SlideShare ist ein Scribd-Unternehmen logo
1 von 1
You want to express the cDNA below in some eukaryotic cells. Which of the plasmids below
would you use? Why? Explain also your cloning strategies. >BIT473 CDNA in pUCi9
GGAATTCGAGCTCGGTACCCTTGTAGTGATGGTAGCTAATGCGTCCCGGGCACCACC
AGTCGGCGCCAGAGCTGACT
TAAGAAGCANGAGCTTCANANCTCTACTAGGTCCTGTGTACCTCCCGGTGGCGTGCT
TCCAGGACMGACGGCAITG
GCCACGTCCGATAATtTACTAACACCTAAGAGGTATTCCAATACCCATICCGCCAACC
TGATCTACTTCCACCCCAA
CCCATGGTTTAAGCGGACCTCTACTTTAAGCGCTCATTTGTATGCGCCGCATGAGGA
CGAATICCCCCCTGTGTITA
AGGCTTATAGGGATGCCAGGGTCGACCAAGCTAAAAAATCTCTGGGGAACTCGAAT
TTIGTCGCGTAACGTTGTGG
AGTGCATCAACGATAAGAAACAACCCCCACTCTCCGTGGAAGGCCTACCTTGCATC
ATCTFGCCATCTGCCCCGTAC
GATTATGTCTTGTGGAGGCCGCCTGGCGAGCGGGATTGCTITTACCAAATGTTAAGTT
ATGGCGTTCGCGATACGA
CGAAACAGTCAAATTGTGGCCCTAACTGCTGTTCCGGTGAGGCCAARCGACCTCTAA
CTPATCTAGCCCGACTGAC
GACCAGATACGCCCTCTAGACACGTTITGTAACGGACCARCGACGACMGIGITAMCC
GCGGACAGCGCTTGCTAC
AGTTTTTGTTTACTTGCAACCTAAAGAATCGTAACTTAGTAGCTAGGSTCGGGGATC
CTCTAGAGTCGACCTGCAGGCA TGCAAGCTTGG

Weitere ähnliche Inhalte

Ähnlich wie You want to express the cDNA below in some eukaryotic cells- Which of.docx

Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technologyDr. Armaan Singh
 
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationSite directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationTyler Liang
 
introduction to metagenomics
introduction to metagenomicsintroduction to metagenomics
introduction to metagenomicsThomas Haverkamp
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Vall d'Hebron Institute of Research (VHIR)
 
Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013mcmahonUW
 
Mighty flower transcription and translation
Mighty flower transcription and translationMighty flower transcription and translation
Mighty flower transcription and translationpunxsyscience
 
Advenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryAdvenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryPeyman Ghoraishizadeh
 

Ähnlich wie You want to express the cDNA below in some eukaryotic cells- Which of.docx (15)

Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technology
 
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationSite directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
 
cloning
cloningcloning
cloning
 
cloning
cloningcloning
cloning
 
C:\fakepath\cloning
C:\fakepath\cloningC:\fakepath\cloning
C:\fakepath\cloning
 
Cloning
CloningCloning
Cloning
 
Cloning
CloningCloning
Cloning
 
introduction to metagenomics
introduction to metagenomicsintroduction to metagenomics
introduction to metagenomics
 
Rna protein
Rna proteinRna protein
Rna protein
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013
 
Mighty flower transcription and translation
Mighty flower transcription and translationMighty flower transcription and translation
Mighty flower transcription and translation
 
Advenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryAdvenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratory
 
Rna.mvanleer
Rna.mvanleerRna.mvanleer
Rna.mvanleer
 

Mehr von karlynwih

Zone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docxZone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docxkarlynwih
 
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docxYour unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docxkarlynwih
 
Your friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docxYour friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docxkarlynwih
 
Your reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docxYour reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docxkarlynwih
 
You will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docxYou will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docxkarlynwih
 
Write definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docxWrite definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docxkarlynwih
 
Write code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docxWrite code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docxkarlynwih
 
Write C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docxWrite C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docxkarlynwih
 
Write an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docxWrite an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docxkarlynwih
 
You and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docxYou and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docxkarlynwih
 
Write an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docxWrite an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docxkarlynwih
 
Write an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docxWrite an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docxkarlynwih
 
write a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docxwrite a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docxkarlynwih
 
Write up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docxWrite up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docxkarlynwih
 
Write an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docxWrite an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docxkarlynwih
 
Write the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docxWrite the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docxkarlynwih
 
Write the formal description of the following state machine (M) What.docx
Write the formal description of the following state machine (M)  What.docxWrite the formal description of the following state machine (M)  What.docx
Write the formal description of the following state machine (M) What.docxkarlynwih
 
Write the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docxWrite the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docxkarlynwih
 
Write the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docxWrite the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docxkarlynwih
 
Write functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docxWrite functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docxkarlynwih
 

Mehr von karlynwih (20)

Zone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docxZone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docx
 
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docxYour unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
 
Your friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docxYour friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docx
 
Your reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docxYour reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docx
 
You will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docxYou will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docx
 
Write definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docxWrite definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docx
 
Write code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docxWrite code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docx
 
Write C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docxWrite C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docx
 
Write an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docxWrite an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docx
 
You and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docxYou and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docx
 
Write an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docxWrite an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docx
 
Write an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docxWrite an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docx
 
write a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docxwrite a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docx
 
Write up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docxWrite up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docx
 
Write an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docxWrite an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docx
 
Write the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docxWrite the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docx
 
Write the formal description of the following state machine (M) What.docx
Write the formal description of the following state machine (M)  What.docxWrite the formal description of the following state machine (M)  What.docx
Write the formal description of the following state machine (M) What.docx
 
Write the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docxWrite the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docx
 
Write the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docxWrite the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docx
 
Write functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docxWrite functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docx
 

Kürzlich hochgeladen

Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfNirmal Dwivedi
 
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...ZurliaSoop
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxRamakrishna Reddy Bijjam
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxVishalSingh1417
 
ComPTIA Overview | Comptia Security+ Book SY0-701
ComPTIA Overview | Comptia Security+ Book SY0-701ComPTIA Overview | Comptia Security+ Book SY0-701
ComPTIA Overview | Comptia Security+ Book SY0-701bronxfugly43
 
Single or Multiple melodic lines structure
Single or Multiple melodic lines structureSingle or Multiple melodic lines structure
Single or Multiple melodic lines structuredhanjurrannsibayan2
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfagholdier
 
How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17Celine George
 
Spellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please PractiseSpellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please PractiseAnaAcapella
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.MaryamAhmad92
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentationcamerronhm
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSCeline George
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxVishalSingh1417
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds  in the ClassroomFostering Friendships - Enhancing Social Bonds  in the Classroom
Fostering Friendships - Enhancing Social Bonds in the ClassroomPooky Knightsmith
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...pradhanghanshyam7136
 
Sociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning ExhibitSociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning Exhibitjbellavia9
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 

Kürzlich hochgeladen (20)

Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdfUGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
UGC NET Paper 1 Mathematical Reasoning & Aptitude.pdf
 
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...
 
Python Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docxPython Notes for mca i year students osmania university.docx
Python Notes for mca i year students osmania university.docx
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
ComPTIA Overview | Comptia Security+ Book SY0-701
ComPTIA Overview | Comptia Security+ Book SY0-701ComPTIA Overview | Comptia Security+ Book SY0-701
ComPTIA Overview | Comptia Security+ Book SY0-701
 
Single or Multiple melodic lines structure
Single or Multiple melodic lines structureSingle or Multiple melodic lines structure
Single or Multiple melodic lines structure
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17
 
Spellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please PractiseSpellings Wk 3 English CAPS CARES Please Practise
Spellings Wk 3 English CAPS CARES Please Practise
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.
 
SOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning PresentationSOC 101 Demonstration of Learning Presentation
SOC 101 Demonstration of Learning Presentation
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POS
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptx
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds  in the ClassroomFostering Friendships - Enhancing Social Bonds  in the Classroom
Fostering Friendships - Enhancing Social Bonds in the Classroom
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
 
Sociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning ExhibitSociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning Exhibit
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 

You want to express the cDNA below in some eukaryotic cells- Which of.docx

  • 1. You want to express the cDNA below in some eukaryotic cells. Which of the plasmids below would you use? Why? Explain also your cloning strategies. >BIT473 CDNA in pUCi9 GGAATTCGAGCTCGGTACCCTTGTAGTGATGGTAGCTAATGCGTCCCGGGCACCACC AGTCGGCGCCAGAGCTGACT TAAGAAGCANGAGCTTCANANCTCTACTAGGTCCTGTGTACCTCCCGGTGGCGTGCT TCCAGGACMGACGGCAITG GCCACGTCCGATAATtTACTAACACCTAAGAGGTATTCCAATACCCATICCGCCAACC TGATCTACTTCCACCCCAA CCCATGGTTTAAGCGGACCTCTACTTTAAGCGCTCATTTGTATGCGCCGCATGAGGA CGAATICCCCCCTGTGTITA AGGCTTATAGGGATGCCAGGGTCGACCAAGCTAAAAAATCTCTGGGGAACTCGAAT TTIGTCGCGTAACGTTGTGG AGTGCATCAACGATAAGAAACAACCCCCACTCTCCGTGGAAGGCCTACCTTGCATC ATCTFGCCATCTGCCCCGTAC GATTATGTCTTGTGGAGGCCGCCTGGCGAGCGGGATTGCTITTACCAAATGTTAAGTT ATGGCGTTCGCGATACGA CGAAACAGTCAAATTGTGGCCCTAACTGCTGTTCCGGTGAGGCCAARCGACCTCTAA CTPATCTAGCCCGACTGAC GACCAGATACGCCCTCTAGACACGTTITGTAACGGACCARCGACGACMGIGITAMCC GCGGACAGCGCTTGCTAC AGTTTTTGTTTACTTGCAACCTAAAGAATCGTAACTTAGTAGCTAGGSTCGGGGATC CTCTAGAGTCGACCTGCAGGCA TGCAAGCTTGG