SlideShare ist ein Scribd-Unternehmen logo
1 von 6
Week 5 Assignment B View the assignment video on the week
5 page FIRST. This is one of the more difficult assignments you
will do all semester. Work your way through one step at a time,
using the examples to help you. If you need help, ASK!
The crime lab collected evidence from the scene of the crime –
specifically, hair and blood samples. Now it is time for you to
analyze the data and figure out “who done it”. You will do this
by creating a DNA fingerprint with the samples that were
collected.
As you learned in the mini-lecture, a DNA fingerprint is
collected using the following methods
· Cut the DNA into pieces using restriction enzymes
· Copy the DNA many times to get more of it to work with
· “Run” the DNA through a gel to separate the different pieces
(gel electrophoresis), which will separate the pieces of cut DNA
by size
You are going to do this for the various samples you collected
from the crime scene, and use that data to solve the crime.
Step 1.Cut the DNA into pieces using restriction enzymes. You
use the restriction enzyme HaeIII to cut the DNA into pieces.
HaeIII cuts the following way:
AAGGCCTAG gets cut into AAGG CCTAG
TTCCGGATC TTCC
GGATC
So, every time the enzyme encounters the sequence “GGCC”,
the DNA strand it cut between the G’s and C’s.
The DNA samples we are working with contain 2 short tandem
repeat (STR) segments. The first repeat is CCACGT, and the
second is CGC. Cut the DNA with the restriction enzyme,
HaeIII. The first DNA sample (victim) is cut for you. Determine
how many base pairs (bp) long each piece of DNA is once it has
been cut.
(a) Victim:
CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC
GCCGCCGCGGCCA
GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG
CGGCGGCGCCGGT
Answer:
Site 1: (16bp long) Site 2: (25bp long)
CCGAGAGG CCCCACGTCCACGTGG
CCCGCCGCCGCCGCCGCCGCCGCGG CCA
GGCTCTCC GGGGTGCAGGTGCACC
GGGCGGCGGCGGCGGCGGCGGCGCC GGT
The enzyme cut each time the target sequence appeared in our
DNA sample. We counted the length (in base pairs) of the DNA
pieces between the cuts. Cut the remaining DNA samples
yourself, and determine how many base pairs each is.
(b) Suspect #1:
CCAGGCCCCACGTCCACGTCCACGTGGCCCGCCGCCGCGG
CCTAAAGAGGCTA
GGTCCGGGGTGCAGGTGCAGGTGCACCGGGCGGCGGCGC
CGGATTTCTCCGAT
Answer: Site 1 Site #2
c) Suspect #2
CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC
GCCGCGGCCTAAA
GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG
CGGCGCCGGATTT
Answer: Site 1 Site #2
d) Evidence (hair sample)
CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC
GCCGCGGCCTAAA
GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG
CGGCGCCGGATTT
Answer: Site 1 Site #2
e) Evidence (blood sample)
CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC
GCCGCCGCGGCCA
GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG
CGGCGGCGCCGGT
Answer: Site 1 Site #2
Step 2. You use a machine to make many copies of your DNA
pieces.
(assignment continues below)
Step 3.Gel Electrophoresis. You place you cut DNA samples
into a gel electrophoresis machine. You have already
determined how big each of your DNA pieces is (above). Use
that information to draw what the gel would look from these
samples. Each sample (victim, hair, etc) will have 2 bands on
the gel – once for each of the cut pieces of DNA. Draw those on
the gel below. The first (victim) is done for you.
Tech Tip: To draw on the gel, click on one of existing purple
lines for the victim, copy, then paste. Move the line to the
appropriate space on the gel. You may not be able to get the
line exactly where you want it – but close counts in this
assignment!
(
Victim
) (
Blood
) (
Hair
) (
S #2
) (
S #1
) Gel
(
50
bp
)
(
40
bp
)
(
15
bp
) (
5
bp
) (
10
bp
) (
20
bp
) (
30
bp
)(assignment continues below)
Step 4.Analysis. Based on the DNA evidence above, answer the
following questions.
a) What conclusions can you make about the DNA collected
from the hair sample left at the scene of the crime? How do you
know?
b) What conclusions can you make about the DNA collected
from the blood sample left at the scene of the crime? How do
you know?
c) Who do you think committed the crime? What evidence is
there to support this?
Week 5 Assignment B   View the assignment video on the week 5 page.docx

Weitere ähnliche Inhalte

Ähnlich wie Week 5 Assignment B View the assignment video on the week 5 page.docx

Biotech labs - restriction digest and transformation
Biotech labs - restriction digest and transformationBiotech labs - restriction digest and transformation
Biotech labs - restriction digest and transformationStephanie Beck
 
DNA cell cycle by flow cytometry
DNA cell cycle by flow cytometryDNA cell cycle by flow cytometry
DNA cell cycle by flow cytometryRichard Hastings
 
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRXDeep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRXBioInformaticsGRX
 
DNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIMEDNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIMEPundlik Rathod
 
Data Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil TamangData Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil TamangApil Tamang
 
Restriction mapping of bacterial dna
Restriction mapping of bacterial dnaRestriction mapping of bacterial dna
Restriction mapping of bacterial dnaAtai Rabby
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprintingsherwen
 
Cyto 2015 Forensic Flow Cytometry Tutorial
Cyto 2015 Forensic Flow Cytometry TutorialCyto 2015 Forensic Flow Cytometry Tutorial
Cyto 2015 Forensic Flow Cytometry TutorialPratip Chattopadhyay
 
Development of a low cost pc-based single-channel eeg monitoring system
Development of a low cost pc-based single-channel eeg monitoring systemDevelopment of a low cost pc-based single-channel eeg monitoring system
Development of a low cost pc-based single-channel eeg monitoring systemMd Kafiul Islam
 
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docxCSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docxfaithxdunce63732
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprintingmantoshrock
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshopc.titus.brown
 
Genotype Imputation via Matrix Completion
Genotype Imputation via Matrix CompletionGenotype Imputation via Matrix Completion
Genotype Imputation via Matrix Completionechi99
 

Ähnlich wie Week 5 Assignment B View the assignment video on the week 5 page.docx (20)

Biotech labs - restriction digest and transformation
Biotech labs - restriction digest and transformationBiotech labs - restriction digest and transformation
Biotech labs - restriction digest and transformation
 
DNA cell cycle by flow cytometry
DNA cell cycle by flow cytometryDNA cell cycle by flow cytometry
DNA cell cycle by flow cytometry
 
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRXDeep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
Deep Learning aplicado al diagnostico de Alzheimer | BioInformaticsGRX
 
DNA Profiling_HMD_2020.pptx
DNA Profiling_HMD_2020.pptxDNA Profiling_HMD_2020.pptx
DNA Profiling_HMD_2020.pptx
 
Dna sequencing
Dna sequencingDna sequencing
Dna sequencing
 
Dna forensic
Dna forensicDna forensic
Dna forensic
 
DNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIMEDNA MUGSHOTS AGAINST CRIME
DNA MUGSHOTS AGAINST CRIME
 
Data Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil TamangData Mining-Project Report Gene Classification using Neural Network- Apil Tamang
Data Mining-Project Report Gene Classification using Neural Network- Apil Tamang
 
Restriction mapping of bacterial dna
Restriction mapping of bacterial dnaRestriction mapping of bacterial dna
Restriction mapping of bacterial dna
 
BioAlg02.ppt
BioAlg02.pptBioAlg02.ppt
BioAlg02.ppt
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
SNP
SNPSNP
SNP
 
Cyto 2015 Forensic Flow Cytometry Tutorial
Cyto 2015 Forensic Flow Cytometry TutorialCyto 2015 Forensic Flow Cytometry Tutorial
Cyto 2015 Forensic Flow Cytometry Tutorial
 
8 x8m guide
8 x8m guide8 x8m guide
8 x8m guide
 
Development of a low cost pc-based single-channel eeg monitoring system
Development of a low cost pc-based single-channel eeg monitoring systemDevelopment of a low cost pc-based single-channel eeg monitoring system
Development of a low cost pc-based single-channel eeg monitoring system
 
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docxCSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
CSI_Fredonia pwerpoint.pptxPremiseDNA Evidence is routinel.docx
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
Microarray full detail
Microarray full detailMicroarray full detail
Microarray full detail
 
2013 pag-equine-workshop
2013 pag-equine-workshop2013 pag-equine-workshop
2013 pag-equine-workshop
 
Genotype Imputation via Matrix Completion
Genotype Imputation via Matrix CompletionGenotype Imputation via Matrix Completion
Genotype Imputation via Matrix Completion
 

Mehr von melbruce90096

`Do assignments as detailed outNO WIKI for referncesPlease m.docx
`Do assignments as detailed outNO WIKI for referncesPlease m.docx`Do assignments as detailed outNO WIKI for referncesPlease m.docx
`Do assignments as detailed outNO WIKI for referncesPlease m.docxmelbruce90096
 
_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docx_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docxmelbruce90096
 
[removed]eltomate  Son rojos y se sirven (they are serv.docx
[removed]eltomate  Son rojos y se sirven (they are serv.docx[removed]eltomate  Son rojos y se sirven (they are serv.docx
[removed]eltomate  Son rojos y se sirven (they are serv.docxmelbruce90096
 
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docxmelbruce90096
 
[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docx[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docxmelbruce90096
 
Your paper should be a literary essay in which you present a combina.docx
Your paper should be a literary essay in which you present a combina.docxYour paper should be a literary essay in which you present a combina.docx
Your paper should be a literary essay in which you present a combina.docxmelbruce90096
 
[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docx[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docxmelbruce90096
 
Your paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docxYour paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docxmelbruce90096
 
Your Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docxYour Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docxmelbruce90096
 
Your Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docxYour Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docxmelbruce90096
 
Your director is not aware of the involvement of the Department of H.docx
Your director is not aware of the involvement of the Department of H.docxYour director is not aware of the involvement of the Department of H.docx
Your director is not aware of the involvement of the Department of H.docxmelbruce90096
 
YOull need to know The purpose of this research is to focus atte.docx
YOull need to know The purpose of this research is to focus atte.docxYOull need to know The purpose of this research is to focus atte.docx
YOull need to know The purpose of this research is to focus atte.docxmelbruce90096
 
Your draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docxYour draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docxmelbruce90096
 
Your company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docxYour company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docxmelbruce90096
 
Your boss has asked you to write a Project Management Plan. Your pla.docx
Your boss has asked you to write a Project Management Plan. Your pla.docxYour boss has asked you to write a Project Management Plan. Your pla.docx
Your boss has asked you to write a Project Management Plan. Your pla.docxmelbruce90096
 
Your boss has chosen you to give a presentation to a number of forei.docx
Your boss has chosen you to give a presentation to a number of forei.docxYour boss has chosen you to give a presentation to a number of forei.docx
Your boss has chosen you to give a presentation to a number of forei.docxmelbruce90096
 
your assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docxyour assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docxmelbruce90096
 
Your assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docxYour assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docxmelbruce90096
 
your article must be a research article You can tell it is a researc.docx
your article must be a research article You can tell it is a researc.docxyour article must be a research article You can tell it is a researc.docx
your article must be a research article You can tell it is a researc.docxmelbruce90096
 
Your administrator has come to you for information for a present.docx
Your administrator has come to you for information for a present.docxYour administrator has come to you for information for a present.docx
Your administrator has come to you for information for a present.docxmelbruce90096
 

Mehr von melbruce90096 (20)

`Do assignments as detailed outNO WIKI for referncesPlease m.docx
`Do assignments as detailed outNO WIKI for referncesPlease m.docx`Do assignments as detailed outNO WIKI for referncesPlease m.docx
`Do assignments as detailed outNO WIKI for referncesPlease m.docx
 
_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docx_____1.On July 9, Sheb Company sells goods on credit to .docx
_____1.On July 9, Sheb Company sells goods on credit to .docx
 
[removed]eltomate  Son rojos y se sirven (they are serv.docx
[removed]eltomate  Son rojos y se sirven (they are serv.docx[removed]eltomate  Son rojos y se sirven (they are serv.docx
[removed]eltomate  Son rojos y se sirven (they are serv.docx
 
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
[u07d2] Unit 7 Discussion 2Conflict and ChangeResourcesDiscuss.docx
 
[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docx[removed]1.Which of the following processes addresses when to sp.docx
[removed]1.Which of the following processes addresses when to sp.docx
 
Your paper should be a literary essay in which you present a combina.docx
Your paper should be a literary essay in which you present a combina.docxYour paper should be a literary essay in which you present a combina.docx
Your paper should be a literary essay in which you present a combina.docx
 
[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docx[removed]1.Photographs are an important source of data because t.docx
[removed]1.Photographs are an important source of data because t.docx
 
Your paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docxYour paper should address the following questionsWhen you hear th.docx
Your paper should address the following questionsWhen you hear th.docx
 
Your Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docxYour Final Project from this course will enable you to compare cultu.docx
Your Final Project from this course will enable you to compare cultu.docx
 
Your Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docxYour Final Paper is to be a comprehensive research study on one of t.docx
Your Final Paper is to be a comprehensive research study on one of t.docx
 
Your director is not aware of the involvement of the Department of H.docx
Your director is not aware of the involvement of the Department of H.docxYour director is not aware of the involvement of the Department of H.docx
Your director is not aware of the involvement of the Department of H.docx
 
YOull need to know The purpose of this research is to focus atte.docx
YOull need to know The purpose of this research is to focus atte.docxYOull need to know The purpose of this research is to focus atte.docx
YOull need to know The purpose of this research is to focus atte.docx
 
Your draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docxYour draft should establish and develop a single thesis [or co.docx
Your draft should establish and develop a single thesis [or co.docx
 
Your company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docxYour company has just hired your foreign friend to work in a middle-.docx
Your company has just hired your foreign friend to work in a middle-.docx
 
Your boss has asked you to write a Project Management Plan. Your pla.docx
Your boss has asked you to write a Project Management Plan. Your pla.docxYour boss has asked you to write a Project Management Plan. Your pla.docx
Your boss has asked you to write a Project Management Plan. Your pla.docx
 
Your boss has chosen you to give a presentation to a number of forei.docx
Your boss has chosen you to give a presentation to a number of forei.docxYour boss has chosen you to give a presentation to a number of forei.docx
Your boss has chosen you to give a presentation to a number of forei.docx
 
your assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docxyour assignment is to submit a presentation on Native-American liter.docx
your assignment is to submit a presentation on Native-American liter.docx
 
Your assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docxYour assignment is to report on TWO cultural experience visits y.docx
Your assignment is to report on TWO cultural experience visits y.docx
 
your article must be a research article You can tell it is a researc.docx
your article must be a research article You can tell it is a researc.docxyour article must be a research article You can tell it is a researc.docx
your article must be a research article You can tell it is a researc.docx
 
Your administrator has come to you for information for a present.docx
Your administrator has come to you for information for a present.docxYour administrator has come to you for information for a present.docx
Your administrator has come to you for information for a present.docx
 

Kürzlich hochgeladen

latest AZ-104 Exam Questions and Answers
latest AZ-104 Exam Questions and Answerslatest AZ-104 Exam Questions and Answers
latest AZ-104 Exam Questions and Answersdalebeck957
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfNirmal Dwivedi
 
Tatlong Kwento ni Lola basyang-1.pdf arts
Tatlong Kwento ni Lola basyang-1.pdf artsTatlong Kwento ni Lola basyang-1.pdf arts
Tatlong Kwento ni Lola basyang-1.pdf artsNbelano25
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17Celine George
 
Towards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptxTowards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptxJisc
 
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptxHMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptxEsquimalt MFRC
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxJisc
 
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxPooja Bhuva
 
How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17Celine George
 
Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsKarakKing
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSCeline George
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds  in the ClassroomFostering Friendships - Enhancing Social Bonds  in the Classroom
Fostering Friendships - Enhancing Social Bonds in the ClassroomPooky Knightsmith
 
Philosophy of china and it's charactistics
Philosophy of china and it's charactisticsPhilosophy of china and it's charactistics
Philosophy of china and it's charactisticshameyhk98
 
Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx
Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptxExploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx
Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptxPooja Bhuva
 
Plant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptxPlant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptxUmeshTimilsina1
 
General Principles of Intellectual Property: Concepts of Intellectual Proper...
General Principles of Intellectual Property: Concepts of Intellectual  Proper...General Principles of Intellectual Property: Concepts of Intellectual  Proper...
General Principles of Intellectual Property: Concepts of Intellectual Proper...Poonam Aher Patil
 
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptxCOMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptxannathomasp01
 
Graduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - EnglishGraduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - Englishneillewis46
 
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...ZurliaSoop
 

Kürzlich hochgeladen (20)

latest AZ-104 Exam Questions and Answers
latest AZ-104 Exam Questions and Answerslatest AZ-104 Exam Questions and Answers
latest AZ-104 Exam Questions and Answers
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
 
Tatlong Kwento ni Lola basyang-1.pdf arts
Tatlong Kwento ni Lola basyang-1.pdf artsTatlong Kwento ni Lola basyang-1.pdf arts
Tatlong Kwento ni Lola basyang-1.pdf arts
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17
 
Towards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptxTowards a code of practice for AI in AT.pptx
Towards a code of practice for AI in AT.pptx
 
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptxHMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
 
Wellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptxWellbeing inclusion and digital dystopias.pptx
Wellbeing inclusion and digital dystopias.pptx
 
Interdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptxInterdisciplinary_Insights_Data_Collection_Methods.pptx
Interdisciplinary_Insights_Data_Collection_Methods.pptx
 
How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17How to Add New Custom Addons Path in Odoo 17
How to Add New Custom Addons Path in Odoo 17
 
Salient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functionsSalient Features of India constitution especially power and functions
Salient Features of India constitution especially power and functions
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POS
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds  in the ClassroomFostering Friendships - Enhancing Social Bonds  in the Classroom
Fostering Friendships - Enhancing Social Bonds in the Classroom
 
Philosophy of china and it's charactistics
Philosophy of china and it's charactisticsPhilosophy of china and it's charactistics
Philosophy of china and it's charactistics
 
Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024Mehran University Newsletter Vol-X, Issue-I, 2024
Mehran University Newsletter Vol-X, Issue-I, 2024
 
Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx
Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptxExploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx
Exploring_the_Narrative_Style_of_Amitav_Ghoshs_Gun_Island.pptx
 
Plant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptxPlant propagation: Sexual and Asexual propapagation.pptx
Plant propagation: Sexual and Asexual propapagation.pptx
 
General Principles of Intellectual Property: Concepts of Intellectual Proper...
General Principles of Intellectual Property: Concepts of Intellectual  Proper...General Principles of Intellectual Property: Concepts of Intellectual  Proper...
General Principles of Intellectual Property: Concepts of Intellectual Proper...
 
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptxCOMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
COMMUNICATING NEGATIVE NEWS - APPROACHES .pptx
 
Graduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - EnglishGraduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - English
 
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
 

Week 5 Assignment B View the assignment video on the week 5 page.docx

  • 1. Week 5 Assignment B View the assignment video on the week 5 page FIRST. This is one of the more difficult assignments you will do all semester. Work your way through one step at a time, using the examples to help you. If you need help, ASK! The crime lab collected evidence from the scene of the crime – specifically, hair and blood samples. Now it is time for you to analyze the data and figure out “who done it”. You will do this by creating a DNA fingerprint with the samples that were collected. As you learned in the mini-lecture, a DNA fingerprint is collected using the following methods · Cut the DNA into pieces using restriction enzymes · Copy the DNA many times to get more of it to work with · “Run” the DNA through a gel to separate the different pieces (gel electrophoresis), which will separate the pieces of cut DNA by size You are going to do this for the various samples you collected from the crime scene, and use that data to solve the crime. Step 1.Cut the DNA into pieces using restriction enzymes. You use the restriction enzyme HaeIII to cut the DNA into pieces. HaeIII cuts the following way: AAGGCCTAG gets cut into AAGG CCTAG TTCCGGATC TTCC GGATC So, every time the enzyme encounters the sequence “GGCC”, the DNA strand it cut between the G’s and C’s.
  • 2. The DNA samples we are working with contain 2 short tandem repeat (STR) segments. The first repeat is CCACGT, and the second is CGC. Cut the DNA with the restriction enzyme, HaeIII. The first DNA sample (victim) is cut for you. Determine how many base pairs (bp) long each piece of DNA is once it has been cut. (a) Victim: CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC GCCGCCGCGGCCA GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG CGGCGGCGCCGGT Answer: Site 1: (16bp long) Site 2: (25bp long) CCGAGAGG CCCCACGTCCACGTGG CCCGCCGCCGCCGCCGCCGCCGCGG CCA GGCTCTCC GGGGTGCAGGTGCACC GGGCGGCGGCGGCGGCGGCGGCGCC GGT The enzyme cut each time the target sequence appeared in our DNA sample. We counted the length (in base pairs) of the DNA pieces between the cuts. Cut the remaining DNA samples yourself, and determine how many base pairs each is. (b) Suspect #1: CCAGGCCCCACGTCCACGTCCACGTGGCCCGCCGCCGCGG CCTAAAGAGGCTA GGTCCGGGGTGCAGGTGCAGGTGCACCGGGCGGCGGCGC CGGATTTCTCCGAT Answer: Site 1 Site #2 c) Suspect #2
  • 3. CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC GCCGCGGCCTAAA GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG CGGCGCCGGATTT Answer: Site 1 Site #2 d) Evidence (hair sample) CCAGGCCCCACGTGGCCCGCCGCCGCCGCCGCCGCCGCC GCCGCGGCCTAAA GGTCCGGGGTGCACCGGGCGGCGGCGGCGGCGGCGGCGG CGGCGCCGGATTT Answer: Site 1 Site #2 e) Evidence (blood sample) CCGAGAGGCCCCACGTCCACGTGGCCCGCCGCCGCCGCC GCCGCCGCGGCCA GGCTCTCCGGGGTGCAGGTGCACCGGGCGGCGGCGGCGG CGGCGGCGCCGGT Answer: Site 1 Site #2 Step 2. You use a machine to make many copies of your DNA pieces. (assignment continues below) Step 3.Gel Electrophoresis. You place you cut DNA samples into a gel electrophoresis machine. You have already determined how big each of your DNA pieces is (above). Use
  • 4. that information to draw what the gel would look from these samples. Each sample (victim, hair, etc) will have 2 bands on the gel – once for each of the cut pieces of DNA. Draw those on the gel below. The first (victim) is done for you. Tech Tip: To draw on the gel, click on one of existing purple lines for the victim, copy, then paste. Move the line to the appropriate space on the gel. You may not be able to get the line exactly where you want it – but close counts in this assignment! ( Victim ) ( Blood ) ( Hair ) ( S #2 ) ( S #1 ) Gel ( 50 bp ) ( 40 bp )
  • 5. ( 15 bp ) ( 5 bp ) ( 10 bp ) ( 20 bp ) ( 30 bp )(assignment continues below) Step 4.Analysis. Based on the DNA evidence above, answer the following questions. a) What conclusions can you make about the DNA collected from the hair sample left at the scene of the crime? How do you know? b) What conclusions can you make about the DNA collected from the blood sample left at the scene of the crime? How do you know? c) Who do you think committed the crime? What evidence is there to support this?