SlideShare ist ein Scribd-Unternehmen logo

3CGACACTACTTTGAAGTCTGCAGGTAGGTCCGAATCCCCTTT5 A What wi.pdf

•
•
V
VANDANASINHACONSULT

This DNA sequence would produce an mRNA with UACGAUGAUAAAUUCAUAGACUCCACUAGGCUAGGGUUAG as its sequence, and a polypeptide with the amino acid sequence HisAspAspLysPheMetAspSerThrArgLeuGly. A mutation changing the underlined G to C would result in an amino acid change from glycine to alanine in the polypeptide, likely altering the 3D structure and function of the enzyme.

Bildung
1 von 1
Downloaden Sie, um offline zu lesen
3-CGACACTACTTTGAAGTCTGCAGGTAGGTCCGAATCCCCTTT-5 A. What will be the mRNA sequence (3 marks) and amino acid sequence of the resulting polypeptide (3 marks)? B. If this DNA sequence codes for an enzyme, suggest what would happen if a mutation appears resulting that the underlined nucleotide (G) is changed to C (6 marks).

Empfohlen

4 Alex Blake Chris Drew and Jordan work for a publishing.pdf
4 Alex Blake Chris Drew and Jordan work for a publishing.pdf4 Alex Blake Chris Drew and Jordan work for a publishing.pdf
4 Alex Blake Chris Drew and Jordan work for a publishing.pdfVANDANASINHACONSULT
 
4 About 20 years ago money was invested to create a forest.pdf
4 About 20 years ago money was invested to create a forest.pdf4 About 20 years ago money was invested to create a forest.pdf
4 About 20 years ago money was invested to create a forest.pdfVANDANASINHACONSULT
 
4 According to Cynthia Garcia Coll and her colleagues chil.pdf
4 According to Cynthia Garcia Coll and her colleagues chil.pdf4 According to Cynthia Garcia Coll and her colleagues chil.pdf
4 According to Cynthia Garcia Coll and her colleagues chil.pdfVANDANASINHACONSULT
 
4 A local restaurant is concerned about their ability to pr.pdf
4 A local restaurant is concerned about their ability to pr.pdf4 A local restaurant is concerned about their ability to pr.pdf
4 A local restaurant is concerned about their ability to pr.pdfVANDANASINHACONSULT
 
4 A 5yearold girl is brought to the physicians office be.pdf
4 A 5yearold girl is brought to the physicians office be.pdf4 A 5yearold girl is brought to the physicians office be.pdf
4 A 5yearold girl is brought to the physicians office be.pdfVANDANASINHACONSULT
 
3Consider the dorsal and ventral halves D and Ve of the X.pdf
3Consider the dorsal and ventral halves D and Ve of the X.pdf3Consider the dorsal and ventral halves D and Ve of the X.pdf
3Consider the dorsal and ventral halves D and Ve of the X.pdfVANDANASINHACONSULT
 
38 A 26yearold man visits his family physician complainin.pdf
38 A 26yearold man visits his family physician complainin.pdf38 A 26yearold man visits his family physician complainin.pdf
38 A 26yearold man visits his family physician complainin.pdfVANDANASINHACONSULT
 
4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdf
4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdf4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdf
4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdfVANDANASINHACONSULT
 

Empfohlen

4 Alex Blake Chris Drew and Jordan work for a publishing.pdf
4 Alex Blake Chris Drew and Jordan work for a publishing.pdf4 Alex Blake Chris Drew and Jordan work for a publishing.pdf
4 Alex Blake Chris Drew and Jordan work for a publishing.pdfVANDANASINHACONSULT
 
4 About 20 years ago money was invested to create a forest.pdf
4 About 20 years ago money was invested to create a forest.pdf4 About 20 years ago money was invested to create a forest.pdf
4 About 20 years ago money was invested to create a forest.pdfVANDANASINHACONSULT
 
4 According to Cynthia Garcia Coll and her colleagues chil.pdf
4 According to Cynthia Garcia Coll and her colleagues chil.pdf4 According to Cynthia Garcia Coll and her colleagues chil.pdf
4 According to Cynthia Garcia Coll and her colleagues chil.pdfVANDANASINHACONSULT
 
4 A local restaurant is concerned about their ability to pr.pdf
4 A local restaurant is concerned about their ability to pr.pdf4 A local restaurant is concerned about their ability to pr.pdf
4 A local restaurant is concerned about their ability to pr.pdfVANDANASINHACONSULT
 
4 A 5yearold girl is brought to the physicians office be.pdf
4 A 5yearold girl is brought to the physicians office be.pdf4 A 5yearold girl is brought to the physicians office be.pdf
4 A 5yearold girl is brought to the physicians office be.pdfVANDANASINHACONSULT
 
3Consider the dorsal and ventral halves D and Ve of the X.pdf
3Consider the dorsal and ventral halves D and Ve of the X.pdf3Consider the dorsal and ventral halves D and Ve of the X.pdf
3Consider the dorsal and ventral halves D and Ve of the X.pdfVANDANASINHACONSULT
 
38 A 26yearold man visits his family physician complainin.pdf
38 A 26yearold man visits his family physician complainin.pdf38 A 26yearold man visits his family physician complainin.pdf
38 A 26yearold man visits his family physician complainin.pdfVANDANASINHACONSULT
 
4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdf
4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdf4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdf
4 4 pts Bonnie and Clyde Remember Bonnie and Clydes pris.pdfVANDANASINHACONSULT
 
4 4 pts In what major sedimentary depositional environmen.pdf
4 4 pts In what major sedimentary depositional environmen.pdf4 4 pts In what major sedimentary depositional environmen.pdf
4 4 pts In what major sedimentary depositional environmen.pdfVANDANASINHACONSULT
 
4 10 pts You have mutated normal epidermal fibroblast cel.pdf
4 10 pts You have mutated normal epidermal fibroblast cel.pdf4 10 pts You have mutated normal epidermal fibroblast cel.pdf
4 10 pts You have mutated normal epidermal fibroblast cel.pdfVANDANASINHACONSULT
 
4 12 points An FA illustrating a simplified version of le.pdf
4 12 points An FA illustrating a simplified version of le.pdf4 12 points An FA illustrating a simplified version of le.pdf
4 12 points An FA illustrating a simplified version of le.pdfVANDANASINHACONSULT
 
4 20 pt Simple linear regression is considered in a data .pdf
4 20 pt Simple linear regression is considered in a data .pdf4 20 pt Simple linear regression is considered in a data .pdf
4 20 pt Simple linear regression is considered in a data .pdfVANDANASINHACONSULT
 
4 2 pts Consider the ER schema for the MOVIES database as.pdf
4 2 pts Consider the ER schema for the MOVIES database as.pdf4 2 pts Consider the ER schema for the MOVIES database as.pdf
4 2 pts Consider the ER schema for the MOVIES database as.pdfVANDANASINHACONSULT
 
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdfVANDANASINHACONSULT
 
3Use Tukeys multiple comparison method to decide among whi.pdf
3Use Tukeys multiple comparison method to decide among whi.pdf3Use Tukeys multiple comparison method to decide among whi.pdf
3Use Tukeys multiple comparison method to decide among whi.pdfVANDANASINHACONSULT
 
329 In the last decade the average age of a mother at chil.pdf
329 In the last decade the average age of a mother at chil.pdf329 In the last decade the average age of a mother at chil.pdf
329 In the last decade the average age of a mother at chil.pdfVANDANASINHACONSULT
 
36 In 1812 an earthquake centered on the San Andreas fault.pdf
36 In 1812 an earthquake centered on the San Andreas fault.pdf36 In 1812 an earthquake centered on the San Andreas fault.pdf
36 In 1812 an earthquake centered on the San Andreas fault.pdfVANDANASINHACONSULT
 
36 Most of the catbon dioxide earried inthe blood is transp.pdf
36 Most of the catbon dioxide earried inthe blood is transp.pdf36 Most of the catbon dioxide earried inthe blood is transp.pdf
36 Most of the catbon dioxide earried inthe blood is transp.pdfVANDANASINHACONSULT
 
36 The kidneys maintain blood fluid volume through the neph.pdf
36 The kidneys maintain blood fluid volume through the neph.pdf36 The kidneys maintain blood fluid volume through the neph.pdf
36 The kidneys maintain blood fluid volume through the neph.pdfVANDANASINHACONSULT
 
319 Let the random variable X have the pdf fx 21x0x.pdf
319 Let the random variable X have the pdf fx 21x0x.pdf319 Let the random variable X have the pdf fx 21x0x.pdf
319 Let the random variable X have the pdf fx 21x0x.pdfVANDANASINHACONSULT
 
35 A 67yearold woman is admitted to the hospital with sev.pdf
35 A 67yearold woman is admitted to the hospital with sev.pdf35 A 67yearold woman is admitted to the hospital with sev.pdf
35 A 67yearold woman is admitted to the hospital with sev.pdfVANDANASINHACONSULT
 
34 Why are teloyears DNA test not an accurate way to predi.pdf
34 Why are teloyears DNA test not an accurate way to predi.pdf34 Why are teloyears DNA test not an accurate way to predi.pdf
34 Why are teloyears DNA test not an accurate way to predi.pdfVANDANASINHACONSULT
 
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdfVANDANASINHACONSULT
 
34 A 42yearold woman is admitted to the hospital due to b.pdf
34 A 42yearold woman is admitted to the hospital due to b.pdf34 A 42yearold woman is admitted to the hospital due to b.pdf
34 A 42yearold woman is admitted to the hospital due to b.pdfVANDANASINHACONSULT
 
35 In Human Resources and Job Design Labor Standards a wo.pdf
35 In Human Resources and Job Design Labor Standards a wo.pdf35 In Human Resources and Job Design Labor Standards a wo.pdf
35 In Human Resources and Job Design Labor Standards a wo.pdfVANDANASINHACONSULT
 
334 LAB Output range with increment of 5 Write a program w.pdf
334 LAB Output range with increment of 5 Write a program w.pdf334 LAB Output range with increment of 5 Write a program w.pdf
334 LAB Output range with increment of 5 Write a program w.pdfVANDANASINHACONSULT
 
31 You are given a list L and another list P containing.pdf
31 You are given a list L and another list P containing.pdf31 You are given a list L and another list P containing.pdf
31 You are given a list L and another list P containing.pdfVANDANASINHACONSULT
 
35 of all college students major in STEM Science Technolo.pdf
35 of all college students major in STEM Science Technolo.pdf35 of all college students major in STEM Science Technolo.pdf
35 of all college students major in STEM Science Technolo.pdfVANDANASINHACONSULT
 
Magic bus Group work1and 2 (Team 3).pptx
Magic bus Group work1and 2 (Team 3).pptxMagic bus Group work1and 2 (Team 3).pptx
Magic bus Group work1and 2 (Team 3).pptxdhanalakshmis0310
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Jisc
 

Weitere ähnliche Inhalte

Mehr von VANDANASINHACONSULT

4 4 pts In what major sedimentary depositional environmen.pdf
4 4 pts In what major sedimentary depositional environmen.pdf4 4 pts In what major sedimentary depositional environmen.pdf
4 4 pts In what major sedimentary depositional environmen.pdfVANDANASINHACONSULT
 
4 10 pts You have mutated normal epidermal fibroblast cel.pdf
4 10 pts You have mutated normal epidermal fibroblast cel.pdf4 10 pts You have mutated normal epidermal fibroblast cel.pdf
4 10 pts You have mutated normal epidermal fibroblast cel.pdfVANDANASINHACONSULT
 
4 12 points An FA illustrating a simplified version of le.pdf
4 12 points An FA illustrating a simplified version of le.pdf4 12 points An FA illustrating a simplified version of le.pdf
4 12 points An FA illustrating a simplified version of le.pdfVANDANASINHACONSULT
 
4 20 pt Simple linear regression is considered in a data .pdf
4 20 pt Simple linear regression is considered in a data .pdf4 20 pt Simple linear regression is considered in a data .pdf
4 20 pt Simple linear regression is considered in a data .pdfVANDANASINHACONSULT
 
4 2 pts Consider the ER schema for the MOVIES database as.pdf
4 2 pts Consider the ER schema for the MOVIES database as.pdf4 2 pts Consider the ER schema for the MOVIES database as.pdf
4 2 pts Consider the ER schema for the MOVIES database as.pdfVANDANASINHACONSULT
 
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdfVANDANASINHACONSULT
 
3Use Tukeys multiple comparison method to decide among whi.pdf
3Use Tukeys multiple comparison method to decide among whi.pdf3Use Tukeys multiple comparison method to decide among whi.pdf
3Use Tukeys multiple comparison method to decide among whi.pdfVANDANASINHACONSULT
 
329 In the last decade the average age of a mother at chil.pdf
329 In the last decade the average age of a mother at chil.pdf329 In the last decade the average age of a mother at chil.pdf
329 In the last decade the average age of a mother at chil.pdfVANDANASINHACONSULT
 
36 In 1812 an earthquake centered on the San Andreas fault.pdf
36 In 1812 an earthquake centered on the San Andreas fault.pdf36 In 1812 an earthquake centered on the San Andreas fault.pdf
36 In 1812 an earthquake centered on the San Andreas fault.pdfVANDANASINHACONSULT
 
36 Most of the catbon dioxide earried inthe blood is transp.pdf
36 Most of the catbon dioxide earried inthe blood is transp.pdf36 Most of the catbon dioxide earried inthe blood is transp.pdf
36 Most of the catbon dioxide earried inthe blood is transp.pdfVANDANASINHACONSULT
 
36 The kidneys maintain blood fluid volume through the neph.pdf
36 The kidneys maintain blood fluid volume through the neph.pdf36 The kidneys maintain blood fluid volume through the neph.pdf
36 The kidneys maintain blood fluid volume through the neph.pdfVANDANASINHACONSULT
 
319 Let the random variable X have the pdf fx 21x0x.pdf
319 Let the random variable X have the pdf fx 21x0x.pdf319 Let the random variable X have the pdf fx 21x0x.pdf
319 Let the random variable X have the pdf fx 21x0x.pdfVANDANASINHACONSULT
 
35 A 67yearold woman is admitted to the hospital with sev.pdf
35 A 67yearold woman is admitted to the hospital with sev.pdf35 A 67yearold woman is admitted to the hospital with sev.pdf
35 A 67yearold woman is admitted to the hospital with sev.pdfVANDANASINHACONSULT
 
34 Why are teloyears DNA test not an accurate way to predi.pdf
34 Why are teloyears DNA test not an accurate way to predi.pdf34 Why are teloyears DNA test not an accurate way to predi.pdf
34 Why are teloyears DNA test not an accurate way to predi.pdfVANDANASINHACONSULT
 
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdfVANDANASINHACONSULT
 
34 A 42yearold woman is admitted to the hospital due to b.pdf
34 A 42yearold woman is admitted to the hospital due to b.pdf34 A 42yearold woman is admitted to the hospital due to b.pdf
34 A 42yearold woman is admitted to the hospital due to b.pdfVANDANASINHACONSULT
 
35 In Human Resources and Job Design Labor Standards a wo.pdf
35 In Human Resources and Job Design Labor Standards a wo.pdf35 In Human Resources and Job Design Labor Standards a wo.pdf
35 In Human Resources and Job Design Labor Standards a wo.pdfVANDANASINHACONSULT
 
334 LAB Output range with increment of 5 Write a program w.pdf
334 LAB Output range with increment of 5 Write a program w.pdf334 LAB Output range with increment of 5 Write a program w.pdf
334 LAB Output range with increment of 5 Write a program w.pdfVANDANASINHACONSULT
 
31 You are given a list L and another list P containing.pdf
31 You are given a list L and another list P containing.pdf31 You are given a list L and another list P containing.pdf
31 You are given a list L and another list P containing.pdfVANDANASINHACONSULT
 
35 of all college students major in STEM Science Technolo.pdf
35 of all college students major in STEM Science Technolo.pdf35 of all college students major in STEM Science Technolo.pdf
35 of all college students major in STEM Science Technolo.pdfVANDANASINHACONSULT
 

Mehr von VANDANASINHACONSULT (20)

4 4 pts In what major sedimentary depositional environmen.pdf
4 4 pts In what major sedimentary depositional environmen.pdf4 4 pts In what major sedimentary depositional environmen.pdf
4 4 pts In what major sedimentary depositional environmen.pdf
 
4 10 pts You have mutated normal epidermal fibroblast cel.pdf
4 10 pts You have mutated normal epidermal fibroblast cel.pdf4 10 pts You have mutated normal epidermal fibroblast cel.pdf
4 10 pts You have mutated normal epidermal fibroblast cel.pdf
 
4 12 points An FA illustrating a simplified version of le.pdf
4 12 points An FA illustrating a simplified version of le.pdf4 12 points An FA illustrating a simplified version of le.pdf
4 12 points An FA illustrating a simplified version of le.pdf
 
4 20 pt Simple linear regression is considered in a data .pdf
4 20 pt Simple linear regression is considered in a data .pdf4 20 pt Simple linear regression is considered in a data .pdf
4 20 pt Simple linear regression is considered in a data .pdf
 
4 2 pts Consider the ER schema for the MOVIES database as.pdf
4 2 pts Consider the ER schema for the MOVIES database as.pdf4 2 pts Consider the ER schema for the MOVIES database as.pdf
4 2 pts Consider the ER schema for the MOVIES database as.pdf
 
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf
4 10 Percent Ryan Enterprises forecasts the free cash flo.pdf
 
3Use Tukeys multiple comparison method to decide among whi.pdf
3Use Tukeys multiple comparison method to decide among whi.pdf3Use Tukeys multiple comparison method to decide among whi.pdf
3Use Tukeys multiple comparison method to decide among whi.pdf
 
329 In the last decade the average age of a mother at chil.pdf
329 In the last decade the average age of a mother at chil.pdf329 In the last decade the average age of a mother at chil.pdf
329 In the last decade the average age of a mother at chil.pdf
 
36 In 1812 an earthquake centered on the San Andreas fault.pdf
36 In 1812 an earthquake centered on the San Andreas fault.pdf36 In 1812 an earthquake centered on the San Andreas fault.pdf
36 In 1812 an earthquake centered on the San Andreas fault.pdf
 
36 Most of the catbon dioxide earried inthe blood is transp.pdf
36 Most of the catbon dioxide earried inthe blood is transp.pdf36 Most of the catbon dioxide earried inthe blood is transp.pdf
36 Most of the catbon dioxide earried inthe blood is transp.pdf
 
36 The kidneys maintain blood fluid volume through the neph.pdf
36 The kidneys maintain blood fluid volume through the neph.pdf36 The kidneys maintain blood fluid volume through the neph.pdf
36 The kidneys maintain blood fluid volume through the neph.pdf
 
319 Let the random variable X have the pdf fx 21x0x.pdf
319 Let the random variable X have the pdf fx 21x0x.pdf319 Let the random variable X have the pdf fx 21x0x.pdf
319 Let the random variable X have the pdf fx 21x0x.pdf
 
35 A 67yearold woman is admitted to the hospital with sev.pdf
35 A 67yearold woman is admitted to the hospital with sev.pdf35 A 67yearold woman is admitted to the hospital with sev.pdf
35 A 67yearold woman is admitted to the hospital with sev.pdf
 
34 Why are teloyears DNA test not an accurate way to predi.pdf
34 Why are teloyears DNA test not an accurate way to predi.pdf34 Why are teloyears DNA test not an accurate way to predi.pdf
34 Why are teloyears DNA test not an accurate way to predi.pdf
 
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf
32 Bowenn kamu mallar taleplerini temsil eden modeli A .pdf
 
34 A 42yearold woman is admitted to the hospital due to b.pdf
34 A 42yearold woman is admitted to the hospital due to b.pdf34 A 42yearold woman is admitted to the hospital due to b.pdf
34 A 42yearold woman is admitted to the hospital due to b.pdf
 
35 In Human Resources and Job Design Labor Standards a wo.pdf
35 In Human Resources and Job Design Labor Standards a wo.pdf35 In Human Resources and Job Design Labor Standards a wo.pdf
35 In Human Resources and Job Design Labor Standards a wo.pdf
 
334 LAB Output range with increment of 5 Write a program w.pdf
334 LAB Output range with increment of 5 Write a program w.pdf334 LAB Output range with increment of 5 Write a program w.pdf
334 LAB Output range with increment of 5 Write a program w.pdf
 
31 You are given a list L and another list P containing.pdf
31 You are given a list L and another list P containing.pdf31 You are given a list L and another list P containing.pdf
31 You are given a list L and another list P containing.pdf
 
35 of all college students major in STEM Science Technolo.pdf
35 of all college students major in STEM Science Technolo.pdf35 of all college students major in STEM Science Technolo.pdf
35 of all college students major in STEM Science Technolo.pdf
 

Kürzlich hochgeladen

Magic bus Group work1and 2 (Team 3).pptx
Magic bus Group work1and 2 (Team 3).pptxMagic bus Group work1and 2 (Team 3).pptx
Magic bus Group work1and 2 (Team 3).pptxdhanalakshmis0310
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Jisc
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.MaryamAhmad92
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfPoh-Sun Goh
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Association for Project Management
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.christianmathematics
 
On National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan FellowsOn National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan FellowsMebane Rash
 
SKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptx
SKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptxSKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptx
SKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptxAmanpreet Kaur
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSCeline George
 
PROCESS RECORDING FORMAT.docx
PROCESS RECORDING FORMAT.docxPROCESS RECORDING FORMAT.docx
PROCESS RECORDING FORMAT.docxPoojaSen20
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
The basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxThe basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxheathfieldcps1
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptxMaritesTamaniVerdade
 
Food safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdfFood safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdfSherif Taha
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docxpsychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docxPoojaSen20
 

Kürzlich hochgeladen (20)

Magic bus Group work1and 2 (Team 3).pptx
Magic bus Group work1and 2 (Team 3).pptxMagic bus Group work1and 2 (Team 3).pptx
Magic bus Group work1and 2 (Team 3).pptx
 
Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)Accessible Digital Futures project (20/03/2024)
Accessible Digital Futures project (20/03/2024)
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.ICT role in 21st century education and it's challenges.
ICT role in 21st century education and it's challenges.
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Asian American Pacific Islander Month DDSD 2024.pptx
Asian American Pacific Islander Month DDSD 2024.pptxAsian American Pacific Islander Month DDSD 2024.pptx
Asian American Pacific Islander Month DDSD 2024.pptx
 
Micro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdfMicro-Scholarship, What it is, How can it help me.pdf
Micro-Scholarship, What it is, How can it help me.pdf
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...Making communications land - Are they received and understood as intended? we...
Making communications land - Are they received and understood as intended? we...
 
This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.This PowerPoint helps students to consider the concept of infinity.
This PowerPoint helps students to consider the concept of infinity.
 
On National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan FellowsOn National Teacher Day, meet the 2024-25 Kenan Fellows
On National Teacher Day, meet the 2024-25 Kenan Fellows
 
SKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptx
SKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptxSKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptx
SKILL OF INTRODUCING THE LESSON MICRO SKILLS.pptx
 
How to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POSHow to Manage Global Discount in Odoo 17 POS
How to Manage Global Discount in Odoo 17 POS
 
PROCESS RECORDING FORMAT.docx
PROCESS RECORDING FORMAT.docxPROCESS RECORDING FORMAT.docx
PROCESS RECORDING FORMAT.docx
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
The basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptxThe basics of sentences session 3pptx.pptx
The basics of sentences session 3pptx.pptx
 
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
2024-NATIONAL-LEARNING-CAMP-AND-OTHER.pptx
 
Food safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdfFood safety_Challenges food safety laboratories_.pdf
Food safety_Challenges food safety laboratories_.pdf
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docxpsychiatric nursing HISTORY COLLECTION .docx
psychiatric nursing HISTORY COLLECTION .docx
 

3CGACACTACTTTGAAGTCTGCAGGTAGGTCCGAATCCCCTTT5 A What wi.pdf

  • 1. 3-CGACACTACTTTGAAGTCTGCAGGTAGGTCCGAATCCCCTTT-5 A. What will be the mRNA sequence (3 marks) and amino acid sequence of the resulting polypeptide (3 marks)? B. If this DNA sequence codes for an enzyme, suggest what would happen if a mutation appears resulting that the underlined nucleotide (G) is changed to C (6 marks).