SlideShare ist ein Scribd-Unternehmen logo
1 von 11
An introduction to Synthetic biology: Engineering biology

                           What is synthetic biology?

                           It is an attempt to engineer biology. It is not metablolic
                           engineering, it is not process engineering, it is not
                           cancer cell engineering..it is an approach to make those
                           sort of things. It is not the particular application..it is the
                           method or approach to utilize a particular application. To
                           put it in other words synthetic biology is’nt about
                           making a particular thing.. it is how you make
                           something.

    Drew Endy
Professor, Stanford
    University




     The final goal is to be able to design biological systems in the same way
                engineers design electronic or mechanical systems.
Why do we need it?                  Synthetic Biology




                     Cells are the ultimate Chemical Factory.
Is it achievable?




           1- Biology is hierarchical
Is it achievable?




           2- Biology is Modular
Is it achievable?




         Hierarchy and Modular (recurrent) organization allows biology to be
         understandable and synthetic biology to be possible.
A possible hierarchy for synthetic biology
Synthetic Biology as Engineering

                    Standard Parts




                Parts should not have multiple functions

                (One subunit of T7 phage DNA polymerase is actually E. coli
                thioredoxin)




               Parts should not encode multiple functions
Synthetic Biology as Engineering

                     Standard Parts


Different parts should be compatible




Parts should work in different contexts
Synthetic Biology as Engineering

                     Standard Parts




Standardized parts could be easily exchanged between different devices
(as well as between different laboratories)
Synthetic Biology as Engineering

                        Abstraction




                       Systems



                       Devices



                       Parts



                       DNA            TGCATGCTGATATACGGCTCGAT




Abstraction hierarchies are a human invention designed to assist people in
engineering very complex systems by ignoring unnecessary details.
How the journey began…

iGEM began in 2003 when Drew Endy (now at Stanford University), Tom Knight and
several MIT students spent the month of January trying to design standardized
biological parts to create bacteria that blink on and off like a light switch.




Today, synthetic biology envisions the impossible... from bacterial photography to
biological LCD screens.


SYNTHETIC BIOLOGY IS HAPPENING..AND ITS HAPPENING NOW!

Weitere ähnliche Inhalte

Kürzlich hochgeladen

fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingTeacherCyreneCayanan
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxAreebaZafar22
 
PROCESS RECORDING FORMAT.docx
PROCESS      RECORDING        FORMAT.docxPROCESS      RECORDING        FORMAT.docx
PROCESS RECORDING FORMAT.docxPoojaSen20
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphThiyagu K
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introductionMaksud Ahmed
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityGeoBlogs
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Celine George
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
Gardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterGardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterMateoGardella
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
APM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAPM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAssociation for Project Management
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxnegromaestrong
 

Kürzlich hochgeladen (20)

fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writing
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
PROCESS RECORDING FORMAT.docx
PROCESS      RECORDING        FORMAT.docxPROCESS      RECORDING        FORMAT.docx
PROCESS RECORDING FORMAT.docx
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1
 
Z Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot GraphZ Score,T Score, Percential Rank and Box Plot Graph
Z Score,T Score, Percential Rank and Box Plot Graph
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introduction
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activity
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
Gardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterGardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch Letter
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
APM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across SectorsAPM Welcome, APM North West Network Conference, Synergies Across Sectors
APM Welcome, APM North West Network Conference, Synergies Across Sectors
 
Seal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptxSeal of Good Local Governance (SGLG) 2024Final.pptx
Seal of Good Local Governance (SGLG) 2024Final.pptx
 
Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"
 

Empfohlen

How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthThinkNow
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfmarketingartwork
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024Neil Kimberley
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)contently
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024Albert Qian
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsKurio // The Social Media Age(ncy)
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Search Engine Journal
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summarySpeakerHub
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next Tessa Mero
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentLily Ray
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best PracticesVit Horky
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project managementMindGenius
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...RachelPearson36
 
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...Applitools
 
12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at WorkGetSmarter
 

Empfohlen (20)

How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
 
Skeleton Culture Code
Skeleton Culture CodeSkeleton Culture Code
Skeleton Culture Code
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
 
12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work
 
ChatGPT webinar slides
ChatGPT webinar slidesChatGPT webinar slides
ChatGPT webinar slides
 

[iGEM] Synthetic Biology [28 10-2011]

  • 1. An introduction to Synthetic biology: Engineering biology What is synthetic biology? It is an attempt to engineer biology. It is not metablolic engineering, it is not process engineering, it is not cancer cell engineering..it is an approach to make those sort of things. It is not the particular application..it is the method or approach to utilize a particular application. To put it in other words synthetic biology is’nt about making a particular thing.. it is how you make something. Drew Endy Professor, Stanford University The final goal is to be able to design biological systems in the same way engineers design electronic or mechanical systems.
  • 2. Why do we need it? Synthetic Biology Cells are the ultimate Chemical Factory.
  • 3. Is it achievable? 1- Biology is hierarchical
  • 4. Is it achievable? 2- Biology is Modular
  • 5. Is it achievable? Hierarchy and Modular (recurrent) organization allows biology to be understandable and synthetic biology to be possible.
  • 6. A possible hierarchy for synthetic biology
  • 7. Synthetic Biology as Engineering Standard Parts Parts should not have multiple functions (One subunit of T7 phage DNA polymerase is actually E. coli thioredoxin) Parts should not encode multiple functions
  • 8. Synthetic Biology as Engineering Standard Parts Different parts should be compatible Parts should work in different contexts
  • 9. Synthetic Biology as Engineering Standard Parts Standardized parts could be easily exchanged between different devices (as well as between different laboratories)
  • 10. Synthetic Biology as Engineering Abstraction Systems Devices Parts DNA TGCATGCTGATATACGGCTCGAT Abstraction hierarchies are a human invention designed to assist people in engineering very complex systems by ignoring unnecessary details.
  • 11. How the journey began… iGEM began in 2003 when Drew Endy (now at Stanford University), Tom Knight and several MIT students spent the month of January trying to design standardized biological parts to create bacteria that blink on and off like a light switch. Today, synthetic biology envisions the impossible... from bacterial photography to biological LCD screens. SYNTHETIC BIOLOGY IS HAPPENING..AND ITS HAPPENING NOW!