SlideShare ist ein Scribd-Unternehmen logo
1 von 10
How Much Breast & Ovarian Cancer Is Hereditary?
Ovarian CancerBreast Cancer
10-25%
70-80%
5–10% 15-20%
Sporadic
Familial
Hereditary
Features of Hereditary and Sporadic Cancer in Hereditary
Breast and Ovarian Cancer Syndrome (HBOC)
Hereditary Sporadic
• Multiple affected blood relatives in more
than one generation
• Typically, earlier age of onset (<50)
• Individuals with bilateral or more than
one cancer diagnosis (breast/ovarian)
•Males with breast cancer
• One or only a few affected blood
relatives
• Typically, later age of onset
Br, 42
Br, 47
Ov, 58
Br, 35Ov, 50
Br, 72
Chromosomes
BRCA1BRCA2
***~84% of HBOC is caused by BRCA1 & BRCA2
50% 50%
BRCA1
-chromosome 17
BRCA2 -
chromosome 13
BRCA1 & BRCA2
Lifetime Cancer Risks
Type
of Cancer
General
Population
BRCA1 BRCA2
Female Breast
Cancer
12% 56-87% 56-87%
2nd
Breast Cancer 0.8-1.5%
(per year – 5y)
5 year: 20%
Lifetime: 64%
5 year: 12%
Lifetime: 50%
Ovarian Cancer 1.8% 44% 27%
Male Breast
Cancer
0.1% ~1-2% 6-10%
Pancreatic Cancer <1% - - ~1.5-5%
Melanoma 1-2% - - Increased
Prostate Cancer 12% ~15-20% ~15-20%
Cancer Screening and Risk-Reduction Options
Increased Screening Risk-Reduction
Surgery
Medications
Breast
• Monthly breast-self
exam
• Clinical breast exam
every 6 months
• Yearly mammogram
• Yearly MRI
Bilateral Mastectomy
can reduce the risk of
breast cancer by 96%
Tamoxifen/
Raloxifene can
reduce the risk of
breast cancer by
approximately 50%
Ovarian
• Transvaginal
Ultrasound
• CA-125 blood tests
every 6 months
* Limitations: Screening
is not effective at picking
up early stage cancer *
Bilateral Salpingo-
Oophorectomy
(removing both the
ovaries and fallopian
tubes) can reduce the
risk of ovarian cancer
by 96%
Oral Contraceptives
(birth control pills)
can reduce the risk
of ovarian cancer by
approximately 50%
Genetic Testing for Breast Cancer
BRCA1
BRCA2
ATGCCGTATAGCTAGTCGATGTACG
• Blood Test
• Misspellings, Deleted, or Added DNA [i.e., mutation]
• Tests offered:
-Analysis of BRCA1 & BRCA2 genes [3-4 weeks]
-Breast/Ovarian Panels [12 weeks]
-Targeted mutation analysis (when family mutation is known) [3 weeks]
Possible Test Results
Positive Result Increased chance of certain cancers;
(implications for other family
members ) (Known mutation detected)
Mutation has been identified in
Negative Result family (True Negative)
(No mutation detected) - No increase in risk above the
general population
Mutation has not been identified in
family and patient has cancer
- Cancer most likely not due to
BRCA1/2
Mutation has not been identified
in family and patient does not have
cancer
- Doesn’t rule out BRCA1/2
Variant of Uncertain Significance Cancer risk not yet known
(Mutation, but implications/management are not known)
Implications for
other family
members
Breast/Ovarian Panels
**Includes BRCA1/2 & 19 additional genes that can increase the risk for breast cancer
**High risk gene panel-BRCA1/2, CDH1, PTEN, STK11, TP53

Weitere ähnliche Inhalte

Was ist angesagt?

BRCA Bible
BRCA BibleBRCA Bible
BRCA BibleNHS
 
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain Lifecare Centre
 
Breast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate CancerBreast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate CancerThet Su Win
 
Aviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningAviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningbreastcancerupdatecongress
 
Brca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancerBrca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancergalinayakubova
 
Prophylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancerProphylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancerINVICTA GENETICS
 
Molecular biology of breast cancer and
Molecular biology of breast cancer andMolecular biology of breast cancer and
Molecular biology of breast cancer andbarun kumar
 
Breast Cancer
Breast CancerBreast Cancer
Breast Cancercphcosu
 
Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?Via Christi Health
 
Activating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With EstrogenActivating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With Estrogennvani
 
A data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survivalA data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survivalLisa Federer
 
Evolution of molecular prognostic testing in ER positive breast cancer
Evolution of molecular prognostic testing in ER positive breast cancerEvolution of molecular prognostic testing in ER positive breast cancer
Evolution of molecular prognostic testing in ER positive breast cancerBell Symposium &amp; MSP Seminar
 
Gene expression profiling in breast carcinoma
Gene expression profiling in breast carcinomaGene expression profiling in breast carcinoma
Gene expression profiling in breast carcinomaghoshparthanrs
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.hungnguyenthien
 

Was ist angesagt? (20)

BRCA Bible
BRCA BibleBRCA Bible
BRCA Bible
 
Brca testing
Brca testingBrca testing
Brca testing
 
DrTerespolsky
DrTerespolskyDrTerespolsky
DrTerespolsky
 
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain BRCA – IMPORTANCE IN HEREDITARY  BREAST & OVARIAN CANCER by Dr Sharda Jain
BRCA – IMPORTANCE IN HEREDITARY BREAST & OVARIAN CANCER by Dr Sharda Jain
 
Genetics of Breast Cancer
Genetics of Breast CancerGenetics of Breast Cancer
Genetics of Breast Cancer
 
Breast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate CancerBreast Cancer, Ovarian Cancer and Prostate Cancer
Breast Cancer, Ovarian Cancer and Prostate Cancer
 
12. brca in premenopausal breast cancer
12. brca in premenopausal breast cancer12. brca in premenopausal breast cancer
12. brca in premenopausal breast cancer
 
Aviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planningAviad Zick. Role of BRCA status in treatment planning
Aviad Zick. Role of BRCA status in treatment planning
 
Understanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer RiskUnderstanding BRCA1/2 Cancer Risk
Understanding BRCA1/2 Cancer Risk
 
Brca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancerBrca2 mutation and their influence to cancer
Brca2 mutation and their influence to cancer
 
Prophylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancerProphylaxis and early diagnosis of breast cancer
Prophylaxis and early diagnosis of breast cancer
 
Molecular biology of breast cancer and
Molecular biology of breast cancer andMolecular biology of breast cancer and
Molecular biology of breast cancer and
 
Genetics 101: Sandra Brown, MS, LCGC
Genetics 101: Sandra Brown, MS, LCGCGenetics 101: Sandra Brown, MS, LCGC
Genetics 101: Sandra Brown, MS, LCGC
 
Breast Cancer
Breast CancerBreast Cancer
Breast Cancer
 
Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?Breast cancer genetic testing: Is it right for you?
Breast cancer genetic testing: Is it right for you?
 
Activating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With EstrogenActivating Brca1 And Brca2 With Estrogen
Activating Brca1 And Brca2 With Estrogen
 
A data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survivalA data driven nomogram for breast cancer survival
A data driven nomogram for breast cancer survival
 
Evolution of molecular prognostic testing in ER positive breast cancer
Evolution of molecular prognostic testing in ER positive breast cancerEvolution of molecular prognostic testing in ER positive breast cancer
Evolution of molecular prognostic testing in ER positive breast cancer
 
Gene expression profiling in breast carcinoma
Gene expression profiling in breast carcinomaGene expression profiling in breast carcinoma
Gene expression profiling in breast carcinoma
 
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
HEREDITARY BREAST and OVARY CANCER [HBOC] SYNDROME, Dr BUI DAC CHI.
 

Andere mochten auch

Ca ovary dr. varun
Ca ovary  dr. varunCa ovary  dr. varun
Ca ovary dr. varunVarun Goel
 
Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...
Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...
Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...Douglas Riegert-Johnson
 
Managing Motion from End to End
Managing Motion from End to EndManaging Motion from End to End
Managing Motion from End to EndSGRT Community
 
Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".
Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".
Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".Academia Nacional de Medicina
 
Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)
Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)
Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)College of Medicine, Sulaymaniyah
 
Onco emergencies : DR. DEVAWRAT BUCHE
Onco emergencies : DR. DEVAWRAT BUCHEOnco emergencies : DR. DEVAWRAT BUCHE
Onco emergencies : DR. DEVAWRAT BUCHEDevawrat Buche
 
Como fazer SRS, SBRT, IGRT com EPID Casos Clínicos
Como fazer SRS, SBRT, IGRT com EPID Casos ClínicosComo fazer SRS, SBRT, IGRT com EPID Casos Clínicos
Como fazer SRS, SBRT, IGRT com EPID Casos ClínicosJean Carlo Cadillo López
 
Genetic counseling
Genetic counselingGenetic counseling
Genetic counselingupinder71
 
Cancer Chemotherapies Final
Cancer Chemotherapies FinalCancer Chemotherapies Final
Cancer Chemotherapies Finalluisa3001
 
Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Mohamed Abdulla
 
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...Setia Pramana
 
SBRT versus Surgery in Early lung cancer : Debate
SBRT versus Surgery in Early lung cancer : DebateSBRT versus Surgery in Early lung cancer : Debate
SBRT versus Surgery in Early lung cancer : DebateRuchir Bhandari
 
Molecular subtypes of breast cancer
Molecular subtypes of breast cancerMolecular subtypes of breast cancer
Molecular subtypes of breast cancerJoydeep Ghosh
 
Stereotactic Body Radiation Therapy
Stereotactic Body Radiation TherapyStereotactic Body Radiation Therapy
Stereotactic Body Radiation Therapyfondas vakalis
 
Ovarian cancer ppt
Ovarian cancer pptOvarian cancer ppt
Ovarian cancer pptVidya Dhonde
 

Andere mochten auch (20)

Ca ovary dr. varun
Ca ovary  dr. varunCa ovary  dr. varun
Ca ovary dr. varun
 
Ca Ovary
Ca OvaryCa Ovary
Ca Ovary
 
Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...
Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...
Hereditary breast and ovarian cancer clinic visit visual aids (Mayo Clinic Fl...
 
priya brca1
priya brca1priya brca1
priya brca1
 
Mutation
MutationMutation
Mutation
 
Managing Motion from End to End
Managing Motion from End to EndManaging Motion from End to End
Managing Motion from End to End
 
Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".
Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".
Dr. Claudio Casali: "Oncologia na Era da medicina personalizada".
 
Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)
Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)
Medicine 5th year, 2nd lecture/part four (Dr. Abdulla Sharief)
 
Onco emergencies : DR. DEVAWRAT BUCHE
Onco emergencies : DR. DEVAWRAT BUCHEOnco emergencies : DR. DEVAWRAT BUCHE
Onco emergencies : DR. DEVAWRAT BUCHE
 
Como fazer SRS, SBRT, IGRT com EPID Casos Clínicos
Como fazer SRS, SBRT, IGRT com EPID Casos ClínicosComo fazer SRS, SBRT, IGRT com EPID Casos Clínicos
Como fazer SRS, SBRT, IGRT com EPID Casos Clínicos
 
Genetic counseling
Genetic counselingGenetic counseling
Genetic counseling
 
Cancer Chemotherapies Final
Cancer Chemotherapies FinalCancer Chemotherapies Final
Cancer Chemotherapies Final
 
Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.Breast Cancer: A focus on BRCA Mutations.
Breast Cancer: A focus on BRCA Mutations.
 
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
Molecular Subtyping of Breast Cancer and Somatic Mutation Discovery Using DNA...
 
SBRT versus Surgery in Early lung cancer : Debate
SBRT versus Surgery in Early lung cancer : DebateSBRT versus Surgery in Early lung cancer : Debate
SBRT versus Surgery in Early lung cancer : Debate
 
Molecular subtypes of breast cancer
Molecular subtypes of breast cancerMolecular subtypes of breast cancer
Molecular subtypes of breast cancer
 
Brexit Webinar Series 4
Brexit Webinar Series 4Brexit Webinar Series 4
Brexit Webinar Series 4
 
Stereotactic Body Radiation Therapy
Stereotactic Body Radiation TherapyStereotactic Body Radiation Therapy
Stereotactic Body Radiation Therapy
 
Ovarian Cancer
Ovarian CancerOvarian Cancer
Ovarian Cancer
 
Ovarian cancer ppt
Ovarian cancer pptOvarian cancer ppt
Ovarian cancer ppt
 

Ähnlich wie Web. hboc visual aids

Genetic Testing for Cancer Risk
Genetic Testing for Cancer RiskGenetic Testing for Cancer Risk
Genetic Testing for Cancer Riskflasco_org
 
All in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic CancerAll in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic Cancerbkling
 
Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)Douglas Riegert-Johnson
 
Is surgical intervention in women with
Is surgical intervention in women withIs surgical intervention in women with
Is surgical intervention in women withWafaa Benjamin
 
Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016OSUCCC - James
 
Hereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate CancerHereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate Cancerflasco_org
 
Hereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer SyndromeHereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer SyndromeAsha Reddy
 
Testing, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological CancersTesting, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological CancersNamrata Das
 
Hereditary Cancer Syndrome
Hereditary Cancer SyndromeHereditary Cancer Syndrome
Hereditary Cancer SyndromeSujoy Dasgupta
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023CHC Connecticut
 
Chapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionChapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionNilesh Kucha
 
All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...Chicago Center for Jewish Genetic Disorders
 
Kawita bapat BRCA
Kawita bapat BRCA Kawita bapat BRCA
Kawita bapat BRCA Kawita Bapat
 
risk factor for breast cancer.pptx
risk factor for breast cancer.pptxrisk factor for breast cancer.pptx
risk factor for breast cancer.pptxPushpa Lal Bhadel
 
cancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).pptcancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).pptmidolyon1990gmailcom
 
cancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).pptcancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).pptmidolyon1990gmailcom
 
Etiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptxEtiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptxAkshaySarraf1
 

Ähnlich wie Web. hboc visual aids (20)

Genetic Testing for Cancer Risk
Genetic Testing for Cancer RiskGenetic Testing for Cancer Risk
Genetic Testing for Cancer Risk
 
BRCA ONCOLOGY.ppt
BRCA ONCOLOGY.pptBRCA ONCOLOGY.ppt
BRCA ONCOLOGY.ppt
 
BRCA ONCOLOGY.ppt
BRCA ONCOLOGY.pptBRCA ONCOLOGY.ppt
BRCA ONCOLOGY.ppt
 
All in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic CancerAll in the Family: Hereditary Risk for Gynecologic Cancer
All in the Family: Hereditary Risk for Gynecologic Cancer
 
Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)Ver c 2014 clinical reviews amelia island (1)
Ver c 2014 clinical reviews amelia island (1)
 
Cancer genetics.ppt
Cancer genetics.pptCancer genetics.ppt
Cancer genetics.ppt
 
Is surgical intervention in women with
Is surgical intervention in women withIs surgical intervention in women with
Is surgical intervention in women with
 
Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016Survivorship Issues Genetics 2016
Survivorship Issues Genetics 2016
 
Hereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate CancerHereditary Genetics focusing on Prostate Cancer
Hereditary Genetics focusing on Prostate Cancer
 
Hereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer SyndromeHereditary Breast and Ovarian Cancer Syndrome
Hereditary Breast and Ovarian Cancer Syndrome
 
Testing, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological CancersTesting, genetic counselling and its implications in Gynaecological Cancers
Testing, genetic counselling and its implications in Gynaecological Cancers
 
Hereditary Cancer Syndrome
Hereditary Cancer SyndromeHereditary Cancer Syndrome
Hereditary Cancer Syndrome
 
Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023Genetic Connections to Breast Cancer - February 14, 2023
Genetic Connections to Breast Cancer - February 14, 2023
 
Chapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer preventionChapter 38 role of surgery in cancer prevention
Chapter 38 role of surgery in cancer prevention
 
All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...All in the Family: Using Family Health History to Identify and Support Women ...
All in the Family: Using Family Health History to Identify and Support Women ...
 
Kawita bapat BRCA
Kawita bapat BRCA Kawita bapat BRCA
Kawita bapat BRCA
 
risk factor for breast cancer.pptx
risk factor for breast cancer.pptxrisk factor for breast cancer.pptx
risk factor for breast cancer.pptx
 
cancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).pptcancer_genetics_for_gps_13_july_2010 (1).ppt
cancer_genetics_for_gps_13_july_2010 (1).ppt
 
cancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).pptcancer_genetics_for_gps_13_july_2010 (2).ppt
cancer_genetics_for_gps_13_july_2010 (2).ppt
 
Etiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptxEtiopathogenesis and Risk factors of Ca Breast.pptx
Etiopathogenesis and Risk factors of Ca Breast.pptx
 

Mehr von Douglas Riegert-Johnson

2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer Syndromes2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer SyndromesDouglas Riegert-Johnson
 
Version i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromesVersion i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromesDouglas Riegert-Johnson
 
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.Douglas Riegert-Johnson
 
Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.Douglas Riegert-Johnson
 
2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjs2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjsDouglas Riegert-Johnson
 
Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)Douglas Riegert-Johnson
 
Version e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow upVersion e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow upDouglas Riegert-Johnson
 
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)Douglas Riegert-Johnson
 
Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Douglas Riegert-Johnson
 

Mehr von Douglas Riegert-Johnson (14)

Riegert Johnson Genetics Ver I.pptx
Riegert Johnson Genetics Ver I.pptxRiegert Johnson Genetics Ver I.pptx
Riegert Johnson Genetics Ver I.pptx
 
2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer Syndromes2020 Update In Hereditary Cancer Syndromes
2020 Update In Hereditary Cancer Syndromes
 
Version i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromesVersion i. riegert johnson. colorectal neoplasms and hereditary syndromes
Version i. riegert johnson. colorectal neoplasms and hereditary syndromes
 
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
Lynch Syndrome and Serrated Polyposis Syndrome in 20 minutes.
 
Version j 2017 uf medical grand rounds
Version j 2017 uf medical grand roundsVersion j 2017 uf medical grand rounds
Version j 2017 uf medical grand rounds
 
Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.Florida GI Society. Serrated polyps. Version i.
Florida GI Society. Serrated polyps. Version i.
 
2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjs2016 may. version c. pearls in the management of pjs
2016 may. version c. pearls in the management of pjs
 
Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)Ver r 2015 clinical reviews amelia island (1)
Ver r 2015 clinical reviews amelia island (1)
 
2015 fellows lecture version d
2015 fellows lecture version d2015 fellows lecture version d
2015 fellows lecture version d
 
Version e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow upVersion e 2015 hawaii serrated adenoma follow up
Version e 2015 hawaii serrated adenoma follow up
 
Polyppolyp lynch syndrome version a
Polyppolyp lynch syndrome version aPolyppolyp lynch syndrome version a
Polyppolyp lynch syndrome version a
 
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
Companion slideshow for polyppolyp.com (Familial adenomatous polyposis)
 
Case discussions in polyposis
Case discussions in polyposisCase discussions in polyposis
Case discussions in polyposis
 
Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014Familial Polyposis and Lynch syndrome review March 2014
Familial Polyposis and Lynch syndrome review March 2014
 

Kürzlich hochgeladen

Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls * UPA...
Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls  * UPA...Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls  * UPA...
Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls * UPA...mahaiklolahd
 
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...parulsinha
 
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...parulsinha
 
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...GENUINE ESCORT AGENCY
 
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls ServiceGENUINE ESCORT AGENCY
 
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...chennailover
 
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...Anamika Rawat
 
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableGENUINE ESCORT AGENCY
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋TANUJA PANDEY
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...adilkhan87451
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...parulsinha
 
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...
Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...
Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...GENUINE ESCORT AGENCY
 
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...GENUINE ESCORT AGENCY
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Availableperfect solution
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...chandars293
 

Kürzlich hochgeladen (20)

Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls * UPA...
Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls  * UPA...Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls  * UPA...
Call Girl in Indore 8827247818 {LowPrice} ❤️ (ahana) Indore Call Girls * UPA...
 
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
Independent Call Girls In Jaipur { 8445551418 } ✔ ANIKA MEHTA ✔ Get High Prof...
 
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service  Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
 
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
Models Call Girls In Hyderabad 9630942363 Hyderabad Call Girl & Hyderabad Esc...
 
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
9630942363 Genuine Call Girls In Ahmedabad Gujarat Call Girls Service
 
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
Coimbatore Call Girls in Coimbatore 7427069034 genuine Escort Service Girl 10...
 
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
Jogeshwari ! Call Girls Service Mumbai - 450+ Call Girl Cash Payment 90042684...
 
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service AvailableCall Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
 
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
Russian Call Girls Lucknow Just Call 👉👉7877925207 Top Class Call Girl Service...
 
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
Call Girls Service Jaipur {8445551418} ❤️VVIP BHAWNA Call Girl in Jaipur Raja...
 
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Hyderabad Just Call 8250077686 Top Class Call Girl Service Available
 
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...
Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...
Call Girls Vasai Virar Just Call 9630942363 Top Class Call Girl Service Avail...
 
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
🌹Attapur⬅️ Vip Call Girls Hyderabad 📱9352852248 Book Well Trand Call Girls In...
 
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
Pondicherry Call Girls Book Now 9630942363 Top Class Pondicherry Escort Servi...
 
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7Call Girls in Gagan Vihar (delhi) call me [🔝  9953056974 🔝] escort service 24X7
Call Girls in Gagan Vihar (delhi) call me [🔝 9953056974 🔝] escort service 24X7
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
 

Web. hboc visual aids

  • 1. How Much Breast & Ovarian Cancer Is Hereditary? Ovarian CancerBreast Cancer 10-25% 70-80% 5–10% 15-20% Sporadic Familial Hereditary
  • 2. Features of Hereditary and Sporadic Cancer in Hereditary Breast and Ovarian Cancer Syndrome (HBOC) Hereditary Sporadic • Multiple affected blood relatives in more than one generation • Typically, earlier age of onset (<50) • Individuals with bilateral or more than one cancer diagnosis (breast/ovarian) •Males with breast cancer • One or only a few affected blood relatives • Typically, later age of onset Br, 42 Br, 47 Ov, 58 Br, 35Ov, 50 Br, 72
  • 3. Chromosomes BRCA1BRCA2 ***~84% of HBOC is caused by BRCA1 & BRCA2
  • 5. BRCA1 & BRCA2 Lifetime Cancer Risks Type of Cancer General Population BRCA1 BRCA2 Female Breast Cancer 12% 56-87% 56-87% 2nd Breast Cancer 0.8-1.5% (per year – 5y) 5 year: 20% Lifetime: 64% 5 year: 12% Lifetime: 50% Ovarian Cancer 1.8% 44% 27% Male Breast Cancer 0.1% ~1-2% 6-10% Pancreatic Cancer <1% - - ~1.5-5% Melanoma 1-2% - - Increased Prostate Cancer 12% ~15-20% ~15-20%
  • 6. Cancer Screening and Risk-Reduction Options Increased Screening Risk-Reduction Surgery Medications Breast • Monthly breast-self exam • Clinical breast exam every 6 months • Yearly mammogram • Yearly MRI Bilateral Mastectomy can reduce the risk of breast cancer by 96% Tamoxifen/ Raloxifene can reduce the risk of breast cancer by approximately 50% Ovarian • Transvaginal Ultrasound • CA-125 blood tests every 6 months * Limitations: Screening is not effective at picking up early stage cancer * Bilateral Salpingo- Oophorectomy (removing both the ovaries and fallopian tubes) can reduce the risk of ovarian cancer by 96% Oral Contraceptives (birth control pills) can reduce the risk of ovarian cancer by approximately 50%
  • 7. Genetic Testing for Breast Cancer BRCA1 BRCA2 ATGCCGTATAGCTAGTCGATGTACG • Blood Test • Misspellings, Deleted, or Added DNA [i.e., mutation] • Tests offered: -Analysis of BRCA1 & BRCA2 genes [3-4 weeks] -Breast/Ovarian Panels [12 weeks] -Targeted mutation analysis (when family mutation is known) [3 weeks]
  • 8. Possible Test Results Positive Result Increased chance of certain cancers; (implications for other family members ) (Known mutation detected) Mutation has been identified in Negative Result family (True Negative) (No mutation detected) - No increase in risk above the general population Mutation has not been identified in family and patient has cancer - Cancer most likely not due to BRCA1/2 Mutation has not been identified in family and patient does not have cancer - Doesn’t rule out BRCA1/2 Variant of Uncertain Significance Cancer risk not yet known (Mutation, but implications/management are not known)
  • 10. Breast/Ovarian Panels **Includes BRCA1/2 & 19 additional genes that can increase the risk for breast cancer **High risk gene panel-BRCA1/2, CDH1, PTEN, STK11, TP53