Figure 2.3. The researchers created versions of the reporter plasmid with two, three, or five point
mutations in the Mizm1, sequence. Sequences are shown at the bottom of the figure. They then
repeated the experiment described for Figure 2.1 with the original two plasmids and the plasmids
with the mutant Mizm1, sequences. Mizm1: GAATTATCGGTAATCCATCGAG Mizm1mut2:
GAATTATGGGTAAaCCATCGAG Mizm1mut3: GAATTATGAGTAAaCCATCGAG Mizm1mut5:
GAATTAGGAGTAAAGCATCGAG 3. Describe and interpret the data in Figure 2.3. 4. Based on
the data in Figure 2.3, what is a possible effect of the mutations in the Mizm1 DNA sequence?
Explain how your hypothesis is consistent with the data. (That is, explain how your hypothesis
about the effect of the mutations could explain the data.) The model in Figure 2.3 and your answer
to Question 2 will be useful for answering this question..
HMCS Max Bernays Pre-Deployment Brief (May 2024).pptx
Figure 23 The researchers created versions of the reporter.pdf
1. Figure 2.3. The researchers created versions of the reporter plasmid with two, three, or five point
mutations in the Mizm1, sequence. Sequences are shown at the bottom of the figure. They then
repeated the experiment described for Figure 2.1 with the original two plasmids and the plasmids
with the mutant Mizm1, sequences. Mizm1: GAATTATCGGTAATCCATCGAG Mizm1mut2:
GAATTATGGGTAAaCCATCGAG Mizm1mut3: GAATTATGAGTAAaCCATCGAG Mizm1mut5:
GAATTAGGAGTAAAGCATCGAG 3. Describe and interpret the data in Figure 2.3. 4. Based on
the data in Figure 2.3, what is a possible effect of the mutations in the Mizm1 DNA sequence?
Explain how your hypothesis is consistent with the data. (That is, explain how your hypothesis
about the effect of the mutations could explain the data.) The model in Figure 2.3 and your answer
to Question 2 will be useful for answering this question.
