus-j.guan
Survival of-newcastle-disease-virus-j.guan IIAD
 
IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...
IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...
IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...iosrphr_editor
 
Clinical use of serum parvovirus and distemper virus antibody titers for dete...
Clinical use of serum parvovirus and distemper virus antibody titers for dete...Clinical use of serum parvovirus and distemper virus antibody titers for dete...
Clinical use of serum parvovirus and distemper virus antibody titers for dete...Yotam Copelovitz
 
Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...Tiensae Teshome
 
Virology Journal Club
Virology Journal ClubVirology Journal Club
Virology Journal ClubPrenesh
 
Protein engineering presentation
Protein engineering presentationProtein engineering presentation
Protein engineering presentationHuzaifa Ummar
 
Association of human leukocyte antigen class II allele and haplotypes Trans R...
Association of human leukocyte antigen class II allele and haplotypes Trans R...Association of human leukocyte antigen class II allele and haplotypes Trans R...
Association of human leukocyte antigen class II allele and haplotypes Trans R...Subrat Thanapati
 
Mbs uti presentation
Mbs uti presentationMbs uti presentation
Mbs uti presentationVikas Sharma
 

Was ist angesagt? (19)

thesis final ppt
thesis final pptthesis final ppt
thesis final ppt
 
2008Phylogenetic Analysis and Isolation of CDV
2008Phylogenetic Analysis and Isolation of CDV2008Phylogenetic Analysis and Isolation of CDV
2008Phylogenetic Analysis and Isolation of CDV
 
Protein biomarker capabilities for Nanosphere
Protein biomarker capabilities for NanosphereProtein biomarker capabilities for Nanosphere
Protein biomarker capabilities for Nanosphere
 
Elucidating the role of the Chromosomal Type III Secretion System structural ...
Elucidating the role of the Chromosomal Type III Secretion System structural ...Elucidating the role of the Chromosomal Type III Secretion System structural ...
Elucidating the role of the Chromosomal Type III Secretion System structural ...
 
A pathogen lurking in the darkness
A pathogen lurking in the darknessA pathogen lurking in the darkness
A pathogen lurking in the darkness
 
Survival of-newcastle-disease-virus-j.guan
Survival of-newcastle-disease-virus-j.guan Survival of-newcastle-disease-virus-j.guan
Survival of-newcastle-disease-virus-j.guan
 
IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...
IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...
IOSR Journal of Pharmacy (IOSRPHR), www.iosrphr.org, call for paper, research...
 
Publication 3 - 3rd Author
Publication 3 - 3rd AuthorPublication 3 - 3rd Author
Publication 3 - 3rd Author
 
Clinical use of serum parvovirus and distemper virus antibody titers for dete...
Clinical use of serum parvovirus and distemper virus antibody titers for dete...Clinical use of serum parvovirus and distemper virus antibody titers for dete...
Clinical use of serum parvovirus and distemper virus antibody titers for dete...
 
Monocyte recruitment into atherosclerotic plaques
Monocyte recruitment into atherosclerotic plaquesMonocyte recruitment into atherosclerotic plaques
Monocyte recruitment into atherosclerotic plaques
 
079 monocyte recruitment into atherosclerotic plaques
079 monocyte recruitment into atherosclerotic plaques079 monocyte recruitment into atherosclerotic plaques
079 monocyte recruitment into atherosclerotic plaques
 
Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...Real time pcr assay for rapid detection and quantification of campylobacter j...
Real time pcr assay for rapid detection and quantification of campylobacter j...
 
Virology Journal Club
Virology Journal ClubVirology Journal Club
Virology Journal Club
 
Ablooglu, AJ (2014) JBC
Ablooglu, AJ (2014) JBCAblooglu, AJ (2014) JBC
Ablooglu, AJ (2014) JBC
 
Protein engineering presentation
Protein engineering presentationProtein engineering presentation
Protein engineering presentation
 
Hall, Theodore
Hall, TheodoreHall, Theodore
Hall, Theodore
 
Association of human leukocyte antigen class II allele and haplotypes Trans R...
Association of human leukocyte antigen class II allele and haplotypes Trans R...Association of human leukocyte antigen class II allele and haplotypes Trans R...
Association of human leukocyte antigen class II allele and haplotypes Trans R...
 
Mbs uti presentation
Mbs uti presentationMbs uti presentation
Mbs uti presentation
 
PAPER1
PAPER1PAPER1
PAPER1
 

Andere mochten auch

Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...
Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...
Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...mgray11
 
Environmental dependency of ranavirus/amphibian genotypic interactions
Environmental dependency of ranavirus/amphibian genotypic interactionsEnvironmental dependency of ranavirus/amphibian genotypic interactions
Environmental dependency of ranavirus/amphibian genotypic interactionsmgray11
 
Brixen marts 13
Brixen marts 13Brixen marts 13
Brixen marts 13sun-web
 
Can patterns of ranavirus emergence be used to assess conservation threat?
Can patterns of ranavirus emergence be used to assess conservation threat?Can patterns of ranavirus emergence be used to assess conservation threat?
Can patterns of ranavirus emergence be used to assess conservation threat?mgray11
 
Ranaviruses in snakes, lizards and chelonians
Ranaviruses in snakes, lizards and cheloniansRanaviruses in snakes, lizards and chelonians
Ranaviruses in snakes, lizards and cheloniansmgray11
 
Oasen fællesstrøg
Oasen fællesstrøgOasen fællesstrøg
Oasen fællesstrøgsun-web
 
The wood frog as a model to study the pathogenesis and host-pathogen interact...
The wood frog as a model to study the pathogenesis and host-pathogen interact...The wood frog as a model to study the pathogenesis and host-pathogen interact...
The wood frog as a model to study the pathogenesis and host-pathogen interact...mgray11
 

Andere mochten auch (7)

Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...
Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...
Concurrent die-offs of turtles, salamanders and frogs at one site in Maryland...
 
Environmental dependency of ranavirus/amphibian genotypic interactions
Environmental dependency of ranavirus/amphibian genotypic interactionsEnvironmental dependency of ranavirus/amphibian genotypic interactions
Environmental dependency of ranavirus/amphibian genotypic interactions
 
Brixen marts 13
Brixen marts 13Brixen marts 13
Brixen marts 13
 
Can patterns of ranavirus emergence be used to assess conservation threat?
Can patterns of ranavirus emergence be used to assess conservation threat?Can patterns of ranavirus emergence be used to assess conservation threat?
Can patterns of ranavirus emergence be used to assess conservation threat?
 
Ranaviruses in snakes, lizards and chelonians
Ranaviruses in snakes, lizards and cheloniansRanaviruses in snakes, lizards and chelonians
Ranaviruses in snakes, lizards and chelonians
 
Oasen fællesstrøg
Oasen fællesstrøgOasen fællesstrøg
Oasen fællesstrøg
 
The wood frog as a model to study the pathogenesis and host-pathogen interact...
The wood frog as a model to study the pathogenesis and host-pathogen interact...The wood frog as a model to study the pathogenesis and host-pathogen interact...
The wood frog as a model to study the pathogenesis and host-pathogen interact...
 

Ähnlich wie Chelonian diagnostics, pathology and treatment

Provenge (sipuleucel t)
Provenge (sipuleucel t)Provenge (sipuleucel t)
Provenge (sipuleucel t)Vinblast
 
Dr. Graham Plastow - Resilience and PRRS in a natural disease challenge model
Dr. Graham Plastow - Resilience and PRRS in a natural disease challenge modelDr. Graham Plastow - Resilience and PRRS in a natural disease challenge model
Dr. Graham Plastow - Resilience and PRRS in a natural disease challenge modelJohn Blue
 
Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...
Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...
Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...John Blue
 
Provenge (Sipuleucel T)
Provenge (Sipuleucel T)Provenge (Sipuleucel T)
Provenge (Sipuleucel T)Cytokinine
 
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...John Blue
 
Overview of C difficile Infections - Dr Steve Brecher - November 2010 Symposium
Overview of C difficile Infections - Dr Steve Brecher - November 2010 SymposiumOverview of C difficile Infections - Dr Steve Brecher - November 2010 Symposium
Overview of C difficile Infections - Dr Steve Brecher - November 2010 SymposiumEastern Pennsylvania Branch ASM
 
Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!
Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!
Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!National Ovarian Cancer Coalition
 
Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...
Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...
Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...mjavan2001
 
Cancer vaccine from mice to humans
Cancer vaccine from mice to humansCancer vaccine from mice to humans
Cancer vaccine from mice to humansHoussein A Sater
 
Clinical Impact of New Data From AIDS 2018
Clinical Impact of New Data From AIDS 2018Clinical Impact of New Data From AIDS 2018
Clinical Impact of New Data From AIDS 2018hivlifeinfo
 
Ravi Kumar Xcyton Innovative Diagnostic
Ravi Kumar  Xcyton Innovative DiagnosticRavi Kumar  Xcyton Innovative Diagnostic
Ravi Kumar Xcyton Innovative DiagnosticEmTech
 
2020 Trypanosoma cruzi loop-mediated isothermal.pdf
2020 Trypanosoma cruzi loop-mediated isothermal.pdf2020 Trypanosoma cruzi loop-mediated isothermal.pdf
2020 Trypanosoma cruzi loop-mediated isothermal.pdfJair Téllez
 
Poster benito SIDiLV BVD/BDV
Poster benito SIDiLV BVD/BDVPoster benito SIDiLV BVD/BDV
Poster benito SIDiLV BVD/BDVSergio Exopol
 
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...John Blue
 
Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...
Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...
Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...Omega Cantrell
 
what is new in prevention, diagnosis and treatment of tuberculosis tb short.pptx
what is new in prevention, diagnosis and treatment of tuberculosis tb short.pptxwhat is new in prevention, diagnosis and treatment of tuberculosis tb short.pptx
what is new in prevention, diagnosis and treatment of tuberculosis tb short.pptxPathKind Labs
 
Automated hematology analyzer as a cost effective aid to screen and monitor s...
Automated hematology analyzer as a cost effective aid to screen and monitor s...Automated hematology analyzer as a cost effective aid to screen and monitor s...
Automated hematology analyzer as a cost effective aid to screen and monitor s...nisaiims
 

Ähnlich wie Chelonian diagnostics, pathology and treatment (20)

Provenge (sipuleucel t)
Provenge (sipuleucel t)Provenge (sipuleucel t)
Provenge (sipuleucel t)
 
Dr. Graham Plastow - Resilience and PRRS in a natural disease challenge model
Dr. Graham Plastow - Resilience and PRRS in a natural disease challenge modelDr. Graham Plastow - Resilience and PRRS in a natural disease challenge model
Dr. Graham Plastow - Resilience and PRRS in a natural disease challenge model
 
Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...
Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...
Dr. Luiza Roos - Mycoplasma Hyopneumoniae Control: Investigating The Gilt Acc...
 
Provenge (Sipuleucel T)
Provenge (Sipuleucel T)Provenge (Sipuleucel T)
Provenge (Sipuleucel T)
 
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
 
Overview of C difficile Infections - Dr Steve Brecher - November 2010 Symposium
Overview of C difficile Infections - Dr Steve Brecher - November 2010 SymposiumOverview of C difficile Infections - Dr Steve Brecher - November 2010 Symposium
Overview of C difficile Infections - Dr Steve Brecher - November 2010 Symposium
 
2004 MHV
2004 MHV2004 MHV
2004 MHV
 
Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!
Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!
Immunotherapy and Recurrent Ovarian Cancer: Time for New Paradigms!
 
Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...
Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...
Sipuleucel_T Immunotherapy for Metastatic Prostate Cancer after Failing Hormo...
 
Austin Virology and Retrovirology
Austin Virology and RetrovirologyAustin Virology and Retrovirology
Austin Virology and Retrovirology
 
pcr.pdf
pcr.pdfpcr.pdf
pcr.pdf
 
Cancer vaccine from mice to humans
Cancer vaccine from mice to humansCancer vaccine from mice to humans
Cancer vaccine from mice to humans
 
Clinical Impact of New Data From AIDS 2018
Clinical Impact of New Data From AIDS 2018Clinical Impact of New Data From AIDS 2018
Clinical Impact of New Data From AIDS 2018
 
Ravi Kumar Xcyton Innovative Diagnostic
Ravi Kumar  Xcyton Innovative DiagnosticRavi Kumar  Xcyton Innovative Diagnostic
Ravi Kumar Xcyton Innovative Diagnostic
 
2020 Trypanosoma cruzi loop-mediated isothermal.pdf
2020 Trypanosoma cruzi loop-mediated isothermal.pdf2020 Trypanosoma cruzi loop-mediated isothermal.pdf
2020 Trypanosoma cruzi loop-mediated isothermal.pdf
 
Poster benito SIDiLV BVD/BDV
Poster benito SIDiLV BVD/BDVPoster benito SIDiLV BVD/BDV
Poster benito SIDiLV BVD/BDV
 
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
Dr. Michael Murtaugh and Dr. Cheryl Dvorak - Natural Infection, Immunity & Pr...
 
Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...
Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...
Ehrlichia canis in a dog with large granular lymphocytosis, thrombocytopenia,...
 
what is new in prevention, diagnosis and treatment of tuberculosis tb short.pptx
what is new in prevention, diagnosis and treatment of tuberculosis tb short.pptxwhat is new in prevention, diagnosis and treatment of tuberculosis tb short.pptx
what is new in prevention, diagnosis and treatment of tuberculosis tb short.pptx
 
Automated hematology analyzer as a cost effective aid to screen and monitor s...
Automated hematology analyzer as a cost effective aid to screen and monitor s...Automated hematology analyzer as a cost effective aid to screen and monitor s...
Automated hematology analyzer as a cost effective aid to screen and monitor s...
 

Mehr von mgray11

Evaluating Disease and Immunocompetency in Threatened Hellbenders
Evaluating Disease and Immunocompetency in Threatened HellbendersEvaluating Disease and Immunocompetency in Threatened Hellbenders
Evaluating Disease and Immunocompetency in Threatened Hellbendersmgray11
 
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...mgray11
 
Pathogens vs. Pesticides: The Threat to Eastern Hellbenders
Pathogens vs. Pesticides: The Threat to Eastern HellbendersPathogens vs. Pesticides: The Threat to Eastern Hellbenders
Pathogens vs. Pesticides: The Threat to Eastern Hellbendersmgray11
 
Batrachochytrium salamandrivorans: Determining the Risk to North America
Batrachochytrium salamandrivorans: Determining the Risk to North AmericaBatrachochytrium salamandrivorans: Determining the Risk to North America
Batrachochytrium salamandrivorans: Determining the Risk to North Americamgray11
 
Averting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threat
Averting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threatAverting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threat
Averting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threatmgray11
 
Sample collection and shipping: what's important and why
Sample collection and shipping: what's important and whySample collection and shipping: what's important and why
Sample collection and shipping: what's important and whymgray11
 
Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...
Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...
Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...mgray11
 
A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...
A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...
A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...mgray11
 
Batrachochytrium salamandrivorans: A review of policy responses in North America
Batrachochytrium salamandrivorans: A review of policy responses in North AmericaBatrachochytrium salamandrivorans: A review of policy responses in North America
Batrachochytrium salamandrivorans: A review of policy responses in North Americamgray11
 
First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...
First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...
First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...mgray11
 
Ranavirus Surveillance Methods
Ranavirus Surveillance MethodsRanavirus Surveillance Methods
Ranavirus Surveillance Methodsmgray11
 
Global Ranavirus Consortium
Global Ranavirus ConsortiumGlobal Ranavirus Consortium
Global Ranavirus Consortiummgray11
 
Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...
Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...
Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...mgray11
 
Ecology of Ranaviruses: State of Understanding
Ecology of Ranaviruses: State of UnderstandingEcology of Ranaviruses: State of Understanding
Ecology of Ranaviruses: State of Understandingmgray11
 
Ranaviruses: Cry Wolf or Real Threat?
Ranaviruses: Cry Wolf or Real Threat?Ranaviruses: Cry Wolf or Real Threat?
Ranaviruses: Cry Wolf or Real Threat?mgray11
 
Ranavirus in Costa Rica
Ranavirus in Costa RicaRanavirus in Costa Rica
Ranavirus in Costa Ricamgray11
 

Mehr von mgray11 (20)

Evaluating Disease and Immunocompetency in Threatened Hellbenders
Evaluating Disease and Immunocompetency in Threatened HellbendersEvaluating Disease and Immunocompetency in Threatened Hellbenders
Evaluating Disease and Immunocompetency in Threatened Hellbenders
 
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
EASTERN HELLBENDER (CRYPTOBRANCHUS ALLEGANIENSIS) CURRENT AND FUTURE RESEARCH...
 
Pathogens vs. Pesticides: The Threat to Eastern Hellbenders
Pathogens vs. Pesticides: The Threat to Eastern HellbendersPathogens vs. Pesticides: The Threat to Eastern Hellbenders
Pathogens vs. Pesticides: The Threat to Eastern Hellbenders
 
Batrachochytrium salamandrivorans: Determining the Risk to North America
Batrachochytrium salamandrivorans: Determining the Risk to North AmericaBatrachochytrium salamandrivorans: Determining the Risk to North America
Batrachochytrium salamandrivorans: Determining the Risk to North America
 
Averting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threat
Averting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threatAverting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threat
Averting a biodiversity crisis: AmphibiaWeb addresses the new Bsal threat
 
Sample collection and shipping: what's important and why
Sample collection and shipping: what's important and whySample collection and shipping: what's important and why
Sample collection and shipping: what's important and why
 
Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...
Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...
Risk Assessment of Batrachochytrium salamandrivorans Introduction into the Un...
 
A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...
A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...
A brief introduction to Batrachochytrium salamandrivorans (Bsal) and the thre...
 
Batrachochytrium salamandrivorans: A review of policy responses in North America
Batrachochytrium salamandrivorans: A review of policy responses in North AmericaBatrachochytrium salamandrivorans: A review of policy responses in North America
Batrachochytrium salamandrivorans: A review of policy responses in North America
 
First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...
First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...
First Steps Toward a National Strategic Plan for Batrachochytrium salamandriv...
 
Ranavirus Surveillance Methods
Ranavirus Surveillance MethodsRanavirus Surveillance Methods
Ranavirus Surveillance Methods
 
Global Ranavirus Consortium
Global Ranavirus ConsortiumGlobal Ranavirus Consortium
Global Ranavirus Consortium
 
Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...
Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...
Ranavirus: an emerging pathogen in amphibian, fish and reptile populations in...
 
Ecology of Ranaviruses: State of Understanding
Ecology of Ranaviruses: State of UnderstandingEcology of Ranaviruses: State of Understanding
Ecology of Ranaviruses: State of Understanding
 
Ranaviruses: Cry Wolf or Real Threat?
Ranaviruses: Cry Wolf or Real Threat?Ranaviruses: Cry Wolf or Real Threat?
Ranaviruses: Cry Wolf or Real Threat?
 
Spitzen
SpitzenSpitzen
Spitzen
 
Mazzoni
MazzoniMazzoni
Mazzoni
 
Ranavirus in Costa Rica
Ranavirus in Costa RicaRanavirus in Costa Rica
Ranavirus in Costa Rica
 
Brunner
BrunnerBrunner
Brunner
 
Warne
WarneWarne
Warne
 

Kürzlich hochgeladen

Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfPoh-Sun Goh
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds  in the ClassroomFostering Friendships - Enhancing Social Bonds  in the Classroom
Fostering Friendships - Enhancing Social Bonds in the ClassroomPooky Knightsmith
 
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...Pooja Bhuva
 
How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17Celine George
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxJisc
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.pptRamjanShidvankar
 
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptxOn_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptxPooja Bhuva
 
Google Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptxGoogle Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptxDr. Sarita Anand
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Jisc
 
Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)Jisc
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfNirmal Dwivedi
 
Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsKarakKing
 
NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...
NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...
NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...Amil baba
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptxMaritesTamaniVerdade
 
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxPooja Bhuva
 
Plant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptxPlant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptxUmeshTimilsina1
 
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptxHMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptxmarlenawright1
 
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...Nguyen Thanh Tu Collection
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.MaryamAhmad92
 

Kürzlich hochgeladen (20)

Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdf
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds  in the ClassroomFostering Friendships - Enhancing Social Bonds  in the Classroom
Fostering Friendships - Enhancing Social Bonds in the Classroom
 
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
Beyond_Borders_Understanding_Anime_and_Manga_Fandom_A_Comprehensive_Audience_...
 
How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptx
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Application orientated numerical on hev.ppt
Application orientated numerical on hev.pptApplication orientated numerical on hev.ppt
Application orientated numerical on hev.ppt
 
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptxOn_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx
 
Google Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptxGoogle Gemini An AI Revolution in Education.pptx
Google Gemini An AI Revolution in Education.pptx
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)
 
Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)Jamworks pilot and AI at Jisc (20/03/2024)
Jamworks pilot and AI at Jisc (20/03/2024)
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
 
Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functions
 
NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...
NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...
NO1 Top Black Magic Specialist In Lahore Black magic In Pakistan Kala Ilam Ex...
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
 
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptx
 
Plant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptxPlant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptx
 
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptxHMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
HMCS Vancouver Pre-Deployment Brief - May 2024 (Web Version).pptx
 
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
TỔNG ÔN TẬP THI VÀO LỚP 10 MÔN TIẾNG ANH NĂM HỌC 2023 - 2024 CÓ ĐÁP ÁN (NGỮ Â...
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.
 

Chelonian diagnostics, pathology and treatment

  • 1. Chelonian Diagnostics, Pathology, and Treatment Matt Allender, DVM, MS, PhD, Diplomate ACZM Ranavirus Symposium July 2013 @Turtle_Doc #RV13
  • 2. Ranavirus epidemiology  Disease events are often clustered in local epizootics  Some occur on annual basis  Several sources report a significant threat to biodiversity  Population density mortality in salamander studies  Environmental factors change prevalence  Restoration efforts
  • 3.
  • 4. Quantitative PCR  TaqMan primer-probes were designed using Primer Express targeting a portion of the MCP that was contained within the 531 bp product  Forward: AACGCCGACCGAAAACTG  Reverse: GCTGCCAAGATGTCGGGTAA  Probe: CCGGCTTTCGGGC  Resultant segment was a 54 bp product
  • 5. Conventional PCR Level of Detection: 529,000 viral copies 52 viral copies Quantitative PCR
  • 6.
  • 7. Epidemiologic evidence Category Institution FV3 positive FV3 negative Prevalence 95% CI Free-living* OR 1 308 0.3% 0 – 1.8 % Rehabilitation* 7 217 3.13% 1.5 – 6.3% UT 3 35 7.9% 2.7 – 20.1 % WCV 2 120 1.6% 0.4 – 5.9 % NCSU 0 46 0.00% 0 – 7.7 % AWC 2 14 14.3% 4.0 – 39.9 % UGA 0 9 0.00% 0 – 29.9 % Total 8 525 1.5% 0.8 – 2.9% * Significant difference between prevalence in free-living population and rehabilitation populations, p=0.01, one-tailed
  • 8. Results Variable FV3 positive FV3 negative Prevalence 95% CI Female 3 168 1.8 % 0.6 – 5.0 % Male 0 218 0.00% 0 – 1.7 % Adult 2 398 0.5 % 0.1 – 1.8 % Juvenile 2 55 3.5 % 0.9 – 11.9 % Sex: p=0.157, observed power = 0.73 Age: p=0.081, observed power = 0.91
  • 9. Housing  Environmental chamber within Division of Animal Resources at UI-CVM  15’9” x 12”  Temperature was acclimated for 1 week prior to beginning study  Recorded daily and maintained +/- 1°C throughout duration of study  Adult female red-eared sliders maintained in 45 or 50 gallon plastic enclosures with ~20 gallons freshwater and basking spot
  • 10. Virus  Ranavirus isolated from infected eastern box turtle  100% sequence homology to MCP of FV3  Grown to confluence in TH-1  Divided into aliquots of 5 x 105 TCID50  Quantitative PCR performed on virus  Four animal in each temperature group were administered 1 aliquot (0.67 ml) in the right forelimb muscle  Uninfected controls administered same volume crude cell lysate
  • 11. Sample collection  Weight, whole blood, oral and cloacal swabs collected twice prior to inoculation to confirm negative status, then twice weekly throughout duration of study  PCV, TS, WBC, differential performed each sample  Clinical signs were recorded daily  Animals were euthanized when clinical signs were severe (as described in IACUC) or at 30 days post- inoculation  Control animal was euthanized at same time as inoculated animal  Gross necropsy performed within 48 hours  Histopathology of 8 tissues  qPCR of necropsy tissues
  • 12. Results  Survival  22°C – all inoculated turtles were euthanized due to severity of signs  28°C – only 2 turtles were euthanized due to clinical signs  One uninfected control died of sepsis  Median survival times  22°C = 24 days (14 -30)  28°C = 30 days (17-30) 22C 28C
  • 13. Results  *Significant increase over time (F=11.1, p=0.045)  Significant difference between control and inoculated turtles (p=0.035)  #Significant increase over time (F=7.13, p=0.026) Time 22°C Weight 28°C Weight Pre-inoculation 1693.5625* 2063.1250# Initial post- inoculation 1692.50* 2082.50# Terminal 1802.50* 2159.50#
  • 14.
  • 15.
  • 16.
  • 17. Results Tissue Parameter 22C Viral Copies 28C Viral Copies Tongue Mean/median* 1.25 x 109* 5.94 x 106* Skeletal Muscle Mean/median* 3.7 x 1010* 3.64 x 108* Lung Mean/median* 6.29 x 109* 5.01 x 109* Heart# Mean/median* 2.92 x 1010 1.27 x 109* Liver^ Mean/median* 2.15 x 109 1.70 x 107* Spleen Mean/median* 2.23 x 1010* 5.44 x 107* Ovary Mean/median* 8.93 x 109* 9.06 x 106* Kidney Mean/median* 3.46 x 1010* 2.54 x 108* # Significant difference between environmental temperatures, p=0.012 ^ Significant difference between environmental temperatures, p=0.011
  • 19. Temperature evidence  Mortality  22°C  Significant association between inoculation and disease (p=0.014)  28°C  No significant association between inoculation and disease (p=0.214)  Non-significant mortality was seen at lower temperature (100%) than higher temperature (50%)  Power = 0.34
  • 20. Temperature evidence  qPCR  Viral copies quickly went from undetectable to millions/billions of copies  All positive turtles had between 2 and 4 positive samples prior to death  Highest in whole blood, lowest in cloacal swab (non- significant) at 22°C  Specificity and Sensitivity  Whole blood  100% specific and 100% sensitive  Oral swab and cloacal swab  100% specific and 83% sensitive
  • 21.
  • 23.
  • 24.
  • 25. Conclusions  Prevalence in surveys of free-ranging populations are low  Are chelonians a spill-over host?  Natural history characteristics make it difficult to identify mortality events?  Are chelonians a reservoir host and fail to develop signs?  Are mechanisms of transmission different in chelonians which provide natural protection?
  • 26. Conclusions  Environmental temperature leads to differences in mortality in red-eared sliders  Both host and pathogen factors that may lead to protection at higher temperatures  May play a role in persistence or transmission  Do other species have similar response to changes in temperature?  Opportunity for therapeutic intervention
  • 27. Funding Sources  Morris Animal Foundation  qPCR development and prevalence study  CRESO  Prevalence study  Fluker’s Farms/Cox Pharmacology lab  PK study