4. Chapter 9 Genetics
• Punnett Squares: set one up, complete it and
determine ratios and percents.
• Genotype of Parents:
• Heterozygous: Aa
• Phenotype of Parents:
• Dominant
• Offspring Ratios:
• ¼ AA, 2/4 Aa, ¼ aa
• Homozygous Dominant
• Heterozygous
• Homozygous Recessive
5. Chapter 9 vocabulary
• Genotype: genetic make-up, example: Rr, BB
• Phenotype: physical appearance, Round, blue
• Homozygous: 2 alleles are the same: BB
• Heterozygous: 2 alleles are different: Rr
• Dominant: allele masks the presence of another
(capital letter). Only have to have one to exhibit
the trait.
• Recessive: is masked by the presence of another
allele (lower case). Need to have two to exhibit
the trait (homozygous)
6. Chapter 10
DNA: Deoxyribonucleic Acid RNA: Ribonucleic Acid
• 2 Strands • 1 strand
• Twisted ladder • mRNA: straight
• Double helix (messenger)
• A-T and C-G • tRNA: hairpin (transfer)
• Codes for amino acid • rRNA: globular (ribosomes)
sequence (instructions for
building proteins) • A-U and C-G
• Never leaves nucleus • Carries directions from DNA
• Discovered by Watson and in Nucleus out to cell
Crick
7. Chapter 10
• Codons: code for amino acids, sequence of 3
nucleotides of mRNA
• AACUUGCAUGGUACCGGUAUCCUA
• Use table to find amino acid sequence (codon
bingo)
8. Ch. 12 Pedigrees
• Fully shaded: Has disorder
• Half shaded: Carries allele for trait (or has it if the
trait is dominant)
• Unshaded: Does not have trait
• Use info to construct Punnett Squares
• Marriage, cousins, siblings, generations, etc.
9. Ch. 12 Sex-linked inheritance
• Hemophilia: blood clotting disorder
• Carried on X chromosome.
• Phenotypes and Genotypes
• Why is it rare for females to have hemophilia?
10. Ch. 12 Sex-linked Inheritance
• Notation for Sex-linked traits use Sex
Chromosomes XX or XY.
• Muscular Dystrophy, Color Blindness are SL.
11. Ch. 12 Genetic Disorders
• Non-disjunction: copies of chromosomes do
not properly separate during meiosis.
• Result: gametes (egg or sperm) have either an
extra copy of a chromosome or are missing a
chromosome.
12. Ch. 12 Genetic Disorders
• Extra copy of a chromosome = Trisomy
• Examples of Trisomy: Trisomy 21 = Down
syndrome, XXY Klinefelter’s Syndrome
• Missing copy of a chromosome = Monosomy
• Example of Monosomy: X _ = Turner’s
Syndrome
13. Ch. 13. DNA Fingerprints
• Investigators use them because EVERYONE
(except identical twins) have unique DNA.
• DNA fingerprints are the pattern of bands
made up of specific fragments from an
individuals DNA.
• DNA fingerprints are collected by first
collecting CELLS left at the crime scene by the
suspect, DNA is in the nucleus of the CELLS!!
14. Ch. 14 Biogenesis vs. Spontaneous
Generation
Redi’s Experiment proved maggots from flies
Control Experimental
15. Ch. 14 Biogenesis vs. Spontaneous
Generation
• Spallanzani killed the “vital force”
• Control
• Experimental
17. Ch. 14 Early Earth
• Early ancestors of cyanobacteria (first
autotrophic cells) put oxygen into
atmosphere.
• Performed photosynthesis.
• First cells on Earth were prokaryotic and
heterotrophic
• Prokaryotic = single celled, small, no nucleus
• Heterotrophic = eat for energy
18. Ch. 15 Evolution
• Darwin’s Finches: size and shape of beak
related to food they eat.
• Natural Selection: organisms with most
successful traits survive, reproduce, pass
favorable trait on to offspring. Number of
members of population with favorable trait
increase each generation.
19. Chapter 16 Evolution Cont.
• Speciation: process of species forming
• Geographic Isolation: physical separation of
member of a population, gene flow
stops, each evolve into different species
because pressures are different in each area.
• Reproductive Isolation: barriers to successful
breeding between population groups in the
same area.
20. Chapter 17 Amino Acid Sequences and
Evolutionary Relationships
• The greater the similarity between amino acid
sequences (more in common) of two species
the more closely related the two species are
evolutionarily.
• The longer the 2 species have been diverging
(V) from a common ancestor, the greater the
differences in sequences (less in common)
21. Ch. 19 Environmental Issues
• Global Warming: rise in average high
temperatures around the world.
• Greenhouse Effect: gases in the atmosphere
(water vapor, carbon dioxide, methane) reflect
heat and direct it back to Earth.
22. Ch. 19 Environmental Issues
• Hole in the Ozone: Ozone is needed to block
UV Radiation from the sun. Hole leads to
more cases of cancer. Discovered in 1985.
Ban on use of ozone destroying chemicals like.
• CFC’s (chloroflourocarbons)
23. Ch. 19 important vocabulary
• Abiotic Factor: non-living components in
ecosystem. Examples: temperature,
precipitation, landscape, minerals in soil,
rocks.
• Biotic Factor: living components in ecosystem.
• Agricultural Revolution: increased, steady
food supply lead to explosion of human
population. Later medical advances and
sanitation also contributed.
24. Ch. 21
• Competition (-,-)
• Competitive Exclusion: 1 species is eliminated
from a community because of competition for
same limited resource. Example?
• Resource Partitioning: when similar species co-
exist, each uses only part of the available
resource. Example?
• Character Displacement: evolution of physical
differences that reduce competition between
similar species. Example?
25. Ch. 21
• Parasitism (+,-)
• Parasite (+): Organism obtains nutrition at the
expense of another organism. Example:
• Host(-): organism that is being hurt or fed off
of.
26. Ch. 21
• Predation (+,-)
• Predator (+): obtains energy by eating another
organism (plant or animal)
• Prey (-): organism being eat by the predator.
27. Ch. 21
• Mutualism (+,+)
• Interaction in which both species benefit.
• Commensalism (+,0)
• Interaction in which one species benefit and
another is not affected.
28. Ch. 21
• Primary Succession: No soil exists, nothing
growing, pioneer species grow, then herbs,
then shrubs, then trees, then a mature forest.
• Secondary Succession: Soil exists, climax
community, disaster destroys ecosystem,
pioneer species, herbs, shrubs, trees, mature
forest.
29. Ch. 22
• Consumers are heterotrophs.
• Carnivore eat meat. (secondary, tertiary)
• Herbivore eat plants. (primary)
• Omnivore eat both meat and plants.
(secondary)
• Producers: autotrophs, plants, produce own
food with energy from the sun, perform
photosynthesis.
30. Ch. 22
• Food webs: examine and determine
relationships and domino effect
31. Ch. 22
• Biomes/Ecosystems: know characteristics
• Tundra: cold, low biodiversity, found at poles.
• Tiaga: south of poles, evergreen trees, less
rain than here, colder.
• Temperate Deciduous Forest: here, 4 seasons,
trees lose leaves.
• Grassland: less rain than here, 4 seasons,
Nebraska.
32. Ch. 22
• Desert: Cold at night, little rain, hot daytime,
found in interior of continents.
• Savanna: Warm, wet and dry seasons, grasses
• Tropical Rain Forest: year long growing
season, steady rain, HIGHEST biodiversity,
found near equator.
34. Biodiversity
• Highest in Tropical Rainforest.
• Lowest in Tundra
• Traveling from Equator to Tundra = to traveling
up a mountain (peak like Tundra).
35. Ethical
• 1. pertaining to or dealing with morals
or principles of morality; pertaining to right and
wrong in conduct.
• 2. being in accordance with the rules or standards
for right conduct or practice, especially the
standards of a profession: It was not considered
ethical for physicians to advertise.
• Think of it in terms of science and conducting
research, experiments, studies.