Primary Task Response- Within the Discussion Board area- write 400600.docx

•Als DOCX, PDF herunterladen•

0 gefällt mir•2 views

H

Primary Task Response: Within the Discussion Board area, write 400â€“600 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions by your classmates. Be substantive and clear, and use examples to reinforce your ideas. You have been a system administrator for 15 years, and you have seen your role evolve and change. This evolution of information technology (IT) has resulted in IT security being a top priority in Enterprise support. When you first started in this field, security was merely checking virus updates and making sure you put patches on your computers to protect the system from intruders. If the servers or workstations did get a virus, you conducted research on your own to find an antidote. Today, botnets, spam, phishing, and malware challenge security. Provide 3â€“4 paragraphs that define how the IT security landscape has evolved over the last 10 years and how today\'s current technology works to keep environments secure. Feel free to mention how some of the tools used to protect your system include the following: Intrusion detection and prevention systems Firewalls Antivirus software Other software to eliminate malware and other such intrusive programs Has to be 400-600 words!! Solution I have been a system administrator for past 15 years and my roles include: Summary Responsible for designing, organizing, modifying, and supporting a company\'s computer systems. Designs and installs LANs, WANs, Internet and intranet systems, and network segments. Primary responsibilities .

Primary Task Response: Within the Discussion Board area, write 400â€“600 words that
respond to the following questions with your thoughts, ideas, and comments. This will be the
foundation for future discussions by your classmates. Be substantive and clear, and use examples
to reinforce your ideas.
You have been a system administrator for 15 years, and you have seen your role evolve and
change. This evolution of information technology (IT) has resulted in IT security being a top
priority in Enterprise support. When you first started in this field, security was merely checking
virus updates and making sure you put patches on your computers to protect the system from
intruders. If the servers or workstations did get a virus, you conducted research on your own to
find an antidote. Today, botnets, spam, phishing, and malware challenge security.
Provide 3â€“4 paragraphs that define how the IT security landscape has evolved over the last 10
years and how today's current technology works to keep environments secure. Feel free to
mention how some of the tools used to protect your system include the following:
Intrusion detection and prevention systems
Firewalls
Antivirus software
Other software to eliminate malware and other such intrusive programs
Has to be 400-600 words!!
Solution
I have been a system administrator for past 15 years and my roles include:
Summary
Responsible for designing, organizing, modifying, and supporting a company's computer
systems. Designs and installs LANs, WANs, Internet and intranet systems, and network
segments.

Primary responsibilities

Weitere ähnliche Inhalte

Ähnlich wie Primary Task Response- Within the Discussion Board area- write 400600.docx

The comparison of written and media Compare and contrast similarity and/or difference of two modes (written and oral with the support of media First and foremost, the patterns of manifestation between written and oral with the support of media do differ. Written always be three part: beginning, body and ending. Media can use graphs, words, videos, music and pictures, which can better express. In contrast, Media needs author giving a speech to audiences.(structure, Second, the words (language) of the written are different from the oral with the support of media. (simple words, fewer words, easier to understand) in written, we must use advanced words and more logical and we need to describe more details. Media we can use simple words in order to let audiences understand. Media just need few words. Third, the effects of these two modes are different. (Audiences will easier getting point and can well educated. Written can’t answer audiences’ questions immediately. But later, audiences can use different way to ask author: email, call or letter. Media is more directly. Combined with words, graphs and pictures give audiences more impression. Media has communication with audiences, which can answer audiences’ questions and confuse.) CMIT 321 Executive Proposal Project The purpose of this project is to evaluate the student’s ability to research and evaluate security testing software and present a proposal for review by executive team members. By completing the document the student will also gain practical knowledge of the security evaluation documentation and proposal writing process. The project will enable the student to identify and understand the required standards in practice, as well as the details that should be covered within a proposal. Project Deliverable · Using the Case Study presented in this document, to complete an executive proposal. · Provide a three to five page proposal summarizing purpose and benefit of chosen security software to the executive management team. · The student will evaluate and test security testing software for purposes of testing corporate network security. The purpose of the software is to measure the security posture of the organization by identifying vulnerabilities and help prevent future attacks and deter any real-time unknown threats. · The proposal should effectively describe the software in a manner that will allow the executive team members to understand the purpose and benefits of the software to approve purchase. Guidelines · Evaluate and select a security tool for recommendation that you learned about in the iLabs modules or the EC-Council text books. · Research back up to 10 years and discover any vulnerabilities with the security tool you have selected. Write up 3 of the vulnerabilities that you find. In your report include the following: · The finding name · The finding description · Analysis and exposure with respect to what the vulnerability would mean to the company selecting the tool ...

The comparison of written and mediaCompare and contrast simila.docx

The comparison of written and mediaCompare and contrast simila.docx

The comparison of written and mediaCompare and contrast simila.docx

Ethical Hacking - Ferramentas Open Source para Pentest - Mateus Buogo - Tchel...

Ethical Hacking - Ferramentas Open Source para Pentest - Mateus Buogo - Tchel...

Ethical Hacking - Ferramentas Open Source para Pentest - Mateus Buogo - Tchel...

Assignment 3: Outline a New IT Security Policy Due Week 9 and worth 250 points You have been hired by the Board of Directors of RollinOn, Inc as the new IT Security Manager. RollinOn is a designer of premade and custom designed skates and skateboards. RollinOn has had some extreme growth in the area of e-Commerce over the past couple of years due to the addition of their custom design tools on their website. However, RollinOn has had some internal security issues. RollinOn hs had some very lax policies allowing employees to bring their own tablets and laptops, also known as bring your own device or BYOD, and access social media on the intranet. The Web application development team has increased in size and is also in need of sound security practices. There have been several instances of downloaded malware and the company website has been hacked on at least one (1) occasion. Your main objective is to create an outline of a new IT security policy regarding the company’s web presence and lack of access control. Note: You may create and / or make all necessary assumptions needed for the completion of this assignment. Part I: Written Section Write a three to five (3-5) page paper in which you: Briefly explain the current state of Web application security to the Board of Directors. Describe the major potential security risks associated with maintaining the organization’s Web presence, protecting its assets, and promoting e-Commerce. Assess any techniques and technologies that you may need to use to mitigate those potential security risks. Create an outline of your new IT security policies for RollinOn. Be sure to relate your policies to the potential risks. Speculate on the most common types of resistance that you might encounter from employees when implementing your new IT policy. Use at least four (4) quality references in this assignment. Note: Wikipedia and similar Websites do not qualify as quality references. Format your assignment according to the following formatting requirements: Typed, double spaced, using Times New Roman font (size 12), with one-inch margins on all sides. Include a cover page containing the title of the assignment, the student’s name, the professor’s name, the course title, and the date. The cover page is not included in the required page length. .

Assignment 3 Outline a New IT Security PolicyDue Week 9 and wor.docx

Assignment 3 Outline a New IT Security PolicyDue Week 9 and wor.docx

Assignment 3 Outline a New IT Security PolicyDue Week 9 and wor.docx

Your company has taken a proactive approach to cybersecurity by ensuring that best practices are interwoven into all operational aspects of the corporation. This includes common issues encountered in hardware, software, operating systems, and networking design and implementation. You have been tasked with creating a training presentation on operating systems theory and concepts for new technology employees at your company. Reference "Introduction to Cybersecurity First Principles," located in the topic Resources, and other online resources. Create a 10- to 12-slide presentation that addresses the following: Explain how employees will have a thorough understanding of operating systems theory and implementation, and how they will be able to understand operating system internals to the level that they could design and implement simple architectural changes to an existing OS. Describe the role and basic functions of an operating system, and how operating systems interact with hardware and software applications. Identify and describe basic security issues of operating systems. Describe the following terms and their potential security concerns: Privileged vs. nonprivileged states, and transitions between them (domain switching) Concurrency and synchronization (e.g., semaphores and locks) Application processes and threads, process/thread management, synchronization, inter-process communications Memory management, virtual memory, real memory, and hierarchical memory schemes Uni-processor and multi-processor interfaces and support CPU scheduling File systems Virtualization/hypervisors Access controls (models and mechanisms) Creation and operation of virtualization technology Domain separation, process isolation, resource encapsulation, least privilege I/O issues (e.g., buffering, queuing, sharing, management) Distributed OS issues (client/server, message passing, remote procedure calls, clustering) .

Your company has taken a proactive approach to cybersecurity by ensuri.pdf

Your company has taken a proactive approach to cybersecurity by ensuri.pdf

Your company has taken a proactive approach to cybersecurity by ensuri.pdf

aamaracreations11

We use computers and electronic systems to run and store just about everything. Personal computers and the Internet are now included as part of the Department of Homeland Security's cybersecurity issues. Cybersecurity involves protecting the information by preventing, detecting, and responding to attacks on information that is housed in technology. There are many levels of risks in cybersecurity, some more serious and damaging than others. Among these dangers are: Viruses erasing the entire system. Individuals breaking into personal computer systems and altering the systems' files. Individuals using personal computers to attack others' computer systems. Individuals stealing credit card information and making unauthorized purchases. Unfortunately, there is no 100% guarantee that even with the best precautions some of these things won't happen. Risk reduction steps exist to minimize vulnerability to information. Tasks: Create a PowerPoint Presentation containing 6–8 slides to address the following: Analyze and discuss the vulnerabilities and recommend what security management can do to minimize the potential of a government or private organization being at risk for cybersecurity damage. Outline the steps you recommend and identify any impediments to successfully implementing the suggested cybersecurity program. Support your presentation with at least three outside scholarly resources using APA in-text citations. Add detailed speaker notes for each of the slides. .

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

sheronlewthwaite

We use computers and electronic systems to run and store just about everything. Personal computers and the Internet are now included as part of the Department of Homeland Security's cybersecurity issues. Cybersecurity involves protecting the information by preventing, detecting, and responding to attacks on information that is housed in technology. There are many levels of risks in cybersecurity, some more serious and damaging than others. Among these dangers are: Viruses erasing the entire system. Individuals breaking into personal computer systems and altering the systems' files. Individuals using personal computers to attack others' computer systems. Individuals stealing credit card information and making unauthorized purchases. Unfortunately, there is no 100% guarantee that even with the best precautions some of these things won't happen. Risk reduction steps exist to minimize vulnerability to information. Tasks: Create a PowerPoint Presentation containing 6–8 slides to address the following: Analyze and discuss the vulnerabilities and recommend what security management can do to minimize the potential of a government or private organization being at risk for cybersecurity damage. Outline the steps you recommend and identify any impediments to successfully implementing the suggested cybersecurity program. Support your presentation with at least three outside scholarly resources using APA in-text citations. Add detailed speaker notes for each of the slides. .

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

CMIT 321 EXECUTIVE PROPOSAL PROJECT

CMIT 321 EXECUTIVE PROPOSAL PROJECT

CMIT 321 EXECUTIVE PROPOSAL PROJECT

Prevent Getting Hacked by Using a Network Vulnerability Scanner

Prevent Getting Hacked by Using a Network Vulnerability Scanner

Prevent Getting Hacked by Using a Network Vulnerability Scanner

Running head: CHALLENGES OF CYBER SECURITY 9 Challenges of Cyber Security Challenges of Cyber Security Currently, computer security constitutes one of the fields with increasing significance because many people rely on computer systems and the internet for various operations. By the term ‘cyber security’, it refers to the provision of safety measures for computer systems against theft and destruction to the hardware, software and the information contained therein. It also includes protecting computer systems from any form of interference that hinders their efficiency to service delivery. According to (Vasconcelos et al., 2017), cyber security means limiting the physical access to certain hardware and providing safety against destruction that could result due to malpractice or when system operators become tricked and deviate from what is known secure guidelines. There are many challenges for cyber security measures to be effective. Computer system operators experience great challenges in providing reliable and effective cyber security. Therefore, the question is that; how should system operators get the proper training to overcome numerous cyber security challenges? It is important to pose the question because today there are many businesses that feel insecure. For example, most enterprises doubt the preparedness by system operators and their ability to ensure that there is security in the corporate networks. In addition, a recent research carried by Enterprise Strategy Group established that about a quarter of system operators do not possess the desired skills. Lack of enough personnel who are equipped with right skills is the key factor attributed to challenges of cyber security. While cyber security significantly assists in to protecting us, many enterprises together with their esteemed clients, from someone falsely representing something as beneficial to them or to infiltrate our systems, it is in great need to be expanded on in order to safeguard us, and to create a safer environment protecting companies and our personal information and data, but it can and does fail to provide us complete security, if safe practices are not followed. Protecting the Home Front Home front is an informal term commonly used by the civilians of a nation, which faces a war, and their active support system of the military. As a result, military forces largely rely on home front civilian aid services. However, due to increased potential of destruction to the home front, there is a need to offer them appropriate protection (Wang & Lu, 2013). The military has the ability to design systems to help protect and deal with the vulnerabilities to the home front from direct attacks. There a number of things, that can be done to protect the home front against various attacks. First, one could use automatic light timers fixed throughout in their systems. Light timers can be programmed to switch on and off in a way that helps simulate an in ...

Running head CHALLENGES OF CYBER SECURITY9.docx

Running head CHALLENGES OF CYBER SECURITY9.docx

Running head CHALLENGES OF CYBER SECURITY9.docx

“Meltdown and Spectre Haunt the World’s Computers” In early January 2018, computer users all over the world were shocked to learn that nearly every computer chip manufactured in the last 20 years contained fundamental security flaws that make it possible for attackers to obtain access to data that were thought to be completely protected. Security researchers had discovered the flaws in late 2017. The flaws arise from features built into the chips that help them run faster. The vulnerability enables a malicious program to gain access to data it should never be able to see. There are two specific variations of these flaws, called Meltdown and Spectre. Meltdown was so named because it “melts” security boundaries normally enforced by hardware. By exploiting Meltdown, an attacker can use a program running on a computer to gain access to data from all over that machine that the program shouldn’t normally be able to see, including data belonging to other programs and data to which only administrators should have access. (A system administrator is responsible for the upkeep, configuration, and reliable operation of computer systems.) Meltdown only affects specific kinds of Intel chips produced since 1995. Spectre is not manufacturer-specific and affects nearly all modern processors. It requires more intimate knowledge of the victim program’s inner workings. Spectre’s name comes from speculative execution, in which a chip is able to start work on predicted future operations in order to work faster. In this case, the system is tricked into incorrectly anticipating application behavior. The name also suggests that Spectre will be much more difficult to neutralize. Other attacks in the same family will no doubt be discovered, and Spectre will be haunting us for some time. With both Meltdown and Spectre, an attacker can make a program reveal some of its own data that should have been kept secret. For example, Spectre could harness JavaScript code on a website to trick a web browser into revealing user and password information. Meltdown could be exploited to view data owned by other users and also virtual servers hosted on the same hardware, which is especially dangerous for cloud computing host computers. The most worrisome aspect of Meltdown and Spectre is that security vulnerabilities are not from flawed software but from the fundamental design of hardware platforms beneath the software. There is no evidence that Spectre and Meltdown have been exploited, but this would be difficult to detect. Moreover, the security flaws are so fundamental and widespread that they could become catastrophic, especially for cloud computing services where many users share machines. According to researchers at global security software firm McAfee, these vulnerabilities are especially attractive to malicious actors because the attack surface is so unprecedented and the impacts of leaking highly sensitive data are so harmful. According to Forester, performance of laptops, des.

Meltdown and Spectre Haunt the World’s Computers”In early Janua.docx

Meltdown and Spectre Haunt the World’s Computers”In early Janua.docx

Meltdown and Spectre Haunt the World’s Computers”In early Janua.docx

Peerlyst Delhi NCR Chapter Meet

Peerlyst Delhi NCR Chapter Meet

Peerlyst Delhi NCR Chapter Meet

You have been asked by the CIO of your company, or another company, to create a PowerPoint® informational presentation. Examples of companies might be a company you have worked for in the past or wish to work for in the future. The audience for this week's presentation will be a group of department supervisors. The objectives of this presentation are to: Define "cyber security," and identify threats to private and public organizations. Define Information and Communication Technology (ICT), and explain why it is a very important component of cyber security. Identify the pillars of personal security that assist in personal protection. Define the Six Principles of Information Security Management and legislation constraints that apply to cyber security. Create an 8- to 10-slide PowerPoint® informational presentation, including the following: Content for each of the objectives Speaker's notes References used to support your presentation, including a minimum of two outside academic references in addition to course textbooks and videos .

You have been asked by the CIO of your company, or another company, .docx

You have been asked by the CIO of your company, or another company, .docx

You have been asked by the CIO of your company, or another company, .docx

Ethical hacking

Ethical hacking

Ethical hacking

Ähnlich wie Primary Task Response- Within the Discussion Board area- write 400600.docx (13)

The comparison of written and mediaCompare and contrast simila.docx

The comparison of written and mediaCompare and contrast simila.docx

The comparison of written and mediaCompare and contrast simila.docx

Ethical Hacking - Ferramentas Open Source para Pentest - Mateus Buogo - Tchel...

Ethical Hacking - Ferramentas Open Source para Pentest - Mateus Buogo - Tchel...

Ethical Hacking - Ferramentas Open Source para Pentest - Mateus Buogo - Tchel...

Assignment 3 Outline a New IT Security PolicyDue Week 9 and wor.docx

Assignment 3 Outline a New IT Security PolicyDue Week 9 and wor.docx

Assignment 3 Outline a New IT Security PolicyDue Week 9 and wor.docx

Your company has taken a proactive approach to cybersecurity by ensuri.pdf

Your company has taken a proactive approach to cybersecurity by ensuri.pdf

Your company has taken a proactive approach to cybersecurity by ensuri.pdf

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

We use computers and electronic systems to run and store just about .docx

CMIT 321 EXECUTIVE PROPOSAL PROJECT

CMIT 321 EXECUTIVE PROPOSAL PROJECT

CMIT 321 EXECUTIVE PROPOSAL PROJECT

Prevent Getting Hacked by Using a Network Vulnerability Scanner

Prevent Getting Hacked by Using a Network Vulnerability Scanner

Prevent Getting Hacked by Using a Network Vulnerability Scanner

Running head CHALLENGES OF CYBER SECURITY9.docx

Running head CHALLENGES OF CYBER SECURITY9.docx

Running head CHALLENGES OF CYBER SECURITY9.docx

Meltdown and Spectre Haunt the World’s Computers”In early Janua.docx

Meltdown and Spectre Haunt the World’s Computers”In early Janua.docx

Meltdown and Spectre Haunt the World’s Computers”In early Janua.docx

Peerlyst Delhi NCR Chapter Meet

Peerlyst Delhi NCR Chapter Meet

Peerlyst Delhi NCR Chapter Meet

You have been asked by the CIO of your company, or another company, .docx

You have been asked by the CIO of your company, or another company, .docx

You have been asked by the CIO of your company, or another company, .docx

Ethical hacking

Ethical hacking

Ethical hacking

Mehr von helenc18

The total electromagnetic power emitted by the sun is 3.8 x 1026 W. This energy is used to power a satellite orbiting Mercury through the use of solar panels. What force is exerted by solar radiation impinging normally on a 5.0 m2 totally absorbing solar panel attached to this satellite? The orbital radius of Mercury is 5.8 x 1010 m. Solution given P = 3.8*10^26 W r = 5.8*10^10 m A = 5 m^2 Intensity of radiation at the surface of the Mercury, I = Power/Area = P/(4*pi*r^2) = 3.8*10^26/(4*pi*(5.8*10^10)^2) = 8989 W/m^2 Radiation pressure on completely oborbing surface, P = I/c = 8989/(3*10^8) = 2.996*10^-5 N so, Force due to radiation, F = P*A = 2.996*10^-5*5 = 1.50*10^-4 N <<<<<<<<-------Answer .

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The Tinsley Company exchanged land that it had been holding for future plant expansion for a more suitable parcel located farther from residential areas. Tinsley carried the land at its original cost of $31,500. According to an independent appraisal, the land currently is worth $75,000. Tinsley gave $17,000 in cash to complete the transaction. Prepare the journal entry to record the exchange assuming the exchange has commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Prepare the journal entry to record the exchange assuming the exchange lacks commercial substance. (If no entry is required for an event, select \"No journal entry required\" in the first account field.) Solution 1) Land: fair value $75,000 cash:paid + $17,000 New parcel = $92,000 2) New parcel = $92,000 Gain on exchnage = $43,500 cash = $17,000 land = $31,500 3) New parcel = $48,500 cash = $17,000 land = $31,500 .

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The State of Rhode Island publishes its budget and the various supporting information at www.budget.state.ri.us/index.htm which you should access and then answer the following: A. What are the duties of the budget office? (Hint: Use the About Us link.) B. What are the six governmental functions listed in the budget? For the most recent year, calculate the percentage of the total budget allocated to each function. C. What are the major sources of Rhode Island\'s revenues? Calculate the percentage which each category represents of the total revenues. D. What is the accounting basis used in the preparation of the budget? (Hint: Use the Primer link and scroll down until you see the Budget Basis section.) E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.) F. What did you learn from reviewing the most recent budget of the State of Rhode Island? Solution E. The budget mentions four categories of program performance measures. List them, and briefly describe how they are used in Rhode Island. (Hint: Scroll down until you see the Program Performance Measures section.) .

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The SRLY rules for consolidated tax returns are designed to keep corporations from trafficking their net operating losses. Explain. Solution The SRLY ( Seperate Return Limitation Year) is applicable in case of consolidation of financial statement of parent company with subsidary companies. According to this rules if a company take over by another company where the subsidary company having losses in that case its losses cannot be merge with the profit of parent company at the time of consolidation. the subsidary company have to file a seperate return till the losses turn into profit. This rule is mainly made to keep the track of losses of coperate sector & to show the actual picture of the corporate groups. By following this rules Coperates are not allowed to hide the losses by merging with another company. Secondly they can\'t take the benefit of tax by adjusting losses with profit. Thirdly the true picture of every entity is showed so that stakeholders can\'t be cheated. .

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The sound strikes the cantina walls and bounces off at the same angle as it struck in a process known as _____. A. reflection B. refraction C. constructive interference D. destructive interference 14. Sound Waves Choose One â€¢ 5 points Obi Wan hears the destruction of a planet and all of its people through \'the force\'. These sounds are only in his head and are not carried through space, since space has no _____ through which sound could transmit. electromagnetic wave electrons magnetic field medium 15. The Doppler Effect Choose One â€¢ 5 points However, had it been a real sound, the sound\'s pitch would have been increased by the Doppler Effect, since the Falcon was moving _____ the source of the sound. perpendicular to away from towards at the same speed as bounced wave 2 Angle of Reflection Angle of Incidence Incident wave A single direction of the Sound Wave from Greedo\'s Blaster Solution 1) Reflection . Reflection is the change in direction of a wavefront at an interface between two different media so that the wave front returns into the medium from which it originated. 2) Medium Sound waves require matter to transmit them, unlike light waves. 3) Towards The Doppler Effect tells us that as an object moves toward the source of sound, the pitch the object feels will increase; when the object moves away, the pitch decreases. In order for the pitch to increase, the falcon must be moving towards the source of sound. .

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The six platforms below are initially at rest in deep space. The indicated forces act on the platforms at endpoints, quarter-points, or midpoints. All forces have the same magnitude. heir Rank these platforms on the basis of the torque that acts on them, measured about their CM. Let the counterclockwise direction be positive and rank positive torques as larger than negative torques. Largest 1. 2.3.4.5. 6. Smallest The ranking cannot be determined based on the information provided. Explain the reason for your ranking: Solution B > E > C = F > A > D let F is the magnitude of force and L is the total length. A) TA = -F*(L/4) - F*(L/4) = -F*L/2 B) TB = F*(L/2) + F*(L/2) = F*L C) TC = F*(L/4) + F*(L/4) = F*L/2 D) TD = F*(L/2) - F*(L/4) + F0 = F*L/4 E) TE = F*(L/2) + F*(L/2) - F*(L/4) = (3/4)*F*L F) TE = F*(L/2) + F*(L/2) - F*(L/4) - F*(L/4) = F*L/2 .

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The rise of various digital communication methods in the past decade has greatly changed the field of public relations. What new and emerging technologies do you think will continue to change the PR field? How do you anticipate the PR field changing in response to those technologies? Explain your answer carefully, citing specific examples of technology or real-life examples from the news. Solution PR is basically a method to built and maintain relationsship with different stake holders of an organization. Stake holders are investors,employees,customers,suppliers, regulating agencies , government and society at large.This happens through constat interaction and communication with the concerned people . In the modern times , communication has become very easy with the availability of smart phones and internet.One can communicate/send mails to thousands of people at the click of a mouse.Unlike in traditional way of sending hard copy mailers which takes lot of time to be delivered, emails can reach the receipiant in fraction of a second. Further one doesn\'t have to physically go to a person to chat or talk. He can do that through video conferencing sitting at his home/office through skype or he can also do text based chate in sites like facebook,gmail,yahoo messenger etc .

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The reason that the increase in population growth in the 19th and 20th centuries did not lead to famine as Thomas Malthus predicted was because wars kept the population in check there was diminishing marginal product of labor increases in technology and capital raised labor productivity people learned to eat less worldwide population didn\'t actually grow Solution 3. increases in technology and capital raised labor productivity .

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The sale of stock and the sale of bonds are reported as financing activities. Are payments of dividends to shareholders and payments of interest to bondholders also reported as financing activities? Explain. Solution The payment of cash dividends to shareholders is classified as a financing activity. FINANCING ACTIVITIES include transactions between the company and its owners and creditors. That is, they include the sale or buyback of stocks or bonds issued by the company and dividend payments by the company to its shareholders. In general, changes involving noncurrent liabilities and stockholders\' equity are reported in the financing activities section. Note the difference between investing and financing activities in the context of the purchase and sale of stocks and bonds. When you buy or sell the stock or bond issued by someone else, it is considered an investing activity. When you issue (sell) or buy back stock or bonds that you had issued, it is considered part of a financing activity. Cash inflows from financing activities arise when the company issues stock or borrows (by issuing a bond or by signing a note, or otherwise). Cash outflows from financing activities arise when the company buys back its own stock or bonds, repays loans, or pays dividends to shareholders. Note that dividends paid to shareholders are considered to be part of financing activities, but interest paid to bondholders is included only as an operating activity. Furthermore, as noted earlier, both dividend and interest revenues received by the company are included in cash flows from operating activities section. NONCASH INVESTING AND FINANCING ACTIVITIES include noncash transactions that effect both noncurrent assets and noncurrent liabilities or owners\' equity. .

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

Precipitation volumetric analysis involves formation reactions of soluble compounds. What are the main factors that influence conditions for a successful analysis? Explain how these factors may influence the profiles of the titration curves. Solution Following factors influence the precipitation volumetric analysis. 1. Nature of solvent- polarity is directly proportional to the precipitation formation. More polar the solvent more the precipitation. 2. Ph of solution is directly proportional to the precipitation formation. More acidic solutuons form precipitate readily than basic solutions. 3. Concentration of solution is directly proportional to the precipitation formation. Diltue solution form less stable precipitate. 4. Formation of low solubility product in precipitation titration decrease the end point in titration. This can be overcome by adjusting ph. 5. Temperature is directly proportional to the precipitation. 6. Foreign elements present decrease the stability of product as they can show coprecipitation. 4. .

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

POST-LAB QUESTIONS 1. Based on your observations, what aimilarities did you observe in the appearances of the DNA Erom different sources (list two] ? 2. Based on your observations, what ditferences did you observe in the appearances of the DNA from different DNA sources (list two)? 3. Why was isopropanol added to the filtrated liquid and not the extraction buffer? 4. Write the complementary DNA sequence for the following segment of DNA (main strand) Main strand ATGATTGACATTGAGGATCCAT Complementary Strand Solution Answer - Similarties - Both contain 3 nitrogenous bases: Adenine, Cytosine and Guanine. both have a phosphate groups in their nucleotides. Difference - DNA is a polymer with deoxyriboses and phosphate backbone while RNA is a polymer with a ribose and phosphate backbone. DNA contain thymine, while RNA contain uracil. complementary strand - PAIR ATÂ Â ;GC........write pair TACTAACTGTAACTCCTAGGTA .

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

Portman Corporation has retained earnings of $675,000 at January 1, 2014. Net income during 2014 was $1,400,000, and cash dividends declared and paid during 2014 totaled $75,000. Prepare a retained earnings statement for the year ended December 31, 2014. (List items that increase retained earnings first.) Solution Computation of Retained Earning of Portman Corporation as on December 31, 2014.We have, .

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Please write it in Microsoft Word. Not in handwritten form. I\'ll give +A review. Q2. Write a biography paragraph about the scientist: Ohm. Solution Name : George Simon Ohm. He is a German Physicist. Total Life : March 16 th 1789 to July 6 th 1854. ( 65 years 3 months and 20 days ) Studies : he studied the subjects are Maths , Physics , Chemistry , Philosophy. he is a doctorate from Erlangen University. ( October 25 th 1811 ) Teaching carrier : He worked as a Teacher and Professor in various Posistions and in various places. Invention : Ohm\'s Law. V = i R V = voltage i = current R = resistance Famous Law which will be useful in the total electricity concepts. Awards : Copley Medal in the year of 1841. and Scintific career. Area of interests : Physics Especially in Electric fields. .

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

please write carefully and explain clearly. Thank you. Solution Ksp of CoCO3 = 1*10^-10 CoCO3 (s) -----------------> Co^2+ (aq) + CO3^2- (aq) s s Ksp = [Co^2+][CO3^2-] Ksp = s*s Ksp = s^2 1*10^-10 = s^2 s^2 = 1*10^-10 s = 1*10^-5 mole/L molar mass of CoCO3 = 118.94g/mole solubility of cobalt(II) carbonate = 1*10^-5 mole/L = 1*10^-5 mole/L * 118.94g/mole = 1.1894*10^-3g/L = 1.1894mg/L The solubility of CoCO3 = 1.1894mg/L .

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

Prioritize the three themes of integrated solid waste management. 1^st priority 2^nd priority 3^rd priority Solution 1.Waste Prevention:Waste prevention also called â€œsource reductionâ€seeks to prevent waste from being generated. Waste prevention strategies include using less packaging, designing products to last longer, and reusing products and materials. Waste prevention helps reduce handling, treatment, and disposal costs and ultimately reduces the generation of methane 2.Recycling and Composting: Recycling is a process that involves collecting, reprocessing, and recovering certain waste materials (e.g., glass, metal, plastics, paper) to make new materials or products. Some recycled organic materials are rich in nutrients and can be used to improve soils. 3.Disposal (landfilling and combustion). These activities are used to manage waste that cannot be prevented or recycled. One way to dispose of waste is to place it in properly designed, constructed, and managed landfills, where it is safely contained. Another way to handle this waste is through combustion. .

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

present synchronized savage code while (1) { getServingFromPot (); eat (); } present synchronized cook code here while (1) { refillPot (); } Solution servings = 0 mutex = Semaphore(1) emptyPot = Semaphore(0) fullPot = Semaphore(0) <Cook> while true: emptyPot.wait() putServingsInPot(M) fullPot.signal() <Savage> while true: mutex.wait() if servings == 0: emptyPot.signal() fullPot.wait() servings = M servings -= 1 getServingFromPot() mutex.signal() eat() .

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

Prepare general journal entries to record the following transactions for the Harris Company. (The company uses the balance sheet approach for recording bad debts expense.) 2010 Dec. 31 Recorded Bad Debts Expense, $800 2011 Jan. 3 Wrote off Jalâ€™s account as uncollectible, $60 Mar. 4 Wrote off Hallâ€™s account as uncollectible, $75 Jul. 5 Recovered $45 from Hall Aug. 19 Wrote off M. Wilsonâ€™s account as uncollectible, $100 Nov. 7 Recovered $25 from Jal Solution (1) Dec 31, 2010 DR Bad Debt Expense $800 Accounts Receivable $800 (To record bad debt expense) (2) Jan 3, 2011 DR Allowance for uncollectible receivable $60 Accounts receivable $60 (To record write-off of Jal\'s account as uncollectible) (3) Mar 4, 2011 DR Allowance for uncollectible receivable $75 Accounts receivable $75 (To record write-off of Hall\'s account as uncollectible) (4) Jul 5, 2011 DR Cash $45 Bad debt recovered (Income) $45 (To record partial recovery of bad debt from Hall) (5) Aug 19, 2011 DR Allowance for uncollectible receivable $100 Accounts receivable $100 (To record write-off of M. Wilson\'s account as uncollectible) (6) Nov 7, 2011 DR Cash $25 Bad debt recovered (Income) $25 (To record partial recovery of bad debt from Jal) .

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare functional specifications for the company\'s use of the Web and the Internet. Include links to and from other sites in your design. Prepare a list of technological specifications for implementation (e.g., what hardware and software are necessary to support your design)? Solution Functional specification is a document prepared by an organization to describe the capabilities of the product, and its interaction with users and appearance. The document is developed for software developers. Through this document software developers understand how website functions and behave. Different tools used to prepare functional specification include case scenario, affinity diagrams, storyboards etc. Functional specifications are valuable for understanding behavior, structure, and functional specification. They help developers and designers to present the information in effective manner. This information helps users interact with the website effectively. Different technological specifications important to be implemented in a website design are mentioned below: Technological specification varies on the basis of website or system being designed. .

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 most important reasons why a company should invest in cybersecurity tools and technologies. Your audience is a group of managers (technical and non-technical) who are participating in a conference on reducing risks associated with insider threats. Provide in-text citations and references for 3 or more authoritative sources. Put the reference list at the end of your posting. Solution Reason One The increasing use of Internet of Thing In business organization the Internet of thing means the addition of devices which can access the organization data and increase in number of threats of security flaws. Since these devices werenâ€™t originally registered on network, they may not have enough cybersecurity protections. so it become easy for cyber criminals to use a device to gain unauthorized access to the hidden data of the organization. Reason 2 The Breaches are a financial burden Whenever a breach is discovered, systems are often taken offline to plug the security holes as a result of which the organization may not be able to take more customer order and to fullfil the last order placed, hence it become necessary to include cybersecurity to reduce such financial burden on organization. Reason 3 the real threats are insider threats The fraud employee sometimes inflict tremendous harm to take revange with organization or to have a personal profit. The risk associated with this type of threat is that it is very difficult to find such internal loop holes. Reason 4 Without cybersecurity the reputation of the organization is at risk. If the organization does\'nt opt the cybersecurity strategy then customer always think that there data is at risk and they will diverge from the organization which really harms the reputation of the organization .

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Mehr von helenc18 (19)

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The total electromagnetic power emitted by the sun is 3-8 x 1026 W- Th.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The Tinsley Company exchanged land that it had been holding for future.docx

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The State of Rhode Island publishes its budget and the various support.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The SRLY rules for consolidated tax returns are designed to keep corpo.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The sound strikes the cantina walls and bounces off at the same angle.docx

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The six platforms below are initially at rest in deep space- The indic.docx

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The rise of various digital communication methods in the past decade h.docx

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The reason that the increase in population growth in the 19th and 20th.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

The sale of stock and the sale of bonds are reported as financing acti.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

Precipitation volumetric analysis involves formation reactions of solu.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

POST-LAB QUESTIONS 1- Based on your observations- what aimilarities di.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Portman Corporation has retained earnings of $675-000 at January 1- 20.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

Please write it in Microsoft Word- Not in handwritten form- I-'ll give.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

please write carefully and explain clearly- Thank you-SolutionKsp of C.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

Prioritize the three themes of integrated solid waste management- 1^st.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

present synchronized savage code while (1) { getServingFromPot ()- ea.docx

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare general journal entries to record the following transactions f.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare functional specifications for the company-'s use of the Web an.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Prepare a 3 to 5 paragraph briefing statement which explains the 3 mos.docx

Kürzlich hochgeladen

Python Notes for mca i year students osmania university.docx

Python Notes for mca i year students osmania university.docx

Python Notes for mca i year students osmania university.docx

Ramakrishna Reddy Bijjam

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

Nguyen Thanh Tu Collection

How to setup Pycharm environment for Odoo 17.pptx

How to setup Pycharm environment for Odoo 17.pptx

How to setup Pycharm environment for Odoo 17.pptx

Key note speaker Neum_Admir Softic_ENG.pdf

Key note speaker Neum_Admir Softic_ENG.pdf

Key note speaker Neum_Admir Softic_ENG.pdf

Klinik_ Apotek Onlin 085657271886 Solusi Menggugurkan Masalah Kehamilan Anda Jual Obat Aborsi Asli KLINIK ABORSI TERPEECAYA _ Jual Obat Aborsi Cytotec Misoprostol Asli 100% Ampuh Hanya 3 Jam Langsung Gugur || OBAT PENGGUGUR KANDUNGAN AMPUH MANJUR OBAT ABORSI OLINE" APOTIK Jual Obat Cytotec, Gastrul, Gynecoside Asli Ampuh. JUAL ” Obat Aborsi Tuntas | Obat Aborsi Manjur | Obat Aborsi Ampuh | Obat Penggugur Janin | Obat Pencegah Kehamilan | Obat Pelancar Haid | Obat terlambat Bulan | Ciri Obat Aborsi Asli | Obat Telat Bulan | Pil Aborsi Asli | Cara Menggugurkan Konten | Cara Aborsi Tuntas | Harga Obat Aborsi Asli | Pil Aborsi | Jual Obat Aborsi Cytotec | Cara Aborsi Sendiri | Cara Aborsi Usia 1 Bulan | Cara Aborsi Usia 2 Tahun | Cara Aborsi Usia 3 Bulan | Obat Aborsi Usia 4 Bulan | Cara Abrasi Usia 5 Bulan | Cara Menggugurkan Konten | Kandungan Obat Penggugur | Cara Menghitung Usia Konten | Cara Mengatasi Terlambat Bulan | Penjual Obat Aborsi Asli | Obat Aborsi Garansi | Kandungan Obat Peluntur | Obat Telat Datang Bulan | Obat Telat Haid | Obat Aborsi Paling Murah | Klinik Jual Obat Aborsi | Jual Pil Cytotec | Apotik Jual Obat Aborsi | Kandungan Dokter Abrasi | Cara Aborsi Cepat | Jual Obat Aborsi Bergaransi | Jual Obat Cytotec Asli | Obat Aborsi Aman Manjur | Obat Misoprostol Cytotec Asli. "APA ITU ABORSI" “Aborsi Adalah dengan membendung hormon yang di perlukan untuk mempertahankan kehamilan yaitu hormon progesteron, karena hormon ini dibendung, maka jalur kehamilan mulai membuka dan leher rahim menjadi melunak,sehingga mengeluarkan darah yang merupakan tanda bahwa obat telah bekerja || maksimal 1 jam obat diminum || PENJELASAN OBAT ABORSI USIA 1 _7 BULAN Pada usia kandungan ini, pasien akan merasakan sakit yang sedikit tidak berlebihan || sekitar 1 jam ||. namun hanya akan terjadi pada saatdarah keluar merupakan pertanda menstruasi. Hal ini dikarenakan pada usiakandungan 3 bulan,janin sudah terbentuk sebesar kepalan tangan orang dewasa. Cara kerja obat aborsi : JUAL OBAT ABORSI AMPUH dosis 3 bulan secara umum sama dengan cara kerja || DOSIS OBAT ABORSI 2 bulan”, hanya berbedanya selain mengisolasijanin juga menghancurkan janin dengan formula methotrexate dikandungdidalamnya. Formula methotrexate ini sangat ampuh untuk menghancurkan janinmenjadi serpihan-serpihan kecil akan sangat berguna pada saat dikeluarkan nanti. APA ALASAN WANITA MELAKUKAN ABORSI? Aborsi di lakukan wanita hamil baik yang sudah menikah maupun belum menikah dengan berbagai alasan , akan tetapi alasan yang utama adalah alasan-alasan non medis (termasuk aborsi sendiri / di sengaja/ buatan] MELAYANI PEMESANAN OBAT ABORSI SETIAP HARI, SIAP KIRIM KESELURUH KOTA BESAR DI INDONESIA DAN LUAR NEGERI. HUBUNGI PEMESANAN LEBIH NYAMAN VIA WA/: 085657271886

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...

SOC 101 Demonstration of Learning Presentation

SOC 101 Demonstration of Learning Presentation

SOC 101 Demonstration of Learning Presentation

Wizards are very useful for creating a good user experience. In all businesses, interactive sessions are most beneficial. To improve the user experience, wizards in Odoo provide an interactive session. For creating wizards, we can use transient models or abstract models. This gives features of a model class except the data storing. Transient and abstract models have permanent database persistence. For them, database tables are made, and the records in such tables are kept until they are specifically erased.

How to Create and Manage Wizard in Odoo 17

How to Create and Manage Wizard in Odoo 17

How to Create and Manage Wizard in Odoo 17

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

RamjanShidvankar

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf

Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf

Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf

Dr Vijay Vishwakarma

Mehran University Newsletter Vol-X, Issue-I, 2024

Mehran University Newsletter Vol-X, Issue-I, 2024

Mehran University Newsletter Vol-X, Issue-I, 2024

Mehran University of Engineering & Technology, Jamshoro

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

Dr. Sarita Anand

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

dhanjurrannsibayan2

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

Elizabeth Walsh

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

MaritesTamaniVerdade

On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx

On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx

On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Jamworks pilot and AI at Jisc (20/03/2024)

Jamworks pilot and AI at Jisc (20/03/2024)

Jamworks pilot and AI at Jisc (20/03/2024)

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Kürzlich hochgeladen (20)

Python Notes for mca i year students osmania university.docx

Python Notes for mca i year students osmania university.docx

Python Notes for mca i year students osmania university.docx

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

80 ĐỀ THI THỬ TUYỂN SINH TIẾNG ANH VÀO 10 SỞ GD – ĐT THÀNH PHỐ HỒ CHÍ MINH NĂ...

How to setup Pycharm environment for Odoo 17.pptx

How to setup Pycharm environment for Odoo 17.pptx

How to setup Pycharm environment for Odoo 17.pptx

Key note speaker Neum_Admir Softic_ENG.pdf

Key note speaker Neum_Admir Softic_ENG.pdf

Key note speaker Neum_Admir Softic_ENG.pdf

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...

Jual Obat Aborsi Hongkong ( Asli No.1 ) 085657271886 Obat Penggugur Kandungan...

SOC 101 Demonstration of Learning Presentation

SOC 101 Demonstration of Learning Presentation

SOC 101 Demonstration of Learning Presentation

How to Create and Manage Wizard in Odoo 17

How to Create and Manage Wizard in Odoo 17

How to Create and Manage Wizard in Odoo 17

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

Application orientated numerical on hev.ppt

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Graduate Outcomes Presentation Slides - English

Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf

Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf

Unit 3 Emotional Intelligence and Spiritual Intelligence.pdf

Mehran University Newsletter Vol-X, Issue-I, 2024

Mehran University Newsletter Vol-X, Issue-I, 2024

Mehran University Newsletter Vol-X, Issue-I, 2024

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

Google Gemini An AI Revolution in Education.pptx

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

How to Give a Domain for a Field in Odoo 17

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

Single or Multiple melodic lines structure

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

FSB Advising Checklist - Orientation 2024

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx

On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx

On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx

On_Translating_a_Tamil_Poem_by_A_K_Ramanujan.pptx

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Sociology 101 Demonstration of Learning Exhibit

Jamworks pilot and AI at Jisc (20/03/2024)

Jamworks pilot and AI at Jisc (20/03/2024)

Jamworks pilot and AI at Jisc (20/03/2024)

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Towards a code of practice for AI in AT.pptx

Primary Task Response- Within the Discussion Board area- write 400600.docx

1. Primary Task Response: Within the Discussion Board area, write 400â€“600 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions by your classmates. Be substantive and clear, and use examples to reinforce your ideas. You have been a system administrator for 15 years, and you have seen your role evolve and change. This evolution of information technology (IT) has resulted in IT security being a top priority in Enterprise support. When you first started in this field, security was merely checking virus updates and making sure you put patches on your computers to protect the system from intruders. If the servers or workstations did get a virus, you conducted research on your own to find an antidote. Today, botnets, spam, phishing, and malware challenge security. Provide 3â€“4 paragraphs that define how the IT security landscape has evolved over the last 10 years and how today's current technology works to keep environments secure. Feel free to mention how some of the tools used to protect your system include the following: Intrusion detection and prevention systems Firewalls Antivirus software Other software to eliminate malware and other such intrusive programs Has to be 400-600 words!! Solution I have been a system administrator for past 15 years and my roles include: Summary Responsible for designing, organizing, modifying, and supporting a company's computer systems. Designs and installs LANs, WANs, Internet and intranet systems, and network segments.

2. Primary responsibilities