Empfohlen
Weitere ähnliche Inhalte
Was ist angesagt?
Was ist angesagt? (20)
Ähnlich wie Gateway
Ähnlich wie Gateway (20)
Kürzlich hochgeladen
Kürzlich hochgeladen (20)
Gateway
- 2. Contents Introduction to the Gateway System Defining Gateway technology. Advantages of Gateway cloning. How to generate an entry clone Ways to enter the Gateway system. Gene Expression How to obtain a Gateway expression clone. Multisite Gateway System Cloning multiple fragments into a single vector. Plant Cloning Gateway Vectors.
- 3. Introduction to the Gateway System To study the structure and function of genes, cloning of those genes into appropriate expression vectors is often required. Characterization of genes Subcloning into one or more specialized vectors Restriction enzyme digestions Several approaches: Homologous recombination in Escherichia coli or Yeast Site-specific transposition Limitation: specific hosts selection schemes
- 4. Recombinational Cloning The λ phage recombination based in vitro conservative DNA segments flanked by recombination sites A new vector also containing recombination sites Bacteriophage λ integrase recombination proteins site-specific
- 5. Phage lambda recombination in E. coli cos Phage attP The Gateway System relies on 232 bp specific and non cross-reacting att sequences x attB E. coli 21 bp BP Clonase Integration (Int, IHF) Excision (Int, IHF, Xis) LR Clonase attL attR 96 bp 157 bp Lysogen The specificity is given by the 7 nucleotides of the core region
- 7. att site – A defined length of DNA that constitutes a recombination site. There are 4 classes of att sites called attB, attP, attL, and attR. ccdB gene – A counterselectable gene that allows for negative selection of unwanted byproduct plasmids after recombination. Donor (pDONR) Vector – A vector with attP sites flanking a counterselectable gene that recombines with a gene of interest flanked by attB sites. BP reaction – A recombination event between attB and attP sites catalyzed by BP Clonase™ II Entry (pENTR) clone – A vector that contains gene of interest flanked by attL or attR sites. LR reaction – A recombination event between attL and attR sites catalyzed by LR Clonase™ II Destination (DEST) Vector – An application-geared vector with attR sites flanking a counterselectable gene that will recombine with one or more entry clones.
- 8. The Gateway Reactions ccdB attL1 attL2 Entry Clone attR1 + ccdB attR2 LR clonase Destination Vector attB1 attB2 Expression Clone attP1 + attP2 Donor Vector BP clonase KanR AmpR AmpR KanR
- 9. The Gateway Cloning System Your Source • • ORF collection Gene synthesis Gene Gene Gene Protein Localization Maintains reading frame • No restriction enzymes • Library Directional cloning No ligation • 1 hour, roomtemperature reaction with >99% efficiency • No re-sequencing • PCR Compatible with automation • Reversible reactions Your Application Gene Entry Clone Gene Gene Protein Purification RNAi Gene Gene Cell-Free Protein interaction Gene1 Gene2 Gene3 Gene4 Your Application
- 10. Key Benefits of the Gateway Technology Efficiently and easily shuttle insert DNA from one expression plasmid to another Simplify the cloning workflow and save time Utilize Ultimate™ ORF clones, a pre-made Gateway collection Simultaneously clone, in a specific order and orientation, up to 4 DNA fragments into one plasmid, Yielding a high proportion of desired clones. In vitro reactions eliminates problems of plasmid segregation Sequence alterations to the subcloned DNA segment are not expected.
- 11. How to generate an entry clone Options for entering the Gateway system BP Clonase™ reaction LR Clonase™ reaction Ultimate™ ORF collection Vector NTI Advance™ software for in silico cloning
- 12. Different ways to generate the entry clone P1 ccdB L1 P2 Donor Vector B1 + Gene B2 + TOPO-Activated Entry Vector attB PCR Product 1. L2 Gene PCR Product BP Cloning 2. BP Clonase™ TOPO® Cloning TOPO® L1 Gene L2 Entry Clone Ligase 3. 4. Pre-made entry clone 5. Custom-made entry clone Restriction/Ligase Cloning L1 L1 L2 digested Entry Vector + B1 Gene digested DNA Fragment ORF L2 ORF Collection
- 13. 1. BP Cloning – The Reaction gene attL1 ccdB attP1 attB1 gene attB2 + Entry Clone attP2 attR1 Donor Vector KanR attL2 ccdB attR2 + KanR BP Clonase™ 90-99% correct clones on Kan plates
- 14. 2. TOPO® Cloning -TOPO®TA
- 15. 3. Restriction/Ligase cloning Use when there are convenient sites to cut insert out of another plasmid Must cut out ccdB gene by using one of four RE sites flanking the ccdB Reading frame of insert must be considered, as well as downstream expression elements
- 16. 4. Pre-existing ORF collection Invitrogen’s Ultimate™ ORF collection 16,272 human ORFs (Oct 2006 release) Amber stop codons Sequence verified Ready to use in LR reactions http://orf.invitrogen.com/cgi-bin/ORF_Browser
- 17. 5. Custom Gene Synthesis • Quick and cost-effective • No PCR amplification necessary • 100% accuracy (sequence verified) • Optional codon optimization for expression
- 18. In silico cloning using Vector NTI AdvanceTM 11.5 DNA of interest Primers for PCR reaction Cloning Strategy
- 19. Gene Expression Destination vectors Effects of att sites on prokaryotic and mammalian expression How to create your own destination vector.
- 20. Obtaining a Gateway Expression Clone gene attB1 ccdB gene attL1 attR1 attL2 Entry Clone KanR ccdB + attR2 attP1 AmpR LR Clonase™ II Expression Clone attP2 Donor Vector Destination Vector attB2 + AmpR KanR 90-99% correct clones on Amp plates
- 21. Choice of the expression system Cell-free Easy of use Cost of media and Equipment Pos-translational Modifications (Probability of protein function) Time Requirement Bacteria Yeast Insect Mammalian
- 22. Destination vectors for protein expression E. coli Native protein expression Cell free Mammalian Insect N-terminal fusion protein expression Yeast Virus C-terminal fusion protein expression
- 23. Examples of Destination vectors For the expression of C-terminal fusion or native proteins For expression of N-terminal fusion proteins
- 24. Methods for Obtaining Gateway Expression Clones attR1 ccdB attR2 attL1 + Destination Vector Gene Entry Clone LR Reaction attB1 Gene attB2 Expression Clone TOPO® Reaction attB1 attB2 TOPO® Expression vector + Gene PCR Product attL2
- 25. Transfer of the CAT Gene into Multiple Destination Vectors Destination Vector/Application Colonies Background Analysis* Native 15,000 0 4/4 6xHis-fusion 10,650 0 4/4 GST-fusion 9,200 0 4/4 Thioredoxin-fusion 11,000 0 4/4 Sequencing + Strand 13,950 0 4/4 Sequencing - Strand 8,950 0 4/4 Native protein 7,800 15 4/4 6xHis 6,350 30 4/4 CMV-promoter 7,950 0 4/4 SFV 4,500 0 4/4 Tet-regulated promoter 6,350 0 4/4 E. coli Insect Mammalian * positives/total
- 26. Effect of att sites on prokaryotic protein expression pET300/NT-Dest pET302 NT-His MM = MagicMedia™ LB = Luria-Bertani medium + 1mM IPTG
- 27. Effect of att sites on mammalian protein expression 1 2 3 1) pCDNA3.1/lacZ/V5His CMVp lacZ V5His LacZ 2) pDEST40/lacZ/V5His CMVp attB1 attB2 lacZ V5His 3) MultiSite CMV/lacZ/V5His attB4 Extracts normalized for total protein Western blot probed with anti V5 antibody CMVp attB1 lacZ attB2 V5His attB3
- 28. Gateway Conversion Kit R2 R1 Gateway ® Cassette + R1 destination vector Promoter linearized vector Conversion cassettes can be used with any vector or system, even the proprietary ones R2
- 29. Multisite Gateway System How to clone up to 4 DNA fragments simultaneously into one destination vector. Expression of multiple genes in HeLa cells. Testing the effects of promoters and regulatory elements on protein expression.
- 30. `
- 31. More att sequences needed Standard Gateway CTGCTTTTTTGTACAAACTTG attB1 CAGCTTTCTTGTACAAAGTTG attB2 CAACTTTATTATACAAAGTTG attB3 CAACTTTTCTATACAAAGTTG attB4 CAACTTTTGTATACAAAGTTG attB5 MultiSite Gateway
- 32. 2-fragment MultiSite Gateway Pro PCR Fragments pDONRs attB1 attB5r attB5 attB2 X X X X attP1 attP5r attP5 attP2 BP reactions attL5 Entry Clones attL2 X attL1 attR5 X Destination Vectors attR1 attR2 LR reaction Expression clones attB1 attB5 attB2
- 33. 3-fragment MultiSite Gateway Pro PCR Fragments attB4 attB4r attB3r attB3 attB2 X pDONRs attB1 X X X X X attP1 attP4 attP4r attP3r attP3 attP2 BP reactions attR1 attL3 X attR4 Destination vector attL1 attL4 X Entry clones attR3 CmR ccdB attL2 attR2 LR reaction Expression clone attB1 attB4 attB3 attB2
- 34. 4-fragment MultiSite Gateway Pro PCR Fragments attB1 X pDONRs attP1 attB5r attB5 attB3r X X X attP5 attP5r attB4r X X attB4 attP4 attP4r attP3r attB3 attB2 X X attP3 attP2 BP reactions attL5 Entry Clones attL4 attL3 X attL1 X X attR5 attR4 attL2 attR3 X Destination Vectors attR1 attR2 LR reaction Expression clones attB1 attB5 attB4 attB3 attB2
- 35. MultiSite Gateway Three-Fragment Vector Construction Kit PCR Fragments attB1r attB1 attB2 attB2r attB3 X pDONRs attB4 X X X X X attP4 attP1r attP1 attP2 attP2r attP3 BP reactions attR4 attR2 X attL1 Destination vector attL4 attR1 X Entry clones attL2 CmR ccdB attL3 attR3 LR reaction Expression clone attB4 attB1 attB2 attB3
- 36. Typical Results Number of recombining fragments Expected # colonies per 10 L reaction Typical recombination efficiency (%) 1 10 3 -10 6 90 -100 2 10 3 -10 5 80 -100 3 10 3 -10 4 70 -90 4 10 2 -10 3 30 -80
- 37. Shortcomings when co-transfecting two plasmids EGFP mRFP PCAG EGFP mRFP EGFP Plasmid 1 mRFP Plasmid 2
- 38. Expression of Multiple Genes in Human Cells CFP A pCMV B1 B1 pCMV B5 B B4 pEF1 YFP YFP B3 B4 pEF1 CFP B3 CFP B2 B2 YFP
- 39. Testing of Expression Elements using MultiSite Gateway Kozak or Promoter IRES EGFP pABGH HeLa aurora A cdc 2 cyclin B1 cyclin E CMV EF1-a ( CAG ) ( SV40 ) Kozak or Gtx 2xGtx 5xGtx 12xGtx EMCV mHCV2a mHCV33 mHCV45 HCV2a HCV33 HCV45 Determination of expression level of EGFP IRES ( Internal Ribosome Entry Site )
- 40. Kozak or Promoter IRES EGFP pA HeLa Transcriptional signals with Kozak 40.0 350 35.0 300 29 30.0 250 150 100 10.0 50 5.0 13 13 15.0 9 1 1 4 7 7 mHCV45 20.0 mHCV33 25.0 200 mHCV2a EMCV 12xGtx 5xGtx 2xGtx Gtx Kozak EF1-a CMV cyclin E cyclin B1 cdc 2 None 0.0 0 aurora A Relative activity Translational signals with CMV promoter
- 41. Applications Optimized multigene delivery without co-transfection Expression of enzymatic pathways Expression of multi-subunit protein complexes Gene knock-down Variable gene expression levels using different expression elements Combinatorial tagging
- 42. Summary for MultiSite Gateway Technology MultiSite Gateway Three-Fragment Vector Construction Kit Compatible with… Ultimate™ ORF clones MultiSite Gateway Pro attL1-attL2 entry clones MultiSite Gateway Pro entry clones attR4-attR3 DEST vectors attR1-attR2 DEST vectors Available for… Only 3-fragment cloning 2-, 3-, or 4-fragment cloning Applications Vector construction Vector construction Promoter analysis Promoter analysis Expression of multiple genes in one plasmid Reporter analysis …and more
- 43. PLANT CLONING The Gateway cloning provides expression platform of choice for plant systems, with a wide range of vectors for different plant species and purposes. Adapted Gateway® vectors for Agrobacterium-mediated transformation, silencing studies, and many other applications have been cited in over 150 peer-reviewed articles.
- 46. Many of these vectors have been made available from academic and commercial entities By Invitrogen. Some of these are listed here: Department of Plant Systems Biology, University of Ghent pEarly gate vectors Tag protein expression in plants Arabidopsis Information Resource InPlanta Innovation Inc.
- 47. •MAPK signalling cascades extracellular stimuli such as environmental stresses and pathogens •Transgenic rice plants Overexpressed OsMAPK33 suppressed OsMAPK33
- 48. Vector construction and plant transformation Gateway binary vector pB7WG2D and pB7GWIWG2(II) were used for overexpression (top) and suppression (bottom)of OsMAPK33 With increased salinity no difference in salt tolerance between OsMAPK33-suppressed lines and their wild-type plants. the overexpressing lines showed greater reduction in biomass accumulation and higher sodium uptake into cells, resulting in a lower K+ /Na+ ratio inside the cell. suggest that OsMAPK33 could play a negative role in salt tolerance through unfavourable ion homeostasis.
- 49. Conclusion Gateway cloning eliminates the disadvantages of restriction enzyme based cloning It offers expression possibilities that have been impractical or involve many cumbersome steps with traditional restriction enzyme cloning. Manipulating large numbers of Genes was not possible in a uniform manner—independent of size, sequence, or restriction sites. Gateway Cloning is nearly independent of these constraints and is highly efficient Genes may be cloned, subcloned, screened for phenotypes, and retrieved from procedures. screening protocols with high-throughput
- 50. Thank you
Hinweis der Redaktion
- The Gateway Cloning System, invented and commercialized by Invitrogen since the late 1990s, is a molecular biology method that enables researchers to efficiently transfer DNA-fragments between plasmids.
- *The cloning workflow involves isolation of RNA or DNA from various potential sources, buying the gene of interest from a clone collection, or having the gene custom isolated. To perform functional analysis, the acquired gene is then usually cloned into an expression vector.Each step of characterization of genes requires subcloning into one or more specialized vectors that impart particular functional properties to the cloned segment.Often the cloning process involves restriction enzyme digestions. These digests set limits to the cloning step.For example, certain restriction enzymes cannot be used because they will cut within the gene of interest, and thus truncate the gene to be cloned. In addition, the cloning efficiency might be low due to the size of the gene being inserted into the vector.Several approaches have been described that facili-tate the cloning process. Examples that take advantageof homologous recombination in Escherichia coli or yeast site-specific transposition havebeen published. These have significant value for particular applications but are limited in scope by requirements for specific hosts, by selection schemes,
- i will illustrate how Gateway cloning eliminates the disadvantages of restriction enzyme based cloning and offers expression possibilities that have been impractical or involve many cumbersome steps with traditional restriction enzyme cloning.A flexible approach is theλ phage based in vitro conservative site-specific recombination called Recombinational Cloning (RC). whereby DNA segments (e.g., genes) flanked by recombination sites can be mixed in vitro with a new vector also containing recombination sites And incubated with bacteriophageλintegrase recombination proteins to accomplish the transfer of the gene into the new vector.
- Bacteriophage lambda att site recombination is a well-characterized phenomenon. In bacteria, there is a stretch of DNA called attB, (B stands for bacteria), and in the phage there is a stretch of DNA called attP (P stands for phage). When the phage infects a bacterium, the injected lambda DNA recombines with the corresponding bacterial DNA via the att sites in the presence of integration-specific enzymes. When an attB site recombines with an attP site, the outcome is integration of the phage DNA into the bacterial genome. Once integrated, the hybrid recombination sites are called attL and attR (L stands for left, R stands for right). If the phage undergoes the lytic phase, phage DNA can excise itself from the bacterial DNA. In the presence of a different set of recombination and excision enzymes, the attL site recombines with the attR site, resulting in phage DNA separation from the bacterial genome. These recombination reactions (“LR” and “BP”) are the basis of the Gateway Cloning SystemThus, the direction of the reactions is controlled by providing different combinations of proteins and sites.
- The paper published as advertizement of gateway cloning by invitrogen
- the entry clone is the door to the Gateway system. Once you have cloned your DNA fragment into a Gateway entry vector, you can easily transfer it into a destination vector to generate the expression clone.
- The main benefit of the Gateway system is that you only have to clone your DNA sequence one time to create an entry clone. Once the entry clone is verified, you can move your DNA fragment across any expression system with a one-step, 1 hour recombination reaction (LR), without the use of restriction enzymes, ligase, subcloning and screening of multiple clones. Here are some examples of different downstream applications that can be used for your gene analysis needs. With the addition of the MultiSite Gateway technology, you can utilize the Gateway technology further for cloning of multiple DNA fragments in the same recombination cloning technique.
- This system allows engineering of recombination sites to provide high specificity (attB1 reacts with attP1 but not attP2, etc.) and activity, thereby maintaining orientation of the transferred DNA segment and yielding a high proportion of desired clones. This system also provides control over reaction directionality, which helps to maximize the amount of starting molecules that can be driven to product without competing reverse reactions that regenerate starting molecules. In contrast to loxPsites, attBsites have no secondarystructure to interfere with protein expression or DNA sequencing. Because no net synthesis or loss of DNA occurs during DNA segment transfer, reading frame register is always maintained. Moreover, because transfer by RC does not rely on a replicative step (e.g., PCR-based strategies), sequence alterations to the subcloned DNA segment are not expected.
- In this section, we will focus on the options for entering the Gateway system.
- You can clone PCR products to make entry clones in three different ways:By using a Gateway BP cloning reactionBy using directional TOPO® or TOPO® TA CloningBy using restriction enzymes and ligation reactionOr and 5. You can use pre-made or customized entry clones
- To perform the BP Cloning reaction, you will combine the PCR product, which is flanked by attB sequences, with a pDONR™ vector and add BP Clonase™ II. The reaction is incubated at room temperature for an hour and then transformed into standard competent E. coli cells, such as DH5α, TOP10 or Mach1™. The next day, you will have >90% correct clones in kanamycin resistant colonies. Efficiency is high because of the specificity of the recombination reaction (i.e., attB1 x attP1, attB2 x attP2), and negative selection is conferred by the presence of ccdB. The Gateway in vitro recombination system relies on 5 artificial, orthogonal att sequences. That is 5 of each attP, B, L, and R sequences that work in parallel. The specificity is determined by a unique, 7 bp core sequence that allows minimal crossreactivity among attsequences. In the BP reaction, the attB site reacts with the attP site to create attL and attR sites, as depicted. Note that attB1 will only react with attP1 and not attP2, ensuring the directionality of the reaction.To generate the entry clone, two of these artificial short attB sequences (attB1 and attB2) must be added to specific primers that are used to amplify the gene of choice. The DNA fragment is combined with a donor vector that contains attP1 and attP2 sequences and a counterselectable marker, ccdB. Upon addition of BP Clonase™ the entry clone is produced along with a by-product fragment containing ccdB. Due to the presence of the kanamycin resistance gene in the donor vector, Entry clones are selected on plates containing kanamycin. the F-plasmid–encoded ccdB (Bernard andCouturier 1992; Miki et. al. 1992) gene, which inhibitsgrowth of E. coli. CcdB protein involves poisoning of DNA-topoisomeraseII.To propagate vectors that contain the ccdB gene, we isolated an E. coli strain (DB3.1) containing agyrA462 mutation that provides resistance to the ef-fects of ccdB.The BP recombination process is highly efficient, usually producing >10,000 colonies per reaction. Of the total number of colonies obtained, greater than 90% of the colonies contain the entry clone with the gene of interest in the correct orientation.
- The key to TOPO® Cloning is DNA topoisomerase I. The biological role of the enzyme is to cleave and rejoin DNA during replication. Vaccinia virus topoisomerase I specifically recognizes the pentameric sequence 5´-(C/T)CCTT-3´ and forms a covalent bond with the phosphate group of the 3´ thymidine. It cleaves one DNA strand, enabling the DNA to unwind. The enzyme then re-ligates the ends of the cleaved strand and releases itself from the DNA. To harness the religation activity of topoisomerase, TOPO® vectors are provided linearized with topoisomerase I covalently bound to each 3´ phosphate group. This enables the vectors to readily ligate DNA sequences with compatible ends. Vectors with protruding T- overhangs on both the 5’ and 3’ ends are available to clone PCR products (up to 5 kb) produced by Taq polymerase. This is called TOPO® TA cloning.An example of a TOPO®-adapted entry vector is our pCR8/GW/TOPO® TA plasmid, with attL1 and attL2 flanking sites. This is one of the few entry vectors with a resistance different from kanamycin, making it compatible with a variety of destination vectors bearing ampicillin or kanamycin resistance.
- Your restriction strategy must be carefully planned. However, Gateway will make subsequent subcloning much easier.Available vectors are: pENTR™ 1A, pENTR™ 2B, pENTR™ 3C, pENTR™ 4, pENTR™ 11.Corresponding plasmid sequences, multiple cloning regions and restriction enzyme tables for all Invitrogen’s vectors can be found on the web site.
- The Ultimate™ ORF collection contains over 16,000 human and 2,000 mouse open reading frames (ORFs). Each ORF has been cloned into a Gateway donor vector, pDONR™221, using the BP recombination method. The ORF contains the particular gene of interest from the start to stop codon. To ensure integrity of the specific gene sequence, each ORF is fully sequenced from start to stop, and is guaranteed down to the amino acid sequence.To express C-terminal tagged proteins in mammalian cells, the amber UAG stop codon can be suppressed using the Tag-On-Demand™ technology.Ocher UAA opal UGA
- If you do not want to clone your own gene, and it is not available within our clone collection, opt for custom gene synthesis. Gene synthesis is also an excellent option for targets that have been difficult to obtain using conventional PCR cloning due to difficult sequences such as GC-rich regions, high secondary structure, or large size.Invitrogen has entered into an exclusive distribution agreement with Blue Heron Biotechnology.Blue Heron Bio's GeneMaker® can synthesize any gene regardless of sequence, complexity, or size with 100% accuracy. GeneMaker® is a proprietary, automated, high throughput gene synthesis platform. It utilizes proprietary gene assembly instruments as well as numerous error correction methods to ensure that each synthetic gene is 100% accurate. In addition, GeneMaker®'s Expression Optimization and Codon Optimization service offers the flexibility to design DNA sequences for various expression systems or future subcloningmanipulations.As part of the service, the resulting gene is cloned into any vector. As an example, the synthesized ORF is cloned into pDONR™221 to create a Gateway entry clone that can be used for recombination with a variety of destination vectors.
- Vector NTI Advance™ Software allows the generation of entry and expression clones starting from any DNA sequence template and using any of the available configurations. It automatically designs the primers for the generation of the PCR fragments used in the corresponding BP reactions. The program is downloadable from the Vector NTI User Community at www.invitrogen/VectorNTICommunity. Licenses are free for academic and government researchers. Free 30-day trial licenses are available for commercial researchers by emailing bioinfotrial@invitrogen.com.
- In this section we will focus our attention on destination vectors, expression clones, and gene expression using the Gatewaycloning system.
- In a similar fashion, the expression clone is produced by recombination of the entry clone with a specific destination vector that has the attR1 and attR2 sequences and the same counterselectable marker ccdB. Upon addition of LR Clonase™ the expression clone is produced along with a by-product plasmid containing ccdB. Due to the presence of the ampicillin resistance gene in the destination vector, expression clones are selected on plates containing ampicillin.Invitrogen offers a wide variety of pre-made destination vectors for expression and functional analysis of your gene of interest in different systems. Most of the destination vectors contain a promoter to drive expression in the host of choice. For example, pET destination vectors offer a T7/lacUV5 promoter for high-level expression in E. coli. pcDNA-DEST vectors provide the CMV promoter for high-level, constitutive expression in mammalian systems such as COS or HEK293 cells.
- Use this as a guide to help you decide which host systems to use for expressing your protein of interest. As an example, you can start with an E. coli-based system if you are looking for ease of use. However, as you will see in subsequent slides, testing multiple systems will allow you to quickly determine which system offers the greatest benefits for your research needs.
- As we discussed in the introductory section, destination vectors are the application-geared vectors of the Gateway system. These vectors are the platform for gene expression, and virtually all of them have the ccdB gene cloned between the attR sites. A number of different destination vectors have been constructed. They have been designed to support the expression of native, N-terminal and C-terminal fusion proteins in a wide variety of hosts. Tags to facilitate purification and detection such as 6xHIS, V5, Lumio™, and EmGFP are available.Invitrogen offers a wide variety of destination vectors. For an updated list please visit www.invitrogen.com/gateway.
- Here we present an example of two types of destination vectors.One of them, pcDNA™/V5-DEST, has been designed to support the expression of C-terminal fusion and non-tagged proteins, depending whether the gene has a stop codon or not. The other vector, pcDNA™6/BioEase™-DEST, is appropriate for the expression of N-terminal fusion proteins.Depending on the type of vector, different expression elements will be provided either by the vector, or will need to be installed between the attB sites prior to the Gateway reactions.
- As explained in the introductory section, the LR recombination between an entry clone and a destination vector will produce an expression clone. However there is a second way in which you can clone your fragment of interest directly for expression analyses. This strategy consists of TOPO® cloning the fragment of interest into a TOPO®-adapted expression vector. It can be particularly useful when limited time is available for cloning, as the expression clone is obtained in a single step. The fragment of interest may be later transferred back into a donor vector via a BP cloning reaction for further transfer into other destination vectors.
- Gateway overcomes the limitations associated with conventional methodology by allowing the construction of multiple expression vectors in parallel.In this example, the CAT gene was cloned into pDONR™221, generating the corresponding entry clone. This entry clone was recombined with 11 different destination vectors to create expression clones geared towards a specific application (see first column). The reactions were performed in parallel and an aliquot was used to transform E. coli competent cells. Transformants were selected on ampicillin plates. The second column shows the number of colonies obtained per LR reaction.In the absence of LR Clonase™ (mock reactions) virtually no recombinants (<0.5%) were obtained (see Background column). In all cases, the correct clone was obtained when four randomly selected clones from each plate were picked for restriction analysis.
- This is the first of a set of slides aimed to show that the presence of att sequences do not interfere with protein expression regardless of the platform that is being used to express the gene of interest.In this experiment the human JNK protein kinase was cloned into a Gateway (pET300/NT-Dest) and into a non-Gateway vector (pET302 NT-His). The vectors were introduced into BL21(DE3) E. coli cells and expression was carried out in regular LB medium (plus 1 mM IPTG) or in Invitrogen’sMagicMedia™ expression medium (MM). MagicMedia™ dramatically increases the yield of recombinant proteins in T7-regulated E. coli expression systems without the need to monitor culture O.D. or adding inducer. The results clearly show that adequate biomass and protein yields are obtained irrespective of the vector backbone. This indicates that the presence of attB sequences, which are the main difference between the vectors, do not exhibit any significant effect on protein expression.
- In this slide, you see data for the lacZ reporter gene cloned into a non-Gateway vector (pcDNA3.1), a Gateway vector (pDEST40) and a MultiSite Gateway destination vector (pDEST-R4-R3). The DNA was transfected into mammalian cells and the protein expression was assessed by western blot using an anti-V5 antibody. The results clearly indicate that the presence of an att site or multiple att sites do not affect the protein yield.For further information about MultiSite Gateway, please refer to the slides “Cloning multiple fragments into a single vector”.
- Any existing vector can be converted into a destination vector, by inserting a Gateway cassette via blunt end ligation. The cassette contains the chloramphenicol resistance gene and the ccdB gene. The attR sites are at either end. Since the cassette will install the ccdB gene, you must propagate your plasmid in an E. coli strain that is permissive for this gene. To meet this requirement, we have developed Library Efficiency™ ccdBOneShot® Survival competent cells. A vector conversion service is also provided by Invitrogen.
- In the previous sections, we discussed the mechanism of transfer of a single DNA fragment among vectors via BP and LR recombination reactions. However, the full power of this system is realized when multiple DNA fragments are simultaneously assembled into a single vector in a predefined order, orientation, and reading frame. MultiSite Gateway and MultiSite Gateway Pro represent an extension of the Gateway site-specific recombinational cloning system. The introduction of new att site specificities allows simultaneous cloning of multiple DNA fragments in a defined order and orientation
- The recombination mechanism for creating a MultiSite Gateway construct is the same as that with a single fragment. The difference is the att site specificity, which is determined at the single base level, as shown by the underlined nucleotides. Virtually no cross recombination is observed among them.
- In MultiSite Gateway and MultiSite Gateway Pro, entry clones are also constructed via BP recombination but in order for them to have the correct configuration in the final LR assembly reaction, a combination of flanking attL and attR sites is used. This is facilitated by the modular nature of the att sites. A different set of pDONR vectors is required.In this example a 2-fragment recombination using MultiSite Gateway Pro is shown. Here, by reversing the “standard”’ orientation of the attB5 site to an attB5r site in the PCR fragment, and by doing the same with its cognate attP5 counterpart in the donor vector, an attR5, instead of an attL5 is generated in one of the entry clones. The second entry clone bears a standard attL5 sequence that allows pairing with attR5 and the generation of an attB5 via LR recombination. This concept is key to the function of the MultiSite Gateway system.To perform the LR reaction the entry vectors are mixed with an appropriate destination vector and LR Clonase™ II Plus. The reaction is incubated for 16 hours at room temperature and an aliquot is used to transform E. coli competent cells. Recombinants are selected using the destination vector’s antibiotic resistance.
- The same rationale is applied to a 3-fragment recombination scheme using MultiSite Gateway Pro. However, a different arrangement of the att sequences and a different set of pDONR vectors is required as shown in this slide.
- And the same applies to a 4-fragment recombination scheme using MultiSite Gateway Pro.
- Another MultiSite Gateway strategy, called MultiSite Gateway Three-Fragment Vector Construction kit enables the addition of 5’ and 3’ elements at both ends of standard attL1-attL2 entry clones (such as the Ultimate™ ORF clones). Note that in this case attR4-attR3 destination vectors are used.
- Sufficient numbers of colonies with the expected expression construct are obtained using any of the described configurations.
- This slide shows one of the shortcomings when co-transfecting two genes encoded by different plasmids. Some cells express one of the genes (EGFP) while others express only the other one (mRFP). In this particular example only one cell received and expressed both genes (marked with an arrow).MultiSite Gateway overcomes this difficulty by recombining both genes into the same vector (see next slide)
- As mentioned in the previous slide, multiple genes can be combined into a single plasmid. Thus, only one transfection experiment needs to be performed. In this set of experiments, YFP and CFP are combined with the CMV and EF1alpha promoters. In one case, the CMV promoter is part of the destination vector (A), whereas in the other case the promoter is introduced using an entry clone (B).Transfection of only one plasmid was used in each of these examples, and virtually all cells exhibit expression of both genes.
- By swapping promoters and/or regulatory elements using MultiSite Gateway, you can fine-tune gene expression.In this experiment, several promoters were tested for their effect on protein expression. Then, different Kozak or IRES elements were tested together with the CMV promoter. The plasmid constructs were transfected into HeLa cells, and the expression levels of eGFP were determined.
- These are the results from the experiment detailed in the previous slide. By swapping the promoter, dramatic changes in the protein expression levels were obtained. Fine tuning of the expression level is modulated by the use of different translation enhancers.
- The approach has multiple applications to the engineering of proteins, pathways, and cells, and provides a highly flexible platform for functional analysis. (controllable RNAi and heterologous gene expression from the same construct)
- In summary, Invitrogen offers two different configurations for the MultiSite Gateway Technology. The MultiSite Gateway three fragment construction kit is available for three-fragment cloning and is compatible with destination vectors that have attR4-R3 sequences.MultiSite Gateway Pro is highly flexible in that you can use any standard Gateway destination vector (attR1-attR2) for 2-, 3-, or 4-fragment cloning. With a wide range of Invitrogen’s destination vectors and those developed by your lab or collaborators, you are able to tap into a variety of applications. Some examples have been highlighted in this seminar, but the possibilities are endless.
- Figure 1. A summary of available Gateway-compatible vectors for use in plants.Diagrams illustrate Gateway-compatible vectors for (a) protein overexpression, (b) RNA knockdown, (c) promoter analysis, (d) protein subcellular localization, (e)fluorescence resonance energy transfer and bioluminescence resonance energy transfer, (f) bimolecular fluorescence complementation, (g) epitope tagging andtandem affinitypurification, and (h) multi-component transgene assembly. All vectors contain attR recombination sites and a ccdB cassette for selection ofsuccessful recombination events. Only C-terminal fusions are illustrated in this figure but, for most constructs, N-terminal constructs are also available. Table 1provides links by which more detailed information concerning available vectors can be obtained.
- Mitogen-activated protein kinases (MAPK) signalling cascades are activated by extracellular stimuli such as environmental stresses and pathogens in higher eukaryotic plants. To know more aboutMAPKsignalling in plants, a MAPK cDNA clone, OsMAPK33, was isolated from rice. The gene is mainly induced by drought stress. In phylogenetic analysis, OsMAPK33 (Os02g0148100) showed approximately 47–93% identity at the amino acid level with other plant MAPKs. It was found to exhibit organ-specific expression with relatively higher expression in leaves as compared with roots or stems, and to exist as a single copy in the rice genome. To investigate the biological functions of OsMAPK33 in rice MAPK signalling, transgenic rice plants that either overexpressed or suppressed OsMAPK33 were made.
- Gateway binary vector pB7WG2D and pB7GWIWG2(II) were used for overexpression (top) and suppression (bottom)of OsMAPK33, With increased salinity, there was still no difference in salt tolerance between OsMAPK33-suppressed lines and their wild-type plants. However, the overexpressing lines showed greater reduction in biomass accumulation and higher sodium uptake into cells, resulting in a lower K+ /Na+ ratio inside the cell than that in the wild-type plants and OsMAPK33-suppressed lines. These results suggest that OsMAPK33 could play a negative role in salt tolerance through unfavourable ion homeostasis. Gene expression profiling of OsMAPK33 transgenic lines through rice DNA chip analysis showed that OsMAPK33 altered expression of genes involved in ion transport. Further characterization of downstream components will elucidate various biological functions of this novel rice MAPK.