SlideShare ist ein Scribd-Unternehmen logo
1 von 18
Chapter Four
Genetics and Evolution
Exam One Results
• Your grade is
posted on “My
Grades” in e-
campus
• Any questions???
Service Learning Opportunity
• Don’t forget that you can substitute one of
your exam grades by participating in service
learning
• Click on the “Service Learning” button in e-
campus to learn more about getting
enrolled
Natural Selection
 Natural selection
– introduced by
Darwin in The
Origin of Species in
1859
 Features and the
environment
Genetic Mechanisms
 Chromosomes, Genes, and DNA
 30,000 genes
• http://youtu.be/uN82GLQYAUQ
• Genes and environment
Ques: Can you think of a disorder that may be
affected by the environment for which you may
have a genetic predisposition?
Skin pigmentation is one example of a
continuous trait. (Nature vs. Nurture)
Two important terms...
Phenotype: The outlook of an organism
Genotype: The genetic information written in DNA
ATGTTTCCACCTTCAGGTTCC
ACTGGGCTGATTCCCCCCTCC
CACTTTCAAGCTCGGCCCCTT
TCAACTCAGAGAGGCGGCTA
GACACCCAGAGACCTCAAGT
GACCATGTGGGAACGGGATG
TTTCCAGTGACAGGCAG
GCCAAGAATGGCTCCCACCT
GGCTCTCAGACATTCCCCTGG
TCCAACCCCCAGGCCATCAAG
ATGTCTCAGAGAGGCGGCTAG
ACACCCAGAGACCTCAAGTGA
CCATGTGGGAACGGGATGTTT
CCAGTGACAGGCA
Genotype
Phenotypes
Genotype
The Science of Sex Appeal Video
Groups: What factors make us attracted to others?
Get into groups and try to brainstorm at least 10
factors that affect attraction. What connections
can be made to biological and environmental
factors?
Smell
• http://youtu.be/s_y8NTaPNQY
Facial Attractiveness
• http://youtu.be/MVhKSzSpXMA
Walk
• http://youtu.be/gwdlq95Tnqc
Mating Patterns
Differential parental investment theory
 Polygyny: One male with multiple females
 Polyandry: One female with multiple males
 Monogamy: One male with one female
 Polygynandry: Multiple males with multiple
females
Color Blind Test
• Just a shortened form:
• http://colorvisiontesting.com/online%20t
est.htm
• An evolutionary advantage?
Genetic Mechanisms
Some of the reasons….
• better health care (less serious illnesses that can delay or
damage brain development, less exposure to toxins such
as lead, smog, food poisoning, etc.)
• better nutrition (better availability of fresh foods,
proteins, fats, vitamins, minerals such as iron and iodine,
etc. that are necessary to build and support the brain)
• higher levels of education
• higher cognitive stimulation by an increasingly complex
environment
(Nature vs. Nurture Debate)
TWIN STUDIES
 Reared separately ~ Career choice, food preferences,
facial expressions, medical conditions, similar speech
rhythms, etc.
 Monozygotic (identical) ~ 80% concordance rate in their
sense of happiness
 Dizygotic (fraternal) ~ no concordance in their sense of
happiness
 Identical ~ if one has schizophrenia, the other has a 50%
chance of developing the condition
 Fraternal ~ 27% chance of developing the disorder
ADOPTION STUDIES
Intelligence is more similar to their biological parents than
to their adoptive parents
Fallacies
 Social Darwinism
 Deterministic fallacy
Homework
• Read Chapter Five

Weitere ähnliche Inhalte

Ähnlich wie Psyc 2301 chapter four powerpoint(2)

09-17-2014_slides.pptx
09-17-2014_slides.pptx09-17-2014_slides.pptx
09-17-2014_slides.pptxJhonCastao24
 
Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019
Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019
Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019Vladimir Trajkovski
 
Eugenics used to design babies
Eugenics used to design babiesEugenics used to design babies
Eugenics used to design babiesJayashrita Debnath
 
Global Medical Cures™ | Genetic Testing Handbook
Global Medical Cures™ | Genetic Testing HandbookGlobal Medical Cures™ | Genetic Testing Handbook
Global Medical Cures™ | Genetic Testing HandbookGlobal Medical Cures™
 
Imp of genetic testing
Imp of genetic testingImp of genetic testing
Imp of genetic testingSabahat Ali
 
fundamentals of human genetics (dental).pptx
fundamentals of human genetics (dental).pptxfundamentals of human genetics (dental).pptx
fundamentals of human genetics (dental).pptxayoy911
 
Genetic Disorders.pptx
Genetic Disorders.pptxGenetic Disorders.pptx
Genetic Disorders.pptxWajidZahoor2
 
Dev Psych.ch2.keynote
Dev Psych.ch2.keynoteDev Psych.ch2.keynote
Dev Psych.ch2.keynotejhoegh
 
Genetic Screening and Genetic Counselling ,Applications
Genetic Screening and Genetic Counselling ,ApplicationsGenetic Screening and Genetic Counselling ,Applications
Genetic Screening and Genetic Counselling ,Applicationshephz
 
Exploring your personal genome with free, online bioinformatics tools
Exploring your personal genome with free, online bioinformatics toolsExploring your personal genome with free, online bioinformatics tools
Exploring your personal genome with free, online bioinformatics tools01archivist
 
Research MethodsLearning Objectives You will learn how.docx
Research MethodsLearning Objectives You will learn how.docxResearch MethodsLearning Objectives You will learn how.docx
Research MethodsLearning Objectives You will learn how.docxronak56
 
Identifying Rare Diseases from Behavioural Data: A Machine Learning Approach
Identifying Rare Diseases from Behavioural Data: A Machine Learning ApproachIdentifying Rare Diseases from Behavioural Data: A Machine Learning Approach
Identifying Rare Diseases from Behavioural Data: A Machine Learning ApproachHaley MacLeod
 
What you should know about genetic testing for mitochondrial disorders
What you should know about genetic testing for mitochondrial disordersWhat you should know about genetic testing for mitochondrial disorders
What you should know about genetic testing for mitochondrial disordersmitoaction
 
2014 05 21_personal_genomics_v_n2n_vfinal
2014 05 21_personal_genomics_v_n2n_vfinal2014 05 21_personal_genomics_v_n2n_vfinal
2014 05 21_personal_genomics_v_n2n_vfinalProf. Wim Van Criekinge
 
Genetic screening counseling Prenatal Testing M Phil 17 2-15
Genetic screening counseling Prenatal Testing M Phil 17 2-15Genetic screening counseling Prenatal Testing M Phil 17 2-15
Genetic screening counseling Prenatal Testing M Phil 17 2-15Yahya Noori, Ph.D
 

Ähnlich wie Psyc 2301 chapter four powerpoint(2) (20)

09-17-2014_slides.pptx
09-17-2014_slides.pptx09-17-2014_slides.pptx
09-17-2014_slides.pptx
 
Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019
Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019
Prof. Dr. Vladimir Trajkovski - Epigenetics of ASD-10.05.2019
 
Eugenics used to design babies
Eugenics used to design babiesEugenics used to design babies
Eugenics used to design babies
 
Do our Genes Determine What We Should Eat? 2016
Do our Genes Determine What We Should Eat? 2016Do our Genes Determine What We Should Eat? 2016
Do our Genes Determine What We Should Eat? 2016
 
Global Medical Cures™ | Genetic Testing Handbook
Global Medical Cures™ | Genetic Testing HandbookGlobal Medical Cures™ | Genetic Testing Handbook
Global Medical Cures™ | Genetic Testing Handbook
 
Imp of genetic testing
Imp of genetic testingImp of genetic testing
Imp of genetic testing
 
Genetic Tests for Health Purposes
Genetic Tests for Health PurposesGenetic Tests for Health Purposes
Genetic Tests for Health Purposes
 
fundamentals of human genetics (dental).pptx
fundamentals of human genetics (dental).pptxfundamentals of human genetics (dental).pptx
fundamentals of human genetics (dental).pptx
 
Genetic Disorders.pptx
Genetic Disorders.pptxGenetic Disorders.pptx
Genetic Disorders.pptx
 
Dev Psych.ch2.keynote
Dev Psych.ch2.keynoteDev Psych.ch2.keynote
Dev Psych.ch2.keynote
 
ERN Ithaca diagnosis for the undiagnosed
ERN Ithaca diagnosis for the undiagnosedERN Ithaca diagnosis for the undiagnosed
ERN Ithaca diagnosis for the undiagnosed
 
Genetic Screening and Genetic Counselling ,Applications
Genetic Screening and Genetic Counselling ,ApplicationsGenetic Screening and Genetic Counselling ,Applications
Genetic Screening and Genetic Counselling ,Applications
 
Exploring your personal genome with free, online bioinformatics tools
Exploring your personal genome with free, online bioinformatics toolsExploring your personal genome with free, online bioinformatics tools
Exploring your personal genome with free, online bioinformatics tools
 
Research MethodsLearning Objectives You will learn how.docx
Research MethodsLearning Objectives You will learn how.docxResearch MethodsLearning Objectives You will learn how.docx
Research MethodsLearning Objectives You will learn how.docx
 
Identifying Rare Diseases from Behavioural Data: A Machine Learning Approach
Identifying Rare Diseases from Behavioural Data: A Machine Learning ApproachIdentifying Rare Diseases from Behavioural Data: A Machine Learning Approach
Identifying Rare Diseases from Behavioural Data: A Machine Learning Approach
 
What you should know about genetic testing for mitochondrial disorders
What you should know about genetic testing for mitochondrial disordersWhat you should know about genetic testing for mitochondrial disorders
What you should know about genetic testing for mitochondrial disorders
 
Ch02
Ch02Ch02
Ch02
 
2014 05 21_personal_genomics_v_n2n_vfinal
2014 05 21_personal_genomics_v_n2n_vfinal2014 05 21_personal_genomics_v_n2n_vfinal
2014 05 21_personal_genomics_v_n2n_vfinal
 
biotechnology regulations.ppt
biotechnology regulations.pptbiotechnology regulations.ppt
biotechnology regulations.ppt
 
Genetic screening counseling Prenatal Testing M Phil 17 2-15
Genetic screening counseling Prenatal Testing M Phil 17 2-15Genetic screening counseling Prenatal Testing M Phil 17 2-15
Genetic screening counseling Prenatal Testing M Phil 17 2-15
 

Mehr von Liz Vera

Chapter 20
Chapter 20Chapter 20
Chapter 20Liz Vera
 
Chapter 19
Chapter 19 Chapter 19
Chapter 19 Liz Vera
 
Ch3 verbal
Ch3 verbalCh3 verbal
Ch3 verbalLiz Vera
 
Nonverbal communication
Nonverbal communicationNonverbal communication
Nonverbal communicationLiz Vera
 
ch 1 - speech
ch 1 - speech ch 1 - speech
ch 1 - speech Liz Vera
 
Chapter 18: New South & Trans-Miss
Chapter 18: New South & Trans-MissChapter 18: New South & Trans-Miss
Chapter 18: New South & Trans-MissLiz Vera
 
Davidson7 ppt ch17(1)
Davidson7 ppt ch17(1)Davidson7 ppt ch17(1)
Davidson7 ppt ch17(1)Liz Vera
 
Sectionalism
SectionalismSectionalism
SectionalismLiz Vera
 
Southern society & slavery
Southern society & slaverySouthern society & slavery
Southern society & slaveryLiz Vera
 
Age of reform(1)
Age of reform(1)Age of reform(1)
Age of reform(1)Liz Vera
 
Era of good feelings
Era of good feelingsEra of good feelings
Era of good feelingsLiz Vera
 
Federalist era
Federalist eraFederalist era
Federalist eraLiz Vera
 
American revolution
American revolutionAmerican revolution
American revolutionLiz Vera
 
Elements and principles of virtual design 2
Elements and principles of virtual design 2Elements and principles of virtual design 2
Elements and principles of virtual design 2Liz Vera
 
Psyc 2301 chapter fifteen powerpoint(3)
Psyc 2301 chapter fifteen powerpoint(3)Psyc 2301 chapter fifteen powerpoint(3)
Psyc 2301 chapter fifteen powerpoint(3)Liz Vera
 
Colonization 17th century
Colonization 17th centuryColonization 17th century
Colonization 17th centuryLiz Vera
 

Mehr von Liz Vera (20)

Chapter 20
Chapter 20Chapter 20
Chapter 20
 
Chapter 19
Chapter 19 Chapter 19
Chapter 19
 
Ch3 verbal
Ch3 verbalCh3 verbal
Ch3 verbal
 
Hybrid2
Hybrid2Hybrid2
Hybrid2
 
Hybrid2
Hybrid2Hybrid2
Hybrid2
 
Listening
ListeningListening
Listening
 
Nonverbal communication
Nonverbal communicationNonverbal communication
Nonverbal communication
 
Hybrid1
Hybrid1Hybrid1
Hybrid1
 
ch 1 - speech
ch 1 - speech ch 1 - speech
ch 1 - speech
 
Chapter 18: New South & Trans-Miss
Chapter 18: New South & Trans-MissChapter 18: New South & Trans-Miss
Chapter 18: New South & Trans-Miss
 
Davidson7 ppt ch17(1)
Davidson7 ppt ch17(1)Davidson7 ppt ch17(1)
Davidson7 ppt ch17(1)
 
Sectionalism
SectionalismSectionalism
Sectionalism
 
Southern society & slavery
Southern society & slaverySouthern society & slavery
Southern society & slavery
 
Age of reform(1)
Age of reform(1)Age of reform(1)
Age of reform(1)
 
Era of good feelings
Era of good feelingsEra of good feelings
Era of good feelings
 
Federalist era
Federalist eraFederalist era
Federalist era
 
American revolution
American revolutionAmerican revolution
American revolution
 
Elements and principles of virtual design 2
Elements and principles of virtual design 2Elements and principles of virtual design 2
Elements and principles of virtual design 2
 
Psyc 2301 chapter fifteen powerpoint(3)
Psyc 2301 chapter fifteen powerpoint(3)Psyc 2301 chapter fifteen powerpoint(3)
Psyc 2301 chapter fifteen powerpoint(3)
 
Colonization 17th century
Colonization 17th centuryColonization 17th century
Colonization 17th century
 

Kürzlich hochgeladen

Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfJayanti Pande
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Beyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactBeyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactPECB
 
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...fonyou31
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxVishalSingh1417
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...Sapna Thakur
 
Student login on Anyboli platform.helpin
Student login on Anyboli platform.helpinStudent login on Anyboli platform.helpin
Student login on Anyboli platform.helpinRaunakKeshri1
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfchloefrazer622
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationnomboosow
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphThiyagu K
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfciinovamais
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxiammrhaywood
 
Disha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdfDisha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdfchloefrazer622
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 

Kürzlich hochgeladen (20)

Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Advance Mobile Application Development class 07
Advance Mobile Application Development class 07Advance Mobile Application Development class 07
Advance Mobile Application Development class 07
 
Beyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactBeyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global Impact
 
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
 
Student login on Anyboli platform.helpin
Student login on Anyboli platform.helpinStudent login on Anyboli platform.helpin
Student login on Anyboli platform.helpin
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdf
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communication
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot Graph
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
Disha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdfDisha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdf
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 

Psyc 2301 chapter four powerpoint(2)

  • 2. Exam One Results • Your grade is posted on “My Grades” in e- campus • Any questions???
  • 3. Service Learning Opportunity • Don’t forget that you can substitute one of your exam grades by participating in service learning • Click on the “Service Learning” button in e- campus to learn more about getting enrolled
  • 4. Natural Selection  Natural selection – introduced by Darwin in The Origin of Species in 1859  Features and the environment
  • 5.
  • 6.
  • 7.
  • 8. Genetic Mechanisms  Chromosomes, Genes, and DNA  30,000 genes • http://youtu.be/uN82GLQYAUQ • Genes and environment Ques: Can you think of a disorder that may be affected by the environment for which you may have a genetic predisposition?
  • 9. Skin pigmentation is one example of a continuous trait. (Nature vs. Nurture)
  • 10. Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in DNA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTCC CACTTTCAAGCTCGGCCCCTT TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG GCCAAGAATGGCTCCCACCT GGCTCTCAGACATTCCCCTGG TCCAACCCCCAGGCCATCAAG ATGTCTCAGAGAGGCGGCTAG ACACCCAGAGACCTCAAGTGA CCATGTGGGAACGGGATGTTT CCAGTGACAGGCA Genotype Phenotypes Genotype
  • 11. The Science of Sex Appeal Video Groups: What factors make us attracted to others? Get into groups and try to brainstorm at least 10 factors that affect attraction. What connections can be made to biological and environmental factors? Smell • http://youtu.be/s_y8NTaPNQY Facial Attractiveness • http://youtu.be/MVhKSzSpXMA Walk • http://youtu.be/gwdlq95Tnqc
  • 12. Mating Patterns Differential parental investment theory  Polygyny: One male with multiple females  Polyandry: One female with multiple males  Monogamy: One male with one female  Polygynandry: Multiple males with multiple females
  • 13. Color Blind Test • Just a shortened form: • http://colorvisiontesting.com/online%20t est.htm • An evolutionary advantage?
  • 15. Some of the reasons…. • better health care (less serious illnesses that can delay or damage brain development, less exposure to toxins such as lead, smog, food poisoning, etc.) • better nutrition (better availability of fresh foods, proteins, fats, vitamins, minerals such as iron and iodine, etc. that are necessary to build and support the brain) • higher levels of education • higher cognitive stimulation by an increasingly complex environment
  • 16. (Nature vs. Nurture Debate) TWIN STUDIES  Reared separately ~ Career choice, food preferences, facial expressions, medical conditions, similar speech rhythms, etc.  Monozygotic (identical) ~ 80% concordance rate in their sense of happiness  Dizygotic (fraternal) ~ no concordance in their sense of happiness  Identical ~ if one has schizophrenia, the other has a 50% chance of developing the condition  Fraternal ~ 27% chance of developing the disorder ADOPTION STUDIES Intelligence is more similar to their biological parents than to their adoptive parents
  • 17. Fallacies  Social Darwinism  Deterministic fallacy