5. CONTENT STANDARD
The learners demonstrate an understanding of:
1. the information stored in DNA as being
used to make proteins.
2. how changes in a DNA molecule may
cause changes in its product
21. Compare
Cytoplasm
Nucleus
Double Stranded Single Strand
Deoxyribose
Ribose
Adenine-Thymine
Cytosine-Guanine
Adenine - A
Uracil - U
Cytosine - C
Guanine - G
Nucleic
Acid
Made up of
Nucleotides
A - T
C - G
29. key players
Carries the information
directed by the DNA
Site for Protein Synthesis, holds the
mRNA, where protein assemble
An enzyme that act on the DNA,
open it, and look for the coding
section
Carries the anticodon, that
supplements the code, and its
corresponding amino acid.
30. SCIENCE 10
DProtein Synthesis: TRANSCRIPTION
Transcription is the sequence of nucleotides in DNA, that directs the order of
nucleotides in messenger RNA (mRNA). The messenger RNA brings information from
the DNA in the nucleus to the protein manufacturing area, the cytoplasm. In the
cytoplasm, the mRNA becomes the template of information to make proteins. The
transcription process can be divided into 3 stages.
Stage 1: Initiation- The Ribonucleic Acid polymerase (RNA polymerase), binds and
open the DNA molecule that will be transcribed.
Stage 2: Elongation- As the DNA molecules open, the RNA polymerase slides along
the DNA strand and links free RNA nucleotides that pair up with nitrogenous bases
of the complementary strand of DNA.
Stage 3: Termination- When the process of base pairing is complete, the RNA
molecule breaks away as DNA strand rejoin. The RNA leaves the nucleus and goes to
the cytoplasm.
35. D
Protein Synthesis: Translation
Translation is the process of converting the information in mRNA into a sequence of
amino acids that make a protein. Two RNA plays an important role in this process:
These are the ribosomal RNA (rRNA) and the transfer RNA (tRNA). As the mRNA leaves
the nucleus of the cell and proceed to the cytoplasm, ribosomes- the site for protein
synthesis, waits for the start of translation process. Translation process can also be
divided into 3 stages.
Stage 1: Initiation- The mRNA binds to the ribosome and it usually look for a start
codon. A codon is triplet base that code for a certain amino acid. The start codon on
mRNA is AUG, the tRNA- that carries an anticodon that complements the codon,
approaches towards the ribosome.
Stage 2: Elongation- As the ribosome slides along the mRNA, new tRNA molecules
carrying amino acids are in place, an enzyme joins them by forming a peptide bond
between them. Thus, a polypeptide chain is produced as the process continues.
36. D
Protein Synthesis: Translation
Stage 3: Termination- When the ribosome reaches the stop codon like (UAG, UAA
and UGA) in the mRNA sequence, a release factor will bind, allowing the ribosome
to dissociates with mRNA and the release of polypeptide chain. Protein synthesis is
now complete.
37. D The Genetic Code Table
The table shows the distribution of amino acids, coded for certain mRNA codons.
There are 20 different amino acids. Some different codons are coded for same amino
acids. For example, if the mRNA code is 5â AUGAAACACCUGUCAGGGUGA 3â,
therefor the sequence of amino acids are Met-Lys-His-Leu-Ser-Gly-Stop.
40. E
True or False
__ 1. RNA polymerase initiates the process of translation.
__ 2. In a semi-conservative replication, two identical DNA has old strands and new strands.
__ 3. The tRNA carries the anticodons that supplement the codon in mRNA strand.
__ 4. The ribosome binds with mature mRNA and begins the process of translation.
__ 5. Cytosine pairs with Uracil in a RNA strand.
__ 6. The stop codon includes UAG, GUA, UAA.
__ 7. The DNA directs the order of nucleotides to be used as template for protein synthesis.
__ 8. A single nucleotide comprises a phosphate group, sugar component and a nucleic acid.
__ 9. In a DNA molecule, a base pair would be composed of Adenine and Guanine.
__ 10. The helicase breaks the bond between nitrogenous pairs of DNA.
FALSE
TRUE
FALSE
TRUE
TRUE
FALSE
TRUE
FALSE
FALSE
TRUE
44. Copyright Infringement
I do not own any of the video clip,
illustrations and diagrams used in
this presentation, they belong to
the rightful owner. They have just
been used for better
understanding of the lesson.