8. Brest Cancer - hindu female-2014

www.wjpps.com Vol 3, Issue 6, 2014. 1213
Abhishikta et al. World Journal of Pharmacy and Pharmaceutical Sciences
ASSOCIATION OF LIFESTYLE VARIABLES WITH THE NOVEL
MUTATION OF BRCA1 GENE IN BREAST CANCER: A CASE-
CONTROL STUDY AMONG THE BENGALEE HINDU FEMALES OF
WEST BENGAL, INDIA.
Abhishikta Ghosh Roy1*
, Pulakes Purkait1
, Malay Barman2
, Biswanath Sarkar1
and
Arup Ratan Bandyopadhyay3
1
DNA Laboratory, Anthropological Survey of India, Kolkata, India.
2
Department of Surgery, National Medical College and Hospital, Kolkata, India.
3
Department of Anthropology, University of Calcutta, Kolkata, India.
ABSTRACT
BRCA1 mutations dramatically increase breast cancer risk, which is
the commonest cause of female death globally including India. There
is a substantial inter-individual variability in breast cancer risk among
BRCA1 mutation carriers, which attracts attention of medical genetics.
In the present study we have identified a novel mutation (cd.1437
CCT>CTT) in BRCA1 gene that changes the amino acid from Proline
to Leucine. Certain lifestyle factors like oral contraceptive use and
abortions are found to be highly associated with breast cancer risk
among the carriers of germline mutation. This study is the first report
from West Bengal among the Bengalee Hindu Caste Female Breast Cancer patients, which
would help in early prognosis of the mutation and modification of lifestyle factors.
Keywords: Novel Mutation, Breast Cancer, Lifestyle factors, Bengalee Hindu females, West
Bengal, India.
INTRODUCTION
Breast cancer is the most frequent female malignancy with an estimated 422,000 new cases
annually being the leading cause of female mortality worldwide (Ferlay et al., 2008). The age
adjusted rates vary with the different regions and cancer registries with increasing incidences
in Indian women with breast cancer (Consolidated Report of Population based Cancer
WWOORRLLDD JJOOUURRNNAALL OOFF PPHHAARRMMAACCYY AANNDD PPHHAARRMMAACCEEUUTTIICCAALL SSCCIIEENNCCEESS
SSJJIIFF IImmppaacctt FFaaccttoorr 22..778866
VVoolluummee 33,, IIssssuuee 66,, 11221133--11222266.. RReesseeaarrcchh AArrttiiccllee IISSSSNN 2278 – 4357
Article Received on
25 March 2014,
Revised on 20 April 2014,
Accepted on 13 May 2014
*Correspondence for Author
Dr. Abhishikta Ghosh Roy
DNA Laboratory,
Anthropological Survey of
India, Kolkata, India.

Registries (2001 – 2004)(Fig.1). Breast cancer being the commonest among women in urban
India, is the second most common cancer among Indian women (Samson et al., 2007).
BRCA1 mutation carriers have a slightly elevated risk of developing breast cancer. Though it
is possible that BRCA1 may interact with estrogen in breast carcinogenesis still it is unclear
what are the exact mechanisms that account for why BRCA1 mutation carriers develop
cancers of these hormonally regulated organs (Lee et al., 2008).
Approximately 5 – 10% of breast cancer and 25% of the early onset of breast cancer is
characterized by genetic susceptibility resulting from highly penetrant germline inactivation
in cancer predisposing genes (Palma et al., 2006). A number of genes have been identified
that are associated with breast cancer that has provided means to begin identifying
individuals and families with an increased risk. BRCA1 was the most highly anticipated
break through in cancer genetics through cloning in the year 1994 (Miki et al., 1994).
Mutations in BRCA1 gene results in loss or inactivation of wild-type allele, resulting in
expression of a non-functional protein and loss of cell cycle control and DNA repair
mechanism in women with tumorigenesis (Welesh and King, 2001).
Estrogen promotes cell proliferation and acts as a genotoxic agent, through its metabolites
generating mutagenic DNA damage in breast carcinogenesis (Yager et al., 2006; Cavalieri et
al., 2000) . BRCA1 is involved in several cellular functions important in carcinogenesis
including DNA damage repair as well as cell cycle checkpoint (Yoshida et al., 2004). In the
absence of BRCA1 functioning, the cancer promoting effects of estrogen would be even
stronger (Fan et al., 2001). There are likely to be other low risk genes that are distributed
more frequently in the population, which interact with environment and lifestyle factors,
which results in breast cancer (Samson et al., 2007).
Breast cancer shows uneven geographical distribution in occurrence reflecting the influence
of local environmental conditions, lifestyle, hormonal / reproductive pattern and genetic
predisposition in the development of the disease (McPherson et al., 2000; Parkin et al., 2001).
Breast cancer being second common cancer in the world, it ranks as fifth cause of death,
because of its good prognosis, average in developed countries is 73% and 57% in developing
countries.
A number of studies have attempted to understand the possible association between certain
lifestyle variables and risk for breast cancer. Certain lifestyle and reproductive factors have

been known to be associated with breast cancer risk. Women, who underwent more menstrual
cycles having early age at menarche (before 12 years) or underwent late menopause (after 55
years) are at a slightly elevated risk of breast cancer (Winer et.al., 2000). Nulliparous women
are at a slightly increased risk of acquiring breast cancer (Huo et al., 2008), the nulliparous
women have undifferentiated cells which never undergoes differentiation, that retains high
concentration of epithelial cells that are targets for carcinogens and therefore undergoes
neoplastic transformation (Boulanger et al., 2005; Henry et al., 2004; Wagner et al., 2002).
Breast-feeding reduces breast cancer risk and is thought to exert its effects through hormonal
mechanisms (Huo et al., 2008; Lord et al., 2008; Zeng et al., 2010). Some studies have found
no association between abortions and increases risk of breast cancer (Erlandsson et al., 2003),
whereas some studies have reported an increased risk of breast cancer among women who
had induced abortions (Zeng et al., 2010). Women who consume alcohol or smoke are at an
increased risk (Atkinson 2003; Chen et al., 2002; Hamajima et al., 2002). Consumption of
alcohol more than two times a day leads to increased level of estrogen in blood leading to
increased risk of breast cancer. Reproductive factors act through different hormonal
mechanisms, some of which may involve estrogen, progesterone, or sex hormone binding
globulin (Bernstein et al., 1985; Garcia-Closas et al., 2002) oral contraceptive use has also
been associated with a slightly increased risk of breast cancer (Collaborative Group on
Hormonal Factors in Breast Cancer, 1996), although the effect is modest, possibly restricted
to current use, and observed in few studies.
Information on BRCA1 mutation in West Bengal, India is still lacking. Association between
breast cancer risk and reproductive and lifestyle variables is still unknown among the
Bengalee Hindu Breast Cancer patients of West Bengal, India. Therefore, the present study is
an attempt to understand the possible risk factors associated with the BRCA1 mutation. This
is the first report from West Bengal, thus it will be a hopeful promise in modifying those
factors to prevent breast cancer occurrence. Some of the breast cancer risk factors can be
modified either through behavioral or environmental changes, whereas genetic and inherited
mutations remains unchanged.
MATERIALS AND METHODS
Collection of samples: The subjects included in this study are 108 patients with histo
pathologically confirmed Breast Carcinoma visiting the Cancer Centre Welfare Home and
Research Institute, Kolkata, India, from April, 2010 to December, 2011. Clinical data and

detailed family history of each patient were collected with the help of collaborating clinicians
after clinical examinations. Ethical approval of the research project using human subjects was
obtained from the Institutional Ethical Committee of Anthropological Survey of India,
Ministry of Culture, Government of India. Patient samples were mainly collected from The
Cancer Centre Welfare Home and Research Institute, Kolkata and National medical College
and Hospital, which are the main referral centers for cases related to Breast Carcinoma. The
demographic data (name, age, caste, address, origin, occupation, family history, educational
status, etc) and reproductive (age at menarche, regularity of menstrual periods, age at
menopause, parity, number of issues) and lifestyle (post menopausal hormone therapy,
abortions, use of oral contraceptives, alcohol consumption and smoking practices) data were
collected using schedule method. Age at menarche was defined as the chronological age
when the women first had her menses; age at menopause was defined as the chronological
age when the natural period ceases without any effect of medical or pathological interference.
Another 127 controls were collected; those were age sex and ethnic group matched. Controls
didn’t have any family history of breast cancer.
DNA Isolation: Approximately 5mL peripheral blood samples were collected in BD
Vacutainer K2 EDTA (6 mL) with written and informed consent from patients with Breast
Carcinoma, and from normal individuals as controls, without any history of breast carcinoma.
Genomic DNA was prepared from fresh whole blood by using the conventional phenol–
chloroform method (Sambrook and Russel, 2001). Genomic DNA was dissolved in TE
(10mM Tris-HCl and 0.1mM EDTA, pH 8.0).
PCR Amplification: Polymerase chain reaction (PCR) was carried out to amplify exon 13 and
adjacent flanking region in a total volume of 10.0 µL containing 40–100 ng genomic DNA,
0.4 mM of each primer, 0.2mM of each dNTP, 0.5–1.5mM of MgCl2 (as appropriate), and
0.2 unit of Taq polymerase (Invitrogen, Carlsbad, CA) in a Thermocycler (GeneAmp-9700;
PE Applied Biosystems, Foster City, CA). Annealing temperature is calculated based on Tm
of the primer pairs. The exon 13 was amplified using the designed primer (F:
AATGGAAAGCTTCTCAAAGTA; R: ATGTTGGAGCTAGGTCCTTAC). PCR amplified
DNA fragments were analyzed on 2% agarose gel and then visualized by ethidium bromide
staining.
Mutation and Polymorphism Detection: The PCR products free of contaminating bands due
to non specific amplification were directly sequenced in forward and reverse direction in

DNA Analyzer 3730 (Applied Biosystems, USA) . Nucleotide changes were detected by
comparing sequence obtained in chromatogram with the normal BRCA1 gene sequence using
pair-wise BLAST (Tatusova et al., 1999) and SeqScape software v2.5. Appropriate statistical
techniques have been applied for analyzing the data using the statistical software SPSS 17.0
version.
RESULTS
A total of 108 breast cancer patients with histopathologically confirmed carcinoma of the
breast and 128 controls without any family history of breast cancer were included in the
present study. The age of the breast cancer patients ranged from 30 to 72 years with a mean
age 54.04 (SD 10.38) years, and mean age of the controls were 54.10 (SD 8.65), ranging
between 32 to 72 years. Exon 13 of BRCA1 has been analysed by amplification using
designed primer followed by direct sequencing in ABI 3730. DNA sequencing results
confirmed the presence of a variant in exon 13 of BRCA1 gene. A C-T transition was found
in codon 1437 which results in the change of amino acid from Proline to Leucine (fig.2).
Figure 1. Showing the novel variant in exon 13 of BRCA1.
Table 1. Distribution of the SNP
Sujects CC CT Total pvalue OR
unadjusted
P value
Patients 93 15 108 P=0.0053
2
- 7.772
0.2000
(0.0643 to
0.6224)
P=0.0055
Controls 124 4 128
217 19 236
Table 1 demonstrated 13% of the patients had significant (p = 0.0053) change in SNP than
the controls (3.125%). The odds of having the SNP for breast cancer patients is 0.2000 times

higher (95% CI: 0.0643 – 0.6224) than those who had no cancer and devoid of family history
of breast cancer. This novel variant (ss527767420 has already been submitted to NCBI
genBank.
Table 2. Socio-demographic characteristics of the subjects.
Socio demographic
characteristics
Cases Controls
pValue
No. % No. %
Marital Status
Ever Married 96 88.9 127 100 p=0.0015
Never Married 12 11.1 0 0
Occupation
Home maker 103 95.4 61 47.7 p=0.0001
service 2 1.9 32 25
others 3 2.8 35 27.6
Caste
Brahmin 23 21.3 30 23.4 p=0.5058
Kayastha 60 55.6 67 52.3
Baidya 15 13.9 23 18
Baishya 8 7.4 4 3.1
SC 2 1.9 4 3.1
Educational Level
Non-literate 3 2.8 4 3.1
Primary level 11 10.2 9 7.0 p=0.7902
Secondary 26 24.1 34 26.6
Higher Secondary 26 24.1 37 28.9
Diploma/Degree 42 38.9 44 34.4
Family History
Yes 72 66.7 0 0 p=0.0001
No 36 33.3 128 100
Socio demographic characteristics of the participants has been presented in Table 2. The
present study revealed no significant differences in age and caste and educational status
between cases and controls. But occupation (p=0.0001) and family history (p=0.0001)

demonstrated significantly in single women (11.1%) and as well married women (88.9%)
among the breast cancer patients in comparison to controls.
Table 3. Reproductive and Lifestyle Characteristics of the studied subjects.
Reproductive chracters
Cases (n= 108) Controls (n=128)
p Value
No. % No. %
Menarche
08 - 10 years 18 16.7 3 2.3 p=0.0001
11 - 13 years 80 74.1 97 75.8
14 and above years 10 9.3 28 21.9
Menstrual Cycle
Regular 53 49.1 104 81.3 p=0.0002
Irregular 55 50.9 24 18.8
Menopausal Status
Pre-Menopause 10 9.3 28 21.9 p=0.006
Post Menopause 98 90.7 100 78.1
Age at Menopause
<50 years 71 65.7 68 53.1 p=0.025
>50 years 27 25 32 25
NA 10 9.3 28 21.9
Post Menopausal Therapy
Yes 32 29.6 23 18 p=0.054
No 76 70.4 104 82
Abortions
Yes 22 20.4 3 2.3 p=0.0001
No 86 79.6 125 97.7
Parity
Parous 85 78.7 128 100 p=0.0001
Nulliparous 23 21.3 0 0
Number of Issues
1 35 32.4 42 32.8 p=0.0002
2 to 4 43 39.8 84 65.6
5 and above 7 6.5 2 1.6
none 23 21.3 0 0
Oral Contraceptive Use
Yes 70 64.8 56 43.8 p=0.0019
No 38 35.2 72 56.3
Alcohol and Smoking
Smoking 31 28.7 26 20.3 P=0.0013
Alcohol 19 17.6 68 53.1
No 58 53.7 34 26.6
Table 3 showed the reproductive performance and lifestyle variables of the patients and
controls. There were significant (p=0.0001) differences between cases and controls in terms
of abortions, such as patients underwent higher abortions (20.4%) than controls (2.3%).
Significant differences (p=0.0001) exist in age at menarche, more number of cases attained

menarche within 8 – 10 years of age (16.7%) than controls (2.3%), while control females
attained menarche at 14 years of age or above (21.9%) in comparison to cases (9.3%).
Significantly (p = 0.0001) of the breast cancer patients were nulliparous and no controls
reported of null Significant differences exist in menopausal status of the women (p=0.006),
post menopausal women were 0.3644 times higher risk of developing breast cancer than pre
menopausal women (95% CI – 0.1681 – 0.7902). Furthermore, higher incidences of irregular
menstruation of the patients (50.9%) has been noticed in comparison to the controls (18.8%).
Hence, the present study envisaged that women with irregularity in menstrual periods were
0.2224 times higher risk of having breast cancer than women with regular menstrual cycles
(95% CI – 0.1242 – 0.3982). Prolonged oral contraceptive use of the patients (64.8%) was
found to be significantly higher (p = 0.0019) than the controls (18%). Alcohol and smoking
practice (p=0.0018), post menopausal therapy (p=0.0540) were found to be also significantly
associated with the breast cancer in the present study.
Table 4. Binary Logistic regression analysis of Risk factors for breast Cancer.
Risk Factors ODDS
Ratio
95% CI pValue
Abortions 1.303 1.226 – 11.039 0.030
Oral Contraceptive Use 1.068 1.131 – 2.902 0.025
Binary Logistic Regression analysis (Table 4) was performed to study the significant
predictors associated with the risk of breast cancer among the carriers of the novel mutation.
The result revealed that there are some lifestyle variables like abortions and prolong use of
oral contraceptives, which can significantly (p<0.030 and p<0.020) predict the risk associated
with the mutation.
Women with the variant who underwent abortions are likely to have 1.303 times more risk
(OR = 1.303; 95% CI = 1.226 – 11.039) of developing breast cancer in their lifetimes than
those who didn’t experience abortions. Again, women carrying the mutation, who have
administered oral contraceptive pills for a longer period of time, are 1.068 times (OR = 1.068;
95% CI = 0.131 – 2.902) more likely to have breast cancer than those who never had oral
contraceptives.
DISCUSSION
In the present study we have identified a novel variant (ss527767420) in exon 13 of BRCA1
gene. Many studies have shown that there is a substantial inter-individual variability in cancer

risk among BRCA1 mutation carriers. Even among those carrying the same deleterious
mutation, there is large variation in age at diagnosis and cancer type. This suggests that there
are additional genetic and environmental factors that modify risk; therefore such study
attracts medical and genetic attention. So, the present study attempted to understand the
possible predictor variables associated with BRCA1 mutation carriers.
Among the well established risk factors of breast cancer, prolong oral contraceptive usage
and abortions were significantly associated with the higher risks of breast cancer among the
carriers of germline BRCA1 mutation in the present study. Furthermore, univariate analysis,
however, demonstrated several variables, such as age at menarche, menaopausal status,
regularity of menstrual periods, parity, number of issues, post menopausal therapy were
found significantly (p<0.001) associated with breast cancer., Several epidemiological studies
have reported that induced or spontaneous abortions are risk factors for breast cancer in
general population (Darling et al., 1994; Newcomb et al., 1996). Induced and
spontaneous abortion increases the risk of developing breast cancer. In early pregnancy,
levels of estrogen increase, leading to breast growth in preparation for lactation. The
hypothesis proposes that if this process is interrupted by an abortion before full maturity in
the third trimester then more relatively vulnerable immature cells could be left than there
were prior to the pregnancy, resulting in a greater potential risk of breast cancer over time.
Though many studies have reported association between abortion and breast cancer risk, the
exact influence is still unclear.
A woman's risk of developing breast cancer depends on several factors, many of which are
related to her natural hormones. Hormonal risk factors include conditions that allow high
levels of estrogen to persist for long periods of time, such as early age at first menstruation
(before age 12), late age at menopause (after age 55), having children after age 30, and not
having children at all. Many of the risk factors for breast cancer are related to natural
hormones, and because Oral Contraceptives work by manipulating these hormones, there has
been some concern about the possible effects of medicines such as Oral Contraceptives on
breast cancer risk, especially if women take them for many years. OCs were introduced in the
1960s, and sufficient time has now elapsed to allow investigators to study large numbers of
women who took birth control pills for many years beginning at a young age and to follow
them as they age. Use of oral contraceptives increases the hormonal levels. Because
hormones are considered to play a role in the etiology of breast cancer, it seems likely that

BRCA1 may be important regulators of growth and differentiation in hormonally responsive
epithelial cells. Breast and ovary being the main estrogen receptor sites, the increased levels
of the estrogen due to prolonged consumption of oral contraceptives gets accumulated in
these sites (Marquis et al., 1995; Rajan et al., 1997). For the females those have mutated
tumor suppressor genes, BRCA1, the gene already fails to perform its tumor suppressing
activity, elevated estrogen and progesterone stimulate breast cell proliferation, finally
uncontrolled growth leads to carcinoma. Several studies have found association between the
OC usage among the BRCA1 mutation carriers, though limited reports are available from
India (Narod et.al., 2002; McLaughlin et al., 2007; Modan et al., 2001). However, most
studies found no or weak association of OC use among BRCA1 mutation carrier in Breast
Cancer (Haile et.al., 2006; Figuiredo et al., 2009; Grenader et al., 2005).
This is the first report of Breast cancer risk assessment among the BRCA1 mutation carriers
among Bengalee females from West Bengal, India. The present study reports a novel variant
in exon 13 of BRCA1 gene, which indicates that exon 13 is likely to play an important role in
carcinogenesis of breast. As known not all individual with germline mutation in BRCA1
develops breast cancer during their lifetimes (risk being 10 – 15%), certain lifestyle variables,
socio-demographic and reproductive factors modify the risk. The present study vindicated
oral contraceptive use and abortions as significant predictors for females carrying the novel
germline mutation. Since it is known that germ line mutations are non-modifiable risk factor,
, therefore modification of the lifestyle variables could reduce the risk of developing the
disease during the lifetime. Therefore, the present study could be taken as one of the early
prognosis for the detection of the mutation and modification of the lifestyle factors among the
Bengalee Hindu females of West Bengal, India.
ACKNOWLEDGEMENT
This research work is supported by the grant from Anthropological Survey of India, Ministry
of Culture, Government of India. I am thankful to the patients with Breast Carcinoma and
control subjects for voluntarily taking part in this research work and donating their blood
samples.
REFERENCES
1. Atkinson HG. Alcohol’s “darker side”( 2003). A drink a day may raise a woman’s risk of
breast cancer. Health News 9(1):4.

2. Bernstein L, Pike MC, Ross RK, Judd HL, Brown JB, Henderson BE.(1985). Estrogen
and Sex hormone-binding globulin levels in nulliparous and parous women. J Natl Cancer
Inst. 74:741-5.
3. Boulanger CA, Wagner KU, Smith GH(2005.). Parity –induced mouse mammary
epithelial cells pluripotent, self-renewing and sensitive to TGF-beta1 expression.
Oncogene. 24:552-560.
4. Cavalieri E, Frenkel K, Liehr JG, Rogan E, Roy D (2000). Estrogens as endogeneous
genotoxic agents- DNA adducts and mutations. J Natl Cancer Inst Monogr. 27:75-93.
5. Chen WY, Colditz GA, Rosner B, Hankinson SE, Hunter DJ, Manson JE, Stampfer MJ,
Willett WC, Speizer FE (2002). Use of post menopausal hormones, alcohol, and risk for
invasive breast cancer. Ann Intern Med 137 (10): 798-804.
6. Collaborative Group on Hormonal Factors in Breast Cancer, 1996. Breast Cancer and
hormonal contraceptives: collaborative reanalysis of individual data on 53,297 women
with breast cancer and 100239 women without breast cancer from 54 epidemiological
studies. Collaborative Group on Hormonal Factors in Breast Cancer. Lancet. 347:1713-
27.
7. Consolidated Report of Population Based Cancer Registries (2001-2004). National
Cancer registry Programme, Indian Council of Medical Research.
8. Daling JR, Malone KE, Voigt LF, White E, Weiss NS (1994). Risk of breast cancer
among young women: relationship to induced abortion. J Natl Cancer Inst. 86(21):1569-
1570.
9. Fan S, Ma YX, Wang C et al (2001). Role of direct interaction in BRCA1 inhibition of
estrogen receptor activity. Oncogene. 20:77-87.
10. Ferlay J, Parki DM, Steliarova-Foucher E (2008). Estimates of the cancer incidence and
mortality in Europe in 2008. Eur J Cancer 46(4):765–781.
11. Garcia-Closas M, Herbstman J, Schiffman M, Glass A, Dorgan JF.(2002). Relationship
between serum hormone concentrations, reproductive history, alcohol consumption and
genetic polymorphisms in premenopausal women. Int j Cancer. 102:172-8.
12. Grenadar T, Peretz T, Lifchitz M, Shavit L (2005). BRCA1 and BRCA2 germ-line
mutations and oral contraceptives: to use or not to use. The Breast. 14: 264-268.
13. Haile RW, Thomas DC, McGuire V, et al. (2006). BRCA1 and BRCA2 mutation carriers,
oral contraceptive use, and breast cancer before age 50. Cancer Epidemiol Biomarkers
Prev. 15(10):1863-70.

14. Hamajima N, Hirose K, Tajima K, Rohan T, Calle EE, Heath CW Jr, Coates RJ, Liff JM,
Talamini R, Chantarakul N et al., (2002). Alcohol, tobacco and breast cancer
collaborative reanalysis of individual data from 53 epidemiological studies, including
58,515 women with breast cancer and 95,067 women without the disease. Br J Cancer
287: 1234-1245.
15. Henry MD, Triplett AA, Oh KB, Smith GH, Wagner KU (2004). Parity induced
mammary epithelial cells facilitate tumorigeneis in MMTV-neu transgenic mice.
Oncogene 23:6980-6985.
16. Huo D, Adebamowo CA, Ogundiran TO, Akang EE, Campbell O, Adenipekun A,
Cummings S, Fackenthal J, Ademuyiwa F, Ahsan H, Olopade OI (2008). Parity and
breastfeeding are protective against breast cancer in Nigerian women. Br J Cancer 98(5):
992-6.
17. Lee E, Ma H, Roberta MC, David VDB, Leslie B, Brian EH, Ursin. (2008). Effect of
reproductive factors and oral contraceptives on Breast Cancer risk in BRCA1/2 Mutation
Carriers and NonCarriers: Result from a Population –Based Study. 17(11):3170-78.
18. Lord SJ, Bernstein L, Johnson KA, Malone KE, McDonald JA, Marchbanks PA, Simon
MS, Strom BL, Press MF, Folger SG, Burkman RT, Deapen D, Spirtas R, ursine G
(2008). Breast Cancer risk and hormone receptor status in older women by parity, age of
first birth, and breastfeeding: a case-control study. Cancer Epidemiol Biomarkers Prev.
17(7): 1723-30.
19. Marquis ST, Rajan JV, Wynshaw-Boris A (1995). The developmental expression of
BRCA1 expression implies a role in differentiation of the breast and other tissues. Nat
Genet. 11:17-26.
20. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q,
Cochran C, Bennett LM, Ding W, Bell R, Rosenthal J, Hussey C, Tran T, McClure M,
Frye C, Hattier T, Phelps R, Haugen-Strano A, Katcher H, Yakumo K, Gholami Z,
Shaffer D, Stone S, Bayer S, Wray C, Bodgen R, Dayananth P, Ward J, Tonin P, Narod S,
Bristow PK, Norris FH, Helvering L, Morrison P, Rosteck P, Lai M, Barrett JC, Lewis C,
Neuhausen S, Cannon-Albright L, Goldgar D, Wiseman R, Kamb A and Skolnick MH
(1994): A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1.
Science 266:66-71
21. Modan B, Hartage P, Hirish-Yechezkel G et.al. (2001). National Israel Ovarian Cancer
Study Group. Parity, oral contraceptives and the risk of ovarian cancer among carriers
and noncarriers of a BRCA1 or BRCA2 mutation. N Engl J Med. 345: 235-40.

22. Mcpherson K, Steel CM, Dixon JM (2000). Breast cancer epidemiology, risk factors and
genetics. Br Med J. 321: 624-628.
23. McLaughlin JR, Risch HA, Lubinski J, Moller P, Ghadirian P, Lynch H, Karlan B,Fishma
n D, Rosen B, Neuhausen SL, et al. (2007). Reproductive risk factors for ovarian cancer
in carriers of BRCA1 or BRCA2 mutations: a case–control study. Lancet Oncol;8:26-34.
24. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q,
Cochran C, Bennet LM, Ding W, Bell R, Rosenthal J, Hussey C, Tran T (1994). A strong
candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266
(5182): 66-71.
25. Narod SA, Dube MP, Klijn J et al (2002). Oral Contraceptives and the risk of Breast
Cancer in BRCA1 and BRCA2 mutation carriers. Journal of the National Cancer Institute.
94(23):1173-1179.
26. Newcomb PA, Storer BE, Longnecker MP, Mittendorf R, Greenberg ER, Willett WC
(1996). Pregnancy termination in relation to risk of breast cancer. JAMA. 275:321-322.
27. Palma M, Ristori E, Ricevuto E, Giannini G, Gulino A (2006). BRCA1 and BRCA2: the
genetic testing and the current management options fro mutation carriers. Crit Rev Oncol
Hematol. 57(1): 1-23.
28. Parkin DM, Bray F, ferlay J, Pisani P (2001). Estimating the world cancer burden:
GLOBOCAN. Int. J. Cancer 94: 153-156.
29. Rajan JV, Marquis ST, Gardner HP, Chodosh LA (1997). Developmental expression of
BRCA2 colocalizes with BRCA1 and is associated with profileration and differentiation
in multiple tissues. Dev Biol. 184:385-401.
30. Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manual. In: Irwin N (ed)
Science. Cold Spring Harbor Press, Cold Sprig Harbor, NY.
31. Samson M, Swaminathan R, Rama R, Sridevi V, Nancy KN, Rajkumar T.(2007). Role of
GSTM1 (Null/Present), GSTP1 (IIe105Val) and P53 (Arg72Pro) Genetic Polymorphisms
and the Risk of Breast Cancer – A Case Control Study from South India. 8:253-257.
32. Tatusova T, Madden T. (1999) BLAST 2 sequences a new tool for comparing protein and
nucleotide sequences. FEMS Microbiol Lett 174:247–250.
33. Welcsh P, King MC (2001). BRCA1 and BRCA2 and the genetics of breast cancer and
ovarian cancer. Hum Mol Genet. 10: 705-713.
34. Winer EP, Morrow M, Osborne CK, Harris JR (2000). Cancer of the breast; Section 2,
Malignant tumors of the breast, in: T.V. Devita (Ed.), Cancer: Principles & practice of
oncology, sixth ed., J.B. Lippcott, Philadelphia, pp. 1651-1659.

35. Yager JD, Davidson NE (2006). Estrogen carcinogenesis in breast cancer. N Engl J Med.
354:270-82.
36. Yoshida K, Miki Y (2004). Role of BRCA1 and BRCA2 as regulators of DNA repair,
transcription, and cell cycle in response to DNA damage. Cancer Sci. 95:866-71.

8. Brest Cancer - hindu female-2014

Empfohlen

Empfohlen

Weitere ähnliche Inhalte

Was ist angesagt?

Was ist angesagt? (20)

Andere mochten auch

Andere mochten auch (6)

Ähnlich wie 8. Brest Cancer - hindu female-2014

Ähnlich wie 8. Brest Cancer - hindu female-2014 (20)

Mehr von Pulakes Purkait

Mehr von Pulakes Purkait (6)

8. Brest Cancer - hindu female-2014