3. PCR Enzyme Family - optimized for your unique application
Reverse-Transcriptases - unwind secondary structure,
create long cDNA, or optimize RT-PCR
Master Mixes – general laboratory and qPCR mixes
dNTPs-high quality + high value
Supporting reagents-One stop shop for ladders etc.
Sample Preparation for
Diagnostics & Life Science
www.biochain.com
1-888-762-2568 (Main)
order@biochain.com (Order)
4. BioChain PCR Enzyme Family
Taq DNA polymerase
Hot Start Taq DNA Polymerase
BioChain LA Polymerase
Purified from recombinant E. coli, Taq DNA polymerase was originally isolated from the
thermophilic bacterium Thermus aquaticus, and possesses 5’-3’ polymerase activity
(required for PCR amplification), and double-strand dependent 5’-3’ exonuclease activity
(needed for many qPCR and genotyping applications). Biochain’s recombinant Taq DNA
polymerase products are manufactured under strict quality control guidelines in an ISO
9001:2008 certified facility to provide consistent performance and stability. We offer both
standard and hot-start versions. This enzyme does not possess a 3’-5’ exonuclease activity
and is not recommended for applications requiring a proofreading enzyme. BioChain also
offers a proprietary enzyme blend optimized for amplifying long DNA fragments.
Applications:
- Genotyping
- DNA labeling
- Sequencing
- Mutagenesis
- General Lab PCR
- Hot Start PCR
Figure 1: BioChain Taq polymerase was aliquoted into 2 tubes and stored for 36
days. One was stored at -20 degrees C (orange) and the other at room temperature
(blue). Following incubation, a 191 bp fragment was amplified from a plasmid
containing an insert for the ANGPTL4 gene. As the amplification plots show,
BioChain’s Taq remained active even after 36 days at room temperature.
AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTACCCAAAGGCCTTAACCAAGGCCTTAATTCA
GACTTCAATTCCGGCCGATCAGGGGTTTACA
CCAATGGG
ACCATTACCCAACTT
AATTCCGGCCGATCAGGGGTTTACACCAAT
GGGACCA
TTACCCAA AATTCCGGCCGATCAGGGGTTTACACCAATGGGACCATTAC
ATCGCTAGCAGTACCATGA-
CAATGACATAGACTAGGTAG-
CAGTAGCCATGACGGTAGCAG-
TAGACGATGGATCAGATGACGA
TTATCAGTGCGTACGTACGATAT
AGCAGTAGCAGTAGCAGTAGC
AATTCCGGCCGATC
5. As we routinely isolate and amplify DNA from precious specimens in our tissue bank, we
know how frustrating a PCR failure can be. When we developed our own line of enzymes, we
took pains to be sure they would be robust. We perform extensive benchmarking experi-
ments to confirm that our units of activity are consistent with those used by our competitors.
We also push the limits in internal testing. For example, in one test, we performed real time
qPCR on a much longer fragment than is generally recommended in the literature (838bp vs
50-150bp). We observed a high reaction efficiency relative to our competitor even with this
long amplicon.
BioChain PCR Enzyme Family
ATCGCTAGCAGTACCATGA-
CAATGACATAGACTAGGTAG-
CAGTAGCCATGACGGTAGCAG-
TAGACGATGGATCAGATGACGA
TTATCAGTGCGTACGTACGATAT
ATCGCTAGCAGTACCATGA-
CAATGACATAGACTAGGTAG-
CAGTAGCCATGACGGTAGCAG-
TAGACGATGGATCAGATGACGA
TTATCAGTGCGTACGTACGATAT
AGCAGTAGCAGTAGCAGTAGC
ATC-
GCTAGCAGTAC
CATGACAATGA-
CATAGACTAGGTAGCAGTAGCC
GACGGTAGCAG-
TAGACGATGGATCAGATGAC
TTATCAGTGCGTACGT
ACGATATAG
Figure 2: BioChain Hot Start Taq polymerase (red) was compared with Competitor A (gray),
for amplification of a 838bp fragment from b-actin.
6. BioChain Reverse-
Transcriptases
PCR is great for DNA, but in the real world, little happens without RNA. Whether
you’re cloning a virus or measuring expression levels of the gene that defines your
career, we have options for you. Our “classic” recombinant M-MLV RT(Moloney Murine
Leukemia Virus Reverse Transcriptase) can be used for cDNA synthesis using templates
exceeding 5kb in length. This enzyme is superior to AMV-RT (Avian Myeloblastosis Virus
Reverse Transcriptase) for cDNA cloning and qPCR due to its lower RNAseH activity.
For long templates or those with a high degree of secondary structure, we offer Ultrascript
. This is an engineered M-MLV RT which remains stable at temperatures exceeding
55°C, and lacks measurable RNaseH activity. This enzyme is ideal for cDNA synthesis at
elevated temperatures – allowing the enzyme to read past RNA secondary structure.
This enzyme is also ideal for transcripts with a high GC content.
Figure 3: Comparison of BioChain
Ultrascript (U) and Competitor (C)
thermostable enzymes: The GC rich
5’-UTR region of LNA interacting protein
1 (LIP1) gene was reverse transcribed
at 60°C using an Iligo dT to prime the
reactions at the 3’ end of the mRNA.
cDNA were synthesized with olig (dT20).
Transcript was detected by PCR using
primers to the 5’-UTR of LIP1.
C U
Ultrascript is for those times when you abso-
lutely MUST get results with a challenging RNA.
7. Master Mixes
At BioChain, we know that you won’t
always have all the starting material
you want.
Premixed solutions of enzymes, reaction buffer, and dNTPs offer significant advan-
tages in convenience and reproducibility. They are especially useful for qPCR, where
precision is critical. BioChain offers master mixes for standard PCR and real-time quanti-
tative PCR (qPCR) with either a double-strand specific fluorescent dye included, or
optimized for use with fluorogenic probes. For our dye-based system, we selected Eva
Green as it is compatible with microcyclers capable of measuring SYBR-green fluores-
cence. Eva Green has the added advantage of being less likely to inhibit PCR reactions.
Figure 4: 3.6ng of Human genomic DNA was subjected to serial
10-fold dilutions down to 3.6pg, and used at template for amplification
of a 170bp GAPDH fragment. Lanes 1,3,5,7 and N correspond to our
benchmarking enzyme. Lanes 2,4,6,8 and N’ correspond to BioChain
Ultrascript. BioChain’s PCR Mix was able to successfully amplify the
fragment from ~1 copy of genomic DNA (3.6pg).
We also know you care about
sensitivity and reliability
Figure 5: BioChain’s PowerEva qPCR Supermix (red)
was compared to Competitor B (gray). Biochain’s
Supermix was able to detect samples earlier (lower Ct)
than the competitor.
M 1 2 3 4 5 6 7 8 N N’
8. BioChain dNTPS
The best enzymes in the world can’t help you if you don’t have good dNTPS, so
we offer a line of dNTPS to ensure your success. Our nucleotides are produced in an
ISO 9001:2008 certified laboratory with extensive QC checking to confirm purity and
stability. Our quality is such that we are rapidly becoming an OEM supplier to much
larger companies.
≥99.0% pure by HPLC
Extended shelf-life 36 months at -20
Free of PCR inhibitors
No nucleases detected
Custom, Bulk and OEM orders can be honored
Suitable for applications such as
Standard and long range PCR assays
cDNA synthesis
qPCR
Microarrays
DNA sequencing
Labeling
9. BioChain PCR
Products
PCR Enzymes and Mixes
L5051100 PCR Mix 2.5 ml
L7051001 Taq DNA Polymerase 1000 unit
L7051200 Taq DNA Polymerase 200 unit
L7052001 Hotstart Taq DNA Polymerase 1000 units
L7052250 Hotstart Taq DNA Polymerase 250 units
L7053001 LA Polymerase 1000 units
L7053250 LA Polymerase 250 units
qPCR Mixes
K5052200 Eva QPCR SuperMix Kit 200 rxn
K5052400 Eva QPCR SuperMix Kit 400 rxn
K5053200 Pro QPCR SuperMix Kit 200 rxn
K5053400 Pro QPCR SuperMix Kit 400 rxn
K5056200 Pro QPCR SuperMix Kit - ROX premixed 200 rxn
K5056400 Pro QPCR SuperMix Kit - ROX premixed 400 rxn
K5057200 Power Eva QPCR SuperMix Kit 200 rxn
K5057400 Power Eva QPCR SuperMix Kit 400 rxn
K5058200 Fast Pro QPCR SuperMix Kit - ROX premixed 200 rxn
K5058400 Fast Pro QPCR SuperMix Kit - ROX premixed 400 rxn
K5054200 QCell-Eva One-Step qRT-PCR SuperMix Kit 200 rxn
K5054400 QCell-Eva One-Step qRT-PCR SuperMix Kit 400 rxn
K5055200 QCell-Pro One-Step qRT-PCR SuperMix Kit 200 rxn
K5055400 QCell-Pro One-Step qRT-PCR SuperMix Kit 400 rxn
Reverse Transcriptases
L4121050 UltraScript MMLV Reverse Transcriptase 50,000 units
L4121100 UltraScript MMLV Reverse Transcriptase 100,000 units
Z5040002 M-MLV Reverse Transcriptase 16000 units
Z5040002-100K M-MLV Reverse Transcriptase 100,000 units
10. Ladders
Z6030001-1 100 bp DNA Ladder Plus, ready-to-use, 50 ug, 0.5 ug per lane 100 lanes
Z6030001-2 100 bp DNA Ladder Plus, loading dye included, 50 ug, 0.5 ug per lane 100 lanes
Z6030001-3 100 bp DNA Ladder Plus, ready-to-use, 250 ug, 0.5 ug per lane 500 lanes
Z6030001-4
100 bp DNA Ladder Plus, loading dye included, 250 ug, 0.5 ug per
lane
500 lanes
Z6030002 1 kb DNA Ladder 100 lanes
dNTPs
K6011100-100 dATP, dCTP, dGTP, dTTP 4x 100 ul (100 mM)
K6011100-1000 dATP, dCTP, dGTP, dTTP 4x1 ml (100 mM)
K6011100-400 dATP, dCTP, dGTP, dTTP 4x400 ul (100 mM)
K6011101-100 dATP 100 ul (100 mM)
K6011101-400 dATP 400 ul (100 mM)
K6011102-100 dGTP 100 ul (100 mM)
K6011102-400 dGTP 400 ul (100 mM)
K6011103-100 dCTP 100 ul (100 mM)
K6011103-400 dCTP 400 ul (100 mM)
K6011104-100 dTTP 100 ul (100 mM)
K6011104-400 dTTP 400 ul (100 mM)
K6011105-100 dNTP Mix 100 ul (10 mM each)
K6011105-1000 dNTP Mix 1000 ul (10 mM each)
K6011105-200 dNTP Mix 200 ul (10 mM each)
K6011105-400 dNTP Mix 400 ul (10 mMeach)
BioChain PCR
Products
11.
12. Sample Preparation for Diagnostics & Life Science
www.biochain.com
1-888-762-2568 (Main)
order@biochain.com (Order)
