Planning and Executing siRNA Experiments—Good Practices for Optimal Results
•Als PPTX, PDF herunterladen•
2 gefällt mir•2,344 views
This document provides guidance on planning and executing successful siRNA experiments through following good practices. It reviews key steps including understanding the target transcript through identifying variants and structures, selecting effective siRNAs using design tools and rules, choosing a cell line with appropriate expression profiles, optimizing experimental conditions through controls and pilot experiments, and validating the assay. Following these steps can help achieve optimized gene knockdown.
Empfohlen
Weitere ähnliche Inhalte
Was ist angesagt?
Was ist angesagt? (20)
Andere mochten auch
Andere mochten auch (9)
Ähnlich wie Planning and Executing siRNA Experiments—Good Practices for Optimal Results
Ähnlich wie Planning and Executing siRNA Experiments—Good Practices for Optimal Results (20)
Mehr von Integrated DNA Technologies
Mehr von Integrated DNA Technologies (20)
Kürzlich hochgeladen
Kürzlich hochgeladen (20)
Planning and Executing siRNA Experiments—Good Practices for Optimal Results
- 1. Planning and Executing siRNA Experiments—Good Practices for Optimal Results Garrett Rettig, PhD
- 2. 2 Abstract Functional analysis by mRNA knockdown using siRNAs is now routine in many molecular biology labs. However, many RNAi-related experiments fail due to diversion from simple, good practices. This webinar will review the steps leading to successful siRNA experiments, including: • Understanding the target transcript • siRNA selection • Choosing the cell type • Validating the assay • Including appropriate biological controls
- 6. 6 RNAi-Mediated Knockdown or Artifact? Untreated controls siRNA targeting gene of interest Cycle ∆Rn ∆ Cq > 3.3, 90% knockdown Amplification Plot qPCR – Gene of Interest (GOI) Expression in HeLa Cells
- 7. 7 Strategy Optimized experiment: gene of interest knockdown Identify target gene of interest DsiRNA selection Cell line selection Optimize experimental conditions Controlled pilot experiment
- 8. 8 INTEGRATED DNA TECHNOLOGIES Understanding the Transcript 0 10 20 30 40 50 60 70 80 90 100 110 120 0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 RemainingmRNALevels(%) siRNA (Hs Locations) GOI Knockdown in HeLa Cells at 1 nM Normalized to Hs HPRT and SFRS9 vs NC1, NC5, and NC7 Hs STAT3 574-720 (FAM) Hs STAT3 3904-4036 (MAX) 5' UTR CDS 3' UTR Identify target gene of interest 2° Structure Transcript variants Species variation
- 9. 9 qPCR Assay Discordance Identify target gene of interest 2° Structure Transcript variants Species variation Assay discordance appears at the 3’-end of the transcript. Measured mRNA levels show significant divergence Retained mRNA fragments “Geographically” spaced qPCR assays 0 10 20 30 40 50 60 70 80 90 100 110 120 0 500 1000 1500 mRNARemaining(%) GOI Knockdown in HeLa Cells at 1 nM Normalized to Hs HPRT and SFRS9 vs NC1, NC5, and NC7 Assay 1 Assay 2 5' UTR CDS 3' UTR
- 10. 10 Understanding the Transcript http://www.informatics.jax.org/genes.shtml qPCR Assay Loc DsiRNA Loc Identify target gene of interest 2° Structure Transcript variants Species variation Transcript variants (and relative abundance) can affect results in a qPCR assay and DsiRNA location- dependent fashion. 1 2 3 4 5
- 11. 11 Understanding the Transcript Identify target gene of interest 2° Structure Transcript variants Species variation Hs GOI Mm GOI Region of Mm/Hs sequence homology Interspecies alignment of mRNA sequence can affect future experimental directions.
- 12. 12 Selecting an Effective siRNA Reynolds Nat Biotechnol (2004) 22(3):326-30 1. siRNA targeted sequence is usually 21 nt in length 2. Avoid regions within 50100 bp of the start codon and the termination codon 3. Avoid intron regions 4. Avoid stretches of 4 or more bases (AAAA, CCCC) 5. Avoid regions with GC content <30% or >60% 6. Avoid repeats and low complexity sequence 7. Avoid SNP sites 8. Perform BLAST homology search to avoid off-target effects on other genes or sequences 9. Design negative controls as scrambled sequence of the target DsiRNA selection Design rules Design tools
- 13. 13 Selecting an Effective siRNA Tuschl Methods (2002) 26(2):199-213 1. Select targeted region from a given cDNA sequence 50-100 nt downstream of start codon 2. First search for 21-nt sequence motif AAN19. If no suitable sequence found, then, 3. Search for 23-nt sequence motif NAN21 and convert the 3 end of the sense siRNA to TT 4. Or search for NARN17YNN 5. Target sequence should have a GC content of around 50% DsiRNA selection Design rules Design tools DsiRNA selection
- 14. 14 Selecting an Effective siRNA 1. A/U at the 5' end of the antisense strand 2. G/C at the 5' end of the sense strand 3. At least five A/U residues in the 5' terminal one-third of the antisense strand 4. The absence of any GC stretch of more than 9 nt in length Ui-Tei Nucleic Acids Res (2004) 32(3):936-48 DsiRNA selection Design rules Design tools
- 15. 15 Selecting an Effective siRNA DsiRNA selection Design rules Design tools
- 16. 16 Selecting an Effective siRNA DsiRNA selection Design rules Design tools
- 17. 17 Selecting an Effective siRNA DsiRNA selection Design rules Design tools Guarantee: 2 of the top 3 ranked DsiRNAs will exhibit >70% knockdown at 10 nM transfection in a well-controlled experiment Tested 50 genes to confirm the frequency of achieving guaranteed knockdown. • 42/50 genes had 2 out of the first 3 ranked DsiRNAs pass at 10 nM. • 50/50 genes had at least 3 passing DsiRNAs out of the tested set of 10 at 10 nM.
- 18. 18 INTEGRATED DNA TECHNOLOGIES Cell Line Expression profile Cell line selection Literature search Assay validation http://biogps.org/#goto=welcome Hs GAPDH Tissue Prevalence RelativeAbundance
- 19. 19 Cell Line Biomaterials 33 (2012) 1154-1161 Expression profile Cell line selection Literature search Assay validation GAPDH NIH 3T3 murine fibroblasts 12,500 cells/cm2 6.25 – 50 nM qPCR
- 20. 20 INTEGRATED DNA TECHNOLOGIES Expression Profile Cell line selection Literature Search Assay validation Cell Line Untreated controls 106 105 104 103 102 101 Amplification Plot qPCR – Gene of Interest Expression in Candidate Cell Line∆Rn Cycle Western bDNA Phenotype qPCR Northern
- 21. 21 INTEGRATED DNA TECHNOLOGIES Cell Line Expression Profile Cell line selection Literature Search Assay validation
- 22. 22 INTEGRATED DNA TECHNOLOGIES Cell Line Expression Profile Cell line selection Literature Search Assay validation HPRT mRNA and Protein Knockdown 10nM Transfection in HeLa Cells
- 23. 23 0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% 110% NC1 10nM HPRT 10nM RemainingmRNALevels(%) Optimizing U87 Cell Transfections HPRT Knockdown Normalized to SFRS9 24hr Reverse Transfections 6uL INTERFERin 3uL TKO 1uL siLentFect 2uL RNAiMAX Optimize experimental conditions Transfection Controls Optimizing Conditions
- 24. 24 Optimizing Conditions Positive Control DsiRNA – HPRT (Hypoxanthine-guanine phosphoribosyltransferase) Optimize experimental conditions Transfection Controls/Variables 5'- CGUUAAUCGCGUAUAAUACGCGUAT ||||||||||||||||||||||||| 3'- CAGCAAUUAGCGCAUAUUAUGCGCAUA 5'- CAUAUUGCGCGUAUAGUCGCGUUAG ||||||||||||||||||||||||| 3'- UGGUAUAACGCGCAUAUCAGCGCAAUC 5'- GGCGCGUAUAGUCGCGCGUAUAGTC ||||||||||||||||||||||||| 3'- CUCCGCGCAUAUCAGCGCGCAUAUCAG 5'- GCCAGACUUUGUUGGAUUUGAAATT ||||||||||||||||||||||||| 3'- UUCGGUCUGAAACAACCUAAACUUUAA Negative Control DsiRNAs Additional parameters to optimize: Transfection reagent Dose-response - reagent Cell seeding density Dose-response – DsiRNA Forward/reverse Time course Reagent:DsiRNA ratio
- 25. 25 Experimental Setup • Negative controls • Positive controls • DsiRNA targeting gene of interest • Biological replicates • Technical replicates Cells Only Reagent Only Neg siRNA#1 – 10 nM HPRT Pos – 10 nM HPRT Pos – 1 nM Neg siRNA#2 – 10 nM HPRT Pos – 0.1 nM GOI siRNA – 10 nM
- 26. 26 Summary Optimized experiment: gene of interest knockdown Identify target gene of interest 2° Structure Transcript variants Species variation DsiRNA selection Design rules Design tools Cell line selection Optimize experimental conditions Controlled pilot experiment Expression profile Literature search Assay validation Transfection Controls
- 27. 27 INTEGRATED DNA TECHNOLOGIES Additional Resources Educational Resources at www.IDTDNA.com Under Support & Education Menu • DECODED Newsletter (www.IDTDNA.com/DECODED) • Video Library • Frequently Asked Questions • More… Design Tools at www.IDTDNA.com/SciTools or Under the Tools Menu • Custom RNAi Design Tool • Predesigned DsiRNA Selection Tool • PrimeTime® qPCR Assays Tool • PrimerQuest® Tool for PCR and qPCR Design Customer Care and Technical Support for Design, Experimental Issues, and Ordering Help • custcare@IDTDNA.com
- 28. 28 INTEGRATED DNA TECHNOLOGIES Additional Resources Additional Product Information: • More information on DsiRNA 27mer duplexes at www.idtdna.com , under Products &Services/DsiRNA • More information on PrimeTime® qPCR Assays and products at www.IDTDNA.com/PrimeTime Related IDT Publications • Molecular Therapy (2012) 20(3):483-512. • Gene Therapy (2011) 18:1111-1120. • Oligonucleotides (2008) 18:305-320. • Curr Opin in Mol Ther (2007) 9(2):110-118. • Nature Methods (2006) Online 23 August; DOI:10.1038. • Nucleic Acids Research (2005) 33:4140-4156. Integrated DNA Technologies, Inc. 1710 Commercial Park Coralville, Iowa 52241 USA