It is one of the best method limiting the Proteases use in the Affinity Chromatography.

1. INVITRO MUTAGENESIS OF ChBD(CHITIN BINDING DOMAIN)TO CREATE AN ELUTABLE AFFINITY TAG BY SAI KRISHNA KOUNDINYA.N

2. IN VITRO MUTAGENESIS : Today molecular technology that is available at hand can be used create desirable mutation under in vitro condition. It is not just creating random mutations; it is now possible to create mutations to create new codons, new messages and new characters. Site-directed mutagenesis using oligonucleotides was first described in 1978. Michael Smith, its pioneer, shared the Nobel Prize in Chemistry in October 1993 with Kary B. Mullis, who invented polymerase chain reaction. In this case the change is directed to one or more specific nucleotides thus one can change only one of the codons by designing specific primers. It is a major tool in the protein engineering and has a vast applications. INTRODUCTION

3. Chitinase is a glycosylhydrolase that catalyzes the hydrolytic degradation of chitin. chitinases, A1 encoded by the chiAgene. It is produced most abundantly and exhibits the highest activity as to the hydrolysis of colloidal chitin and a high affinity to insoluble chitin. The C-terminal chitin-binding domain (ChBDChiA1) is required for ChiA1 to bind specifically to insoluble chitin and to hydrolyze it efficiently. A relevant studies on chitin binding domains showed that mutations in the catalytic sites of Chitinases has a great importance in the purification of protein. GENE SEQUENCE OF CHITIN BINDING DOMAIN (ChBD) acaaatcctggtgtatccgcttggcaggtcaacacagcttatactgcgggacaattggtcacatataacggcaagacgtataaatgtttgcagccccacacctccttggcaggatgggaaccatccaacgttcctgccttgtggcagcttcaa CHITINASAES & CHITIN BINDING DOMAIN :

4. To bring out the site mediated mutations in the ChBD sequence. Cloning of the mutated ChBD sequence. Expression of Chbd protein. Check out for the reversible elution in affinity chromatography OBJECTIVE

5. ISOLATION OF PLASMID: Add solution 1,2,3 of about to culture pellet. Centrifuge the solution at 12000rpm for 10 min. Add phenol and chloroform and iso amyl alcohol (24:1) to the solution . Centrifuge and collect the upper aqueous layer . Add chloroform am iso amyl alcohol to the solution ,centrifuge it and collect the supernatent. Add isopropanol and centrifuge . Drain off supernatent and dissolve the pellet in TE buffer. PLAN OF ACTION

6. PRIMER DESIGNING : Generally primer designing is computer aided and to design the primer that was specific to the chitin binding domain of chitinase A1 gene, help of a primer designing tool of VECTOR NTI software was taken. ’ Forward primer 5’- catatggacaaatcctggtgtatccgc – 3’ Reverse primer Outer 5’- gaattcttgaagctgccacaagcaggaacg – 3’ Reverse primer Inner 5’ –ggcaggaacgttggatggttcaaatcctgcca -3’

7. POLYMERASE CHAIN REACTON : Polymerase chain reaction is performed by designing a specific program including denaturation , annealing, extension steps . Add all contents and perform PCR . After the completion of the PCR, performed the agarose gel electrophoresis with 1.5% gel concentration.

8. GEL ELUTION : Excise the DNA fragment from the agarose gel with a clean scalpel. Add binding buffer to the excised fragment and kept at 50ºc till the gel dissolves. Centrifuge the solution and discard the supernatent. Add wash buffer to the column and centrifuge ,discard the supernatent. In the final step add elution buffer to column and centrifuge it and collect it an eppendorf.store it at -20ºc.

9. LIGATION : Combine vector with a 3-fold molar excess of insert. Add 2X Quick Ligation Buffer and mix well. Add 1 μl of Quick T4 DNA Ligase and mix thoroughly. Incubate the solution at 4ºc for overnight.

10. TRANSFORMATION : Preparation of competent cells : Inoculate the LB broth with bacterial culture and grow it till the O.D. reaches 0.6-0.8. Add 0.1M cacl2 to the culture pellet and kept for 1 hour incubation. Centrifuge and add again 0.1M cacl2 solution to prepare competent cells. Transformation : Place the culture on ice,adddna sample to culture an give heat shock at 42ºc. Add L.B. broth to the solution and incubate it till growth came. Centrifuge the culture and again add L.B. medium to pellet. Spread the culture on L.B. agar ampicillin medium.

11. RESTRICTION DIGESTION : Check out the correct enzyme and buffer suitable to the given fragment. Add the components carefully. Incubate the solution at 37ºc for 3 hours. Check the digestion on 1.5% agarose gel electrophoresis by adding 3x loading dye.

12. PROTEIN EXPRESSION : For the purpose of the gene expression one of the colonies of the transformed cells was picked from the plate and was inoculated in the LB broth containing ampicillin. Then2 ml sample was collected and centrifuged to get the pellet. Store the pellet at -20 °C. Now add 1M IPTG to the culture and collected samples at 3hours,6 hours and overnight in the previous way respectively. These samples were checked for expression by using SDS-PAGE gel electrophoresis.

13. SDS PAGE : The gel cassette and casting stand assembly has been done. Then prepare resolving and stacking gels. Sample is prepared by adding protein loading dye and boil the samples for 10min. Add the samples to gel and run the electrophoresis. Stain the gel by using coomassive brilliant blue stain followed by destaining.

14. AFFINITY CHROMATOGRAPHY: Prepare a 10ml affinity column and made a column bed. Add 1ml of chitin beads to column and wait to solidify. Equlibrate the column with column buffer and add the sample completely. collect the folw through. Wash the column with wash buffer and collect it. Add gradients of elution buffer to column and collect the samples. Check the appearance of protein by SDS-PAGE electrophoresis.

15. RESULTS

16. RESULTS DIGESTION OF RECOMBINANT PET VECTOR PROTEIN EXPRESSION AFFINITY CHROMATOGRAPHY

17. CONCLUSION

18. THANK YOU