SlideShare ist ein Scribd-Unternehmen logo
1 von 1
Downloaden Sie, um offline zu lesen
Perform a BLAST search on the following nucleotide sequence and answer the following 3
questions:
https://blast.ncbi.nlm.nih.gov/Blast.cgi
1. What is the name of the gene from which this nucleotide sequence is derived?
2. What human disease has been associated with this gene?
3. What is the function of this gene product?ACCCAGGAACTGAGGGCGCTGATGGACGAG

Weitere ähnliche Inhalte

Mehr von amayagency123

Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdfParte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
amayagency123
 
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdfPARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
amayagency123
 
Please answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdfPlease answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdf
amayagency123
 
Please answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdfPlease answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdf
amayagency123
 

Mehr von amayagency123 (20)

Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdfParte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
Parte A. Un ni�o de 3 a�os de edad es llevado al departamento de eme.pdf
 
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdfparte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
parte 1) El factor de estabilidad N s es generalmente mayor para s.pdf
 
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdfParte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
Parte 1 Bajo tipos de cambio flotantes o flexibles, una pol�tica mo.pdf
 
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdfParte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
Parte II Caracter�sticas de dise�o del lenguaje. 1. Los sem�foros.pdf
 
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdfParte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
Parte B �Cu�l de las siguientes afirmaciones es falsa �Cu�l de .pdf
 
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdfPARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
PARTICIPATION ACTIVITY 8.17.4 Arrange code to keep a passenger mani.pdf
 
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdfParte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
Parte 1 �C�mo se conectaron las campa�as presidenciales de Barack .pdf
 
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdfParte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
Parte II coloraci�n de los ojos Desconcertados, Alexia y Evan usaro.pdf
 
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdfPARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
PARTE A �Cu�l de las siguientes puede hacer el presidente para con.pdf
 
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdfPatr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
Patr�n de hechos 19-1 Nadine y Orin trabajan en Pumps & Pipes Inc. N.pdf
 
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdfPathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
PathophysiologyDemonstrate knowledge of the pathophysiology of hum.pdf
 
Please answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdfPlease answer both questions so I can like!! Excitatory postsynapt.pdf
Please answer both questions so I can like!! Excitatory postsynapt.pdf
 
Please answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdfPlease answer both questions so I can like! Why are action pot.pdf
Please answer both questions so I can like! Why are action pot.pdf
 
Please answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdfPlease answer both questions fully with steps Thanks! (14 points) As.pdf
Please answer both questions fully with steps Thanks! (14 points) As.pdf
 
Please answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdfPlease answer ASAP!!!!Research topic What are the challenges that.pdf
Please answer ASAP!!!!Research topic What are the challenges that.pdf
 
Please answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdfPlease answer and show the work ) 5. Let X and Y have joint pmf .pdf
Please answer and show the work ) 5. Let X and Y have joint pmf .pdf
 
Please answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdfPlease answer all questions According to the Model of the Whole .pdf
Please answer all questions According to the Model of the Whole .pdf
 
Piense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdfPiense en un programa de televisi�n popular que ve que se enfoca en .pdf
Piense en un programa de televisi�n popular que ve que se enfoca en .pdf
 
Please answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdfPlease answer all parts of the following question thoroughly.This .pdf
Please answer all parts of the following question thoroughly.This .pdf
 
Please answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdfPlease answer all 4 parts of this question if possible. Would be g.pdf
Please answer all 4 parts of this question if possible. Would be g.pdf
 

Kürzlich hochgeladen

1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
QucHHunhnh
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
ciinovamais
 

Kürzlich hochgeladen (20)

How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17How to Give a Domain for a Field in Odoo 17
How to Give a Domain for a Field in Odoo 17
 
Fostering Friendships - Enhancing Social Bonds in the Classroom
Fostering Friendships - Enhancing Social Bonds  in the ClassroomFostering Friendships - Enhancing Social Bonds  in the Classroom
Fostering Friendships - Enhancing Social Bonds in the Classroom
 
Spatium Project Simulation student brief
Spatium Project Simulation student briefSpatium Project Simulation student brief
Spatium Project Simulation student brief
 
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...Kodo Millet  PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
Kodo Millet PPT made by Ghanshyam bairwa college of Agriculture kumher bhara...
 
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17  How to Extend Models Using Mixin ClassesMixin Classes in Odoo 17  How to Extend Models Using Mixin Classes
Mixin Classes in Odoo 17 How to Extend Models Using Mixin Classes
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Unit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptxUnit-V; Pricing (Pharma Marketing Management).pptx
Unit-V; Pricing (Pharma Marketing Management).pptx
 
FSB Advising Checklist - Orientation 2024
FSB Advising Checklist - Orientation 2024FSB Advising Checklist - Orientation 2024
FSB Advising Checklist - Orientation 2024
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
 
How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17How to Create and Manage Wizard in Odoo 17
How to Create and Manage Wizard in Odoo 17
 
Sociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning ExhibitSociology 101 Demonstration of Learning Exhibit
Sociology 101 Demonstration of Learning Exhibit
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.
 
Graduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - EnglishGraduate Outcomes Presentation Slides - English
Graduate Outcomes Presentation Slides - English
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Dyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptxDyslexia AI Workshop for Slideshare.pptx
Dyslexia AI Workshop for Slideshare.pptx
 
ComPTIA Overview | Comptia Security+ Book SY0-701
ComPTIA Overview | Comptia Security+ Book SY0-701ComPTIA Overview | Comptia Security+ Book SY0-701
ComPTIA Overview | Comptia Security+ Book SY0-701
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
On National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan FellowsOn National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan Fellows
 

Perform a BLAST search on the following nucleotide sequence and answ.pdf

  • 1. Perform a BLAST search on the following nucleotide sequence and answer the following 3 questions: https://blast.ncbi.nlm.nih.gov/Blast.cgi 1. What is the name of the gene from which this nucleotide sequence is derived? 2. What human disease has been associated with this gene? 3. What is the function of this gene product?ACCCAGGAACTGAGGGCGCTGATGGACGAG