SlideShare ist ein Scribd-Unternehmen logo
1 von 36
Downloaden Sie, um offline zu lesen
hSMC2, novel transcriptional
target of Wnt signaling pathway


              Lucía Suárez-López
        Drug delivery and targeting unit
            CIBBIM-Nanomedicine
              VHIR meeting 2012
Colon cancer progression model




                     Adapted from Davies, R. J., et al. 2005.
Colon cancer progression model




       Pathway members altered in 90% of CRC




                                       Adapted from Davies, R. J., et al. 2005.
Wnt pathway along the colon crypt


                WNT OFF




                WNT ON




  Wnt ligands
Wnt pathway along the colon crypt


                WNT OFF




                WNT ON      Aberrant crypt foci




                          Tumorogenesis initiation

  Wnt ligands
Wnt pathway
OFF
Wnt pathway
OFF        ON




                C-MYC,
                Cyclin D
SMC family: Structural Maintenance of Chromosomes
 ATPases highly conserved along evolution
                    Arqueobacteria  Mammals
 Responsible for Higher-order chromosome organization and dynamics


                SMC2 & SMC4 = Condensin Complex

               SMC2            SMC4
                                           SMC core members


                                           Non-SMC regulatory subunits
                                                 • Condensin I
                                                 • Condensin II




                                                                      Tatsuya Hirano, 2010
SMC family: Structural Maintenance of Chromosomes
 ATPases highly conserved along evolution
                    Arqueobacteria  Mammals
 Responsible for Higher-order chromosome organization and dynamics


                SMC2 & SMC4 = Condensin Complex

               SMC2            SMC4
                                           SMC core members


                                           Non-SMC regulatory subunits
                                                 • Condensin I
                                                 • Condensin II
  Introduces positive supercoilings into DNA


     DNA


                                                                      Tatsuya Hirano, 2010
Condensin complex is upregulated in CRC
   • QPCR on CRC samples



     SMC2              CAP-G     CAP-G2    CAP-H

        ***                ***       ***       ***
Condensin complex is upregulated in CRC
   • QPCR on CRC samples



     SMC2              CAP-G     CAP-G2    CAP-H

        ***                ***       ***       ***
SMC2 is upregulated in CRC

• Western Blot on CRC paired samples



         Case       31           35           36           38       85       86
                N        T   N        T   N        T   N        T   N    T   N    T
     SMC2                                                                             150 kDa

     ACTIN                                                                            37 kDa
SMC2 is upregulated in CRC

• Western Blot on CRC paired samples



         Case       31           35           36           38       85       86
                N        T   N        T   N        T   N        T   N    T   N    T
     SMC2                                                                             150 kDa

     ACTIN                                                                            37 kDa




             SMC2 is up-regulated in 20 out 29 tumor samples: 69%
SMC2 is upregulated in CRC
• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.
SMC2 is upregulated in CRC
• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.




                                           Colon adenocarcinoma
SMC2 is upregulated in CRC
• IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.

                                              Normal mucosa




                                                                     Wnt-target genes
                                                                       expression
                                                                         pattern


                                           Colon adenocarcinoma
SMC2 expression is linked to β-catenin
            Wnt signaling activation   Nuclear accumulation of β-catenin

                    β-catenin                    SMC2
Membrane
 β-catenin




 Nuclear
β-catenin
SMC2 expression is linked to β-catenin
            Wnt signaling activation          Nuclear accumulation of β-catenin

                    β-catenin                           SMC2
Membrane
 β-catenin




 Nuclear
β-catenin




                                                     Fisher exact test p=0,04, N=43


                    SMC2 is up-regulated in tumors where β-catenin is nuclear
Is SMC2 a target of Wnt/β-catenin pathway?
SMC2 is down-regulated upon Wnt inhibition


         Ls174T/dnTCF4                                                    Ls174T/pTER-bCAT
   Dominant negative form of TCF4                                       siRNA against β-catenin
Time        24h       48h           72h           96h          Time         24h       48h           72h           96h
Dox     -         +   -     +   -         +   -         +      Dox      -         +   -     +   -         +   -         +

TCF-4                                                       β-catenin
C-MYC                                                         C-MYC

SMC2                                                           SMC2

ACTIN                                                          ACTIN
SMC2 is down-regulated upon Wnt inhibition


         Ls174T/dnTCF4                                                    Ls174T/pTER-bCAT
   Dominant negative form of TCF4                                       siRNA against β-catenin
Time        24h       48h           72h           96h          Time         24h       48h           72h           96h
Dox     -         +   -     +   -         +   -         +      Dox      -         +   -     +   -         +   -         +

TCF-4                                                       β-catenin
C-MYC                                                         C-MYC

SMC2                                                           SMC2

ACTIN                                                          ACTIN
SMC2 is down-regulated upon Wnt inhibition


         Ls174T/dnTCF4                                                    Ls174T/pTER-bCAT
   Dominant negative form of TCF4                                       siRNA against β-catenin
Time        24h       48h           72h           96h          Time         24h       48h           72h           96h
Dox     -         +   -     +   -         +   -         +      Dox      -         +   -     +   -         +   -         +

TCF-4                                                       β-catenin
C-MYC                                                         C-MYC

SMC2                                                           SMC2

ACTIN                                                          ACTIN



        SMC2 is under β-catenin/TCF4 regulation, but is it direct or indirect?
TCF4 is bound to SMC2 promoter in vivo

  TATA   Sp1       Sp1   TATA TSS   Sp1



  -595   -561     -301   -12   +1   +219
TCF4 is bound to SMC2 promoter in vivo

      TATA   Sp1                             Sp1          TATA TSS       Sp1



      -595   -561                            -301          -12   +1      +219



                                TBE 2             TBE 3
Hs      1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA   74
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pt      1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA   74
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||
Mmt     1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA   71
          .|.|.||...||||||||||||||||||||||||||||||||||||    |||.|||||||||.|||.|||||
Rn      1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG-   69
          .|.|.||...||||.||||||||||||||||||||||||||||||||    ||.|||||||||.|||.|||||
Mms     1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG-   69
TCF4 is bound to SMC2 promoter in vivo

      TATA   Sp1                             Sp1          TATA TSS       Sp1



      -595   -561                            -301          -12   +1      +219



                                TBE 2             TBE 3
Hs      1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA   74
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Pt      1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA   74
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||
Mmt     1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA   71
          .|.|.||...||||||||||||||||||||||||||||||||||||    |||.|||||||||.|||.|||||
Rn      1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG-   69
          .|.|.||...||||.||||||||||||||||||||||||||||||||    ||.|||||||||.|||.|||||
Mms     1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG-   69
Identification of the TCF4 responding element in SMC2
                        promoter
   • Luciferase reporter assays

               WT     1      2    3   4   5   Luc+

             2Mut     1      2    3   4   5   Luc+
             3Mut     1      2    3   4   5   Luc+
       1/2/4/5 Mut    1      2    3   4   5   Luc+
Identification of the TCF4 responding element in SMC2
                        promoter
   • Luciferase reporter assays

                   WT     1      2   3      4   5      Luc+

                  2Mut    1      2   3      4   5      Luc+
                  3Mut    1      2   3      4   5      Luc+
           1/2/4/5 Mut    1      2   3      4   5      Luc+

    DLD-1 cells                                     HCT116 cells




   pgl3b     WT    2Mut   3MUT 1/2/4/5Mut           pgl3b   WT     2Mut   3MUT 1/2/4/5Mut
Identification of the TCF4 responding element in SMC2
                        promoter
   • Luciferase reporter assays

                  WT   1      2    3       4   5      Luc+

              2Mut     1      2    3       4   5      Luc+
              3Mut     1      2    3       4   5      Luc+
        1/2/4/5 Mut    1      2    3       4   5      Luc+

    DLD-1 cells                                    HCT116 cells




      pgl3b       WT   3MUT   1/2/4/5Mut            pgl3b    WT   3MUT   1/2/4/5Mut
Identification of the TCF4 responding element in SMC2
                             promoter
              • Luciferase reporter assays

        WT      1       2   3     4     5        Luc+

      2Mut      1       2   3     4     5        Luc+        TBE3 is responsible for
                                                                   β-catenin/TCF4
      3Mut      1       2   3     4     5        Luc+    transactivation of SMC2 promoter
1/2/4/5 Mut     1       2   3     4     5        Luc+

              DLD-1 cells                                HCT116 cells




                pgl3b       WT   3MUT       1/2/4/5Mut    pgl3b    WT     3MUT   1/2/4/5Mut
SMC2 role in tumorogenesis

• siRNA mediated Knockdown of SMC2




            Time (h):        24        48     72
              siRNA:    sc   SMC2 sc   SMC2 sc SMC2

                                                      SMC2
                                                      SMC4
                                                      NCAPH
                                                      GAPDH
SMC2 role in tumorogenesis

• siRNA mediated Knockdown of SMC2




            Time (h):        24        48     72
              siRNA:    sc   SMC2 sc   SMC2 sc SMC2

                                                      SMC2
                                                      SMC4
                                                      NCAPH
                                                      GAPDH
SMC2 role in tumorogenesis

        • Tumor Xenografts

                                                              siRNA     siRNA
           1st                  2nd                         scrambled    SMC2
       transfection         transfection

DLD1 cells                                 Mice injection
                      48h           24h
SMC2 role in tumorogenesis

        • Tumor Xenografts

                                                              siRNA     siRNA
           1st                  2nd                         scrambled    SMC2
       transfection         transfection

DLD1 cells                                 Mice injection
                      48h           24h
SMC2 role in tumorogenesis

        • Tumor Xenografts

                                                              siRNA       siRNA
           1st                  2nd                         scrambled      SMC2
       transfection         transfection

DLD1 cells                                 Mice injection
                      48h           24h




                                                                        SMC2 is a new
                                                                          potential
                                                                         therapeutic
                                                                            target
Summary


1. Condensin complex is up-regulated in colon cancer

2. SMC2 is under direct regulation of β-catenin/TCF4 complex

3. SMC2 is proposed as new potential therapeutic target for CRC
   treatment
Acknowledgments
DRUG DELIVERY AND TARGETING GROUP
        Verónica Dávalos
        Julio Castaño
        Anthea Messent
        Simó Schwartz Navarro


                                    FUNCTIONAL VALIDATION AND PRE-
                                    CLINICAL RESEARCH
                                             Yolanda Fernández
                                             Ibane Abásolo

Weitere ähnliche Inhalte

Mehr von Vall d'Hebron Institute of Research (VHIR)

"Cost of illness studies in rare diseases: cystic fibrosis as an example" by ...
"Cost of illness studies in rare diseases: cystic fibrosis as an example" by ..."Cost of illness studies in rare diseases: cystic fibrosis as an example" by ...
"Cost of illness studies in rare diseases: cystic fibrosis as an example" by ...
Vall d'Hebron Institute of Research (VHIR)
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Vall d'Hebron Institute of Research (VHIR)
 
Registros de enfermedades raras: Sistemas de información básicos para el fome...
Registros de enfermedades raras: Sistemas de información básicos para el fome...Registros de enfermedades raras: Sistemas de información básicos para el fome...
Registros de enfermedades raras: Sistemas de información básicos para el fome...
Vall d'Hebron Institute of Research (VHIR)
 
Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)
Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)
Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)
Vall d'Hebron Institute of Research (VHIR)
 

Mehr von Vall d'Hebron Institute of Research (VHIR) (20)

Data analysis pipelines for NGS applications
Data analysis pipelines for NGS applicationsData analysis pipelines for NGS applications
Data analysis pipelines for NGS applications
 
NGS and the molecular basis of disease: a practical view
NGS and the molecular basis of disease: a practical viewNGS and the molecular basis of disease: a practical view
NGS and the molecular basis of disease: a practical view
 
Prof. Adolfo García Sastre: Influenza epidemics and pandemics
Prof. Adolfo García Sastre: Influenza epidemics and pandemicsProf. Adolfo García Sastre: Influenza epidemics and pandemics
Prof. Adolfo García Sastre: Influenza epidemics and pandemics
 
"Rare diseases as platform to develop novel therapeutic strategies: the examp...
"Rare diseases as platform to develop novel therapeutic strategies: the examp..."Rare diseases as platform to develop novel therapeutic strategies: the examp...
"Rare diseases as platform to develop novel therapeutic strategies: the examp...
 
Richard horton, barcelona 2014
Richard horton, barcelona 2014Richard horton, barcelona 2014
Richard horton, barcelona 2014
 
"Cost of illness studies in rare diseases: cystic fibrosis as an example" by ...
"Cost of illness studies in rare diseases: cystic fibrosis as an example" by ..."Cost of illness studies in rare diseases: cystic fibrosis as an example" by ...
"Cost of illness studies in rare diseases: cystic fibrosis as an example" by ...
 
Dr. Esteban Domingo: Respuesta del virus de la hepatitis C a inhibidores. Inf...
Dr. Esteban Domingo: Respuesta del virus de la hepatitis C a inhibidores. Inf...Dr. Esteban Domingo: Respuesta del virus de la hepatitis C a inhibidores. Inf...
Dr. Esteban Domingo: Respuesta del virus de la hepatitis C a inhibidores. Inf...
 
"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin
"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin
"Biomarkers in sepsis and septic shock" by Prof. Jérôme Pugin
 
"Enfermedades Minoritarias y Medicamentos huérfanos en la UE" by Dr. Josep To...
"Enfermedades Minoritarias y Medicamentos huérfanos en la UE" by Dr. Josep To..."Enfermedades Minoritarias y Medicamentos huérfanos en la UE" by Dr. Josep To...
"Enfermedades Minoritarias y Medicamentos huérfanos en la UE" by Dr. Josep To...
 
Sr. Juan Carrión: 'Unidos nuestros derechos avanzan: análisis de las 14 propu...
Sr. Juan Carrión: 'Unidos nuestros derechos avanzan: análisis de las 14 propu...Sr. Juan Carrión: 'Unidos nuestros derechos avanzan: análisis de las 14 propu...
Sr. Juan Carrión: 'Unidos nuestros derechos avanzan: análisis de las 14 propu...
 
Dr. Tobias Welte: Lessons learned from the CAPNETZ study
Dr. Tobias Welte: Lessons learned from the CAPNETZ studyDr. Tobias Welte: Lessons learned from the CAPNETZ study
Dr. Tobias Welte: Lessons learned from the CAPNETZ study
 
Dr. Jordi Llinares: Research, regulations and rare deseases. Is there a meeti...
Dr. Jordi Llinares: Research, regulations and rare deseases. Is there a meeti...Dr. Jordi Llinares: Research, regulations and rare deseases. Is there a meeti...
Dr. Jordi Llinares: Research, regulations and rare deseases. Is there a meeti...
 
IRDiRC: State of the Art. By Paul Lasko, PhD
IRDiRC: State of the Art. By Paul Lasko, PhDIRDiRC: State of the Art. By Paul Lasko, PhD
IRDiRC: State of the Art. By Paul Lasko, PhD
 
Acute kidney injury in critically ill patients in the new millenium: definiti...
Acute kidney injury in critically ill patients in the new millenium: definiti...Acute kidney injury in critically ill patients in the new millenium: definiti...
Acute kidney injury in critically ill patients in the new millenium: definiti...
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
 
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ..."The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. ...
 
Registros de enfermedades raras: Sistemas de información básicos para el fome...
Registros de enfermedades raras: Sistemas de información básicos para el fome...Registros de enfermedades raras: Sistemas de información básicos para el fome...
Registros de enfermedades raras: Sistemas de información básicos para el fome...
 
Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)
Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)
Gut microbiota for health: lessons of a metagenomic scan (by Joel Doré)
 
TLR ligand functionalized nanocarriers to enhance immunogenicity of vaccines
TLR ligand functionalized nanocarriers to enhance immunogenicity of vaccinesTLR ligand functionalized nanocarriers to enhance immunogenicity of vaccines
TLR ligand functionalized nanocarriers to enhance immunogenicity of vaccines
 
Horizon 2020: Nuevo programa y nuevas reglas
Horizon 2020: Nuevo programa y nuevas reglasHorizon 2020: Nuevo programa y nuevas reglas
Horizon 2020: Nuevo programa y nuevas reglas
 

hSMC2, novel transcriptional target of Wnt signaling pathway

  • 1. hSMC2, novel transcriptional target of Wnt signaling pathway Lucía Suárez-López Drug delivery and targeting unit CIBBIM-Nanomedicine VHIR meeting 2012
  • 2. Colon cancer progression model Adapted from Davies, R. J., et al. 2005.
  • 3. Colon cancer progression model Pathway members altered in 90% of CRC Adapted from Davies, R. J., et al. 2005.
  • 4. Wnt pathway along the colon crypt WNT OFF WNT ON Wnt ligands
  • 5. Wnt pathway along the colon crypt WNT OFF WNT ON Aberrant crypt foci Tumorogenesis initiation Wnt ligands
  • 7. Wnt pathway OFF ON C-MYC, Cyclin D
  • 8. SMC family: Structural Maintenance of Chromosomes  ATPases highly conserved along evolution Arqueobacteria  Mammals  Responsible for Higher-order chromosome organization and dynamics SMC2 & SMC4 = Condensin Complex SMC2 SMC4 SMC core members Non-SMC regulatory subunits • Condensin I • Condensin II Tatsuya Hirano, 2010
  • 9. SMC family: Structural Maintenance of Chromosomes  ATPases highly conserved along evolution Arqueobacteria  Mammals  Responsible for Higher-order chromosome organization and dynamics SMC2 & SMC4 = Condensin Complex SMC2 SMC4 SMC core members Non-SMC regulatory subunits • Condensin I • Condensin II Introduces positive supercoilings into DNA DNA Tatsuya Hirano, 2010
  • 10. Condensin complex is upregulated in CRC • QPCR on CRC samples SMC2 CAP-G CAP-G2 CAP-H *** *** *** ***
  • 11. Condensin complex is upregulated in CRC • QPCR on CRC samples SMC2 CAP-G CAP-G2 CAP-H *** *** *** ***
  • 12. SMC2 is upregulated in CRC • Western Blot on CRC paired samples Case 31 35 36 38 85 86 N T N T N T N T N T N T SMC2 150 kDa ACTIN 37 kDa
  • 13. SMC2 is upregulated in CRC • Western Blot on CRC paired samples Case 31 35 36 38 85 86 N T N T N T N T N T N T SMC2 150 kDa ACTIN 37 kDa SMC2 is up-regulated in 20 out 29 tumor samples: 69%
  • 14. SMC2 is upregulated in CRC • IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts.
  • 15. SMC2 is upregulated in CRC • IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts. Colon adenocarcinoma
  • 16. SMC2 is upregulated in CRC • IHC on CRC paraffin embebed tissues: SMC2 up-regulated in tumoral counterparts. Normal mucosa Wnt-target genes expression pattern Colon adenocarcinoma
  • 17. SMC2 expression is linked to β-catenin Wnt signaling activation Nuclear accumulation of β-catenin β-catenin SMC2 Membrane β-catenin Nuclear β-catenin
  • 18. SMC2 expression is linked to β-catenin Wnt signaling activation Nuclear accumulation of β-catenin β-catenin SMC2 Membrane β-catenin Nuclear β-catenin Fisher exact test p=0,04, N=43 SMC2 is up-regulated in tumors where β-catenin is nuclear
  • 19. Is SMC2 a target of Wnt/β-catenin pathway?
  • 20. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-catenin Time 24h 48h 72h 96h Time 24h 48h 72h 96h Dox - + - + - + - + Dox - + - + - + - + TCF-4 β-catenin C-MYC C-MYC SMC2 SMC2 ACTIN ACTIN
  • 21. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-catenin Time 24h 48h 72h 96h Time 24h 48h 72h 96h Dox - + - + - + - + Dox - + - + - + - + TCF-4 β-catenin C-MYC C-MYC SMC2 SMC2 ACTIN ACTIN
  • 22. SMC2 is down-regulated upon Wnt inhibition Ls174T/dnTCF4 Ls174T/pTER-bCAT Dominant negative form of TCF4 siRNA against β-catenin Time 24h 48h 72h 96h Time 24h 48h 72h 96h Dox - + - + - + - + Dox - + - + - + - + TCF-4 β-catenin C-MYC C-MYC SMC2 SMC2 ACTIN ACTIN SMC2 is under β-catenin/TCF4 regulation, but is it direct or indirect?
  • 23. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219
  • 24. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219 TBE 2 TBE 3 Hs 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Pt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Mmt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA 71 .|.|.||...|||||||||||||||||||||||||||||||||||| |||.|||||||||.|||.||||| Rn 1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG- 69 .|.|.||...||||.|||||||||||||||||||||||||||||||| ||.|||||||||.|||.||||| Mms 1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG- 69
  • 25. TCF4 is bound to SMC2 promoter in vivo TATA Sp1 Sp1 TATA TSS Sp1 -595 -561 -301 -12 +1 +219 TBE 2 TBE 3 Hs 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Pt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGGTGTTGA 74 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Mmt 1 AATAAGCAATGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGGAATAAATAGTTCCGGCGCGGG---TGA 71 .|.|.||...|||||||||||||||||||||||||||||||||||| |||.|||||||||.|||.||||| Rn 1 CAGACGCGTCGGAGGTGGGGTCCTTTGCTCGCGCCGAAATTCAAAG----AAACAGTTCCGGCACGGTTGTTG- 69 .|.|.||...||||.|||||||||||||||||||||||||||||||| ||.|||||||||.|||.||||| Mms 1 CAGACGCCTCGGAGTTGGGGTCCTTTGCTCGCGCCGAAATTCAAAGG----AACAGTTCCGGCACGGTTGTTG- 69
  • 26. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+
  • 27. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 2Mut 3MUT 1/2/4/5Mut pgl3b WT 2Mut 3MUT 1/2/4/5Mut
  • 28. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ 3Mut 1 2 3 4 5 Luc+ 1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 3MUT 1/2/4/5Mut pgl3b WT 3MUT 1/2/4/5Mut
  • 29. Identification of the TCF4 responding element in SMC2 promoter • Luciferase reporter assays WT 1 2 3 4 5 Luc+ 2Mut 1 2 3 4 5 Luc+ TBE3 is responsible for β-catenin/TCF4 3Mut 1 2 3 4 5 Luc+ transactivation of SMC2 promoter 1/2/4/5 Mut 1 2 3 4 5 Luc+ DLD-1 cells HCT116 cells pgl3b WT 3MUT 1/2/4/5Mut pgl3b WT 3MUT 1/2/4/5Mut
  • 30. SMC2 role in tumorogenesis • siRNA mediated Knockdown of SMC2 Time (h): 24 48 72 siRNA: sc SMC2 sc SMC2 sc SMC2 SMC2 SMC4 NCAPH GAPDH
  • 31. SMC2 role in tumorogenesis • siRNA mediated Knockdown of SMC2 Time (h): 24 48 72 siRNA: sc SMC2 sc SMC2 sc SMC2 SMC2 SMC4 NCAPH GAPDH
  • 32. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfection DLD1 cells Mice injection 48h 24h
  • 33. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfection DLD1 cells Mice injection 48h 24h
  • 34. SMC2 role in tumorogenesis • Tumor Xenografts siRNA siRNA 1st 2nd scrambled SMC2 transfection transfection DLD1 cells Mice injection 48h 24h SMC2 is a new potential therapeutic target
  • 35. Summary 1. Condensin complex is up-regulated in colon cancer 2. SMC2 is under direct regulation of β-catenin/TCF4 complex 3. SMC2 is proposed as new potential therapeutic target for CRC treatment
  • 36. Acknowledgments DRUG DELIVERY AND TARGETING GROUP Verónica Dávalos Julio Castaño Anthea Messent Simó Schwartz Navarro FUNCTIONAL VALIDATION AND PRE- CLINICAL RESEARCH Yolanda Fernández Ibane Abásolo