2. Genome!
• The genome is all the DNA in a cell.!
– All the DNA on all the chromosomes!
– Includes genes, intergenic sequences, repeats!
• Specifically, it is all the DNA in an organelle.!
• Eukaryotes can have 2-3 genomes!
– Nuclear genome!
– Mitochondrial genome!
– Plastid genome!
• If not specified, genome usually refers to
the nuclear genome.!
3. Genomics!
• Genomics is the study of genomes,
including large chromosomal segments
containing many genes. !
• The initial phase of genomics aims to map
and sequence an initial set of entire
genomes.!
• Functional genomics aims to deduce
information about the function of DNA
sequences.!
– Should continue long after the initial genome
sequences have been completed.!
4. Human genome!
• 22 autosome pairs + 2 sex chromosomes!
• 3 billion base pairs in the haploid genome!
– About 3% codes for proteins!
– About 40-50% is repetitive, made by (retro)transposition!
– What is the function of the remaining 50%?!
!
• Where and what are the 30,000 to 40,000 genes? Searching DNA
for open reading frames seems to be the most logical way of finding genes, but just because an open
reading frame exists does not definitively answer whether it is transcribed.!
In the Genomic revolution:!
• Know (close to) all the genes in a genome, and the
sequence of the proteins they encode.!
• No longer look at just individual genes!
– Examine whole genomes or systems of genes!
5. Genomics, Genetics and Biochemistry!
• Genetics: study of inherited phenotypes!
The whole point of genetics is to link genes with phenotypes!
• Genomics: study of genomes!
!Functional genomics - is the attachment of information about function
to knowledge of DNA sequence.!
• Biochemistry: study of the chemistry of living
organisms and/or cells!
• Revolution launched by full genome sequencing!
– Many biological problems now have finite (but
complex) solutions.!
– New era will see an even greater interaction among
these three disciplines!
6. Finding the function of genes!
• Genes were originally defined in terms of!
phenotypes of mutants!
• Now we have sequences of lots of DNA from!
a variety of organisms, so ...!
• Which portions of DNA actually do something?!
• What do they do?!
• code for protein or some other product?!
• regulate expression?!
• used in replication, etc?!
7. Much DNA in large genomes is non-coding!
• Complex genomes have roughly 10x to 30x
more DNA than is required to encode all the
RNAs or proteins in the organism.!
• Contributors to the non-coding DNA include:!
– Introns in genes!
– Regulatory elements of genes!
– Multiple copies of genes, including
pseudogenes!
– Intergenic sequences!
– Interspersed repeats!
8. Distinct components in complex genomes!
• Highly repeated DNA (HRS)!
– R (repetition frequency) >100,000!
– Almost no information, low complexity!
• Moderately repeated DNA (MRS)!
– 10<R<10,000!
– Little information, moderate complexity!
• Single copy DNA (Unique)!
– R=1 or 2!
– Much information, high complexity!
9. Re-association kinetics measure sequence complexity!
+
nucleation
2nd
order,
slow
1st
order,
fast
zippering
Denatured DNA
(two single
strands)
A short duplex
forms at a region
of complementarity.
Renatured
DNA
(two strands in
duplex)
10. Sequence complexity is not the same as length!
• Complexity is the number of base pairs of
unique, i.e. nonrepeating, DNA.!
• E.g. consider 1000 bp DNA.!
• 500 bp is sequence a, present in a single copy.!
• 500 bp is sequence b (100 bp) repeated 5X!
a ! b b b b b!
|___________|__|__|__|__|__|!
L = length = 1000 bp = a + 5b!
N = complexity = 600 bp = a + b!
11. Less complex DNA renatures faster!
Let a, b, ... z represent a string of base pairs in DNA that can
hybridize. For simplicity in arithmetic, we will use 10 bp per
letter.!
!
DNA 1 = ab. This is very low sequence complexity, 2 letters or
20 bp.!
DNA 2 = cdefghijklmnopqrstuv. This is 10 times more complex
(20 letters or 200 bp).!
DNA 3 =
izyajczkblqfreighttrainrunninsofastelizabethcottonqwftzxvbifyoud
ontbelieveimleavingyoujustcountthedaysimgonerxcvwpowentdo
wntothecrossroadstriedtocatchariderobertjohnsonpzvmwcomeon
homeintomykitchentrad. !
This is 100 times more complex (200 letters or 2000 bp).!
12. Less complex DNA renatures faster, #2!
DNA 1 DNA 2 DNA 3
ab
cdefghijklmnopqrstuv
izyajczkblqfreighttrainrunninsofastelizabethcottonqwf
tzxvbifyoudontbelieveimleavingyoujustcountthedaysi
mgonerxcvwpowentdowntothecrossroadstriedtocatch
ariderobertjohnsonpzvmwcomeonhomeintomykitche
ntrad
ab ab ab ab
ab ab ab ab ab
ab ab ab ab ab
ab ab ab ab ab
ab ab ab ab ab
ab ab ab ab ab
ab ab ab ab ab
ab ab ab ab ab
etc.
cdefghijklmnopqrstuv
cdefghijklmnopqrstuv
cdefghijklmnopqrstuv
Molar concentration of each sequence:
150 microM 15 microM 1.5 microM
Relative rates of reassociation:
100 10 1
For an equal mass/vol:!
13. Five main classes of repetitive DNA
1. Interspersed repeats
2. Processed pseudogenes
3. Simple sequence repeats (SSRs)
4. Segmental duplications
5. Blocks of tandem repeats
Page 546-550
14. Five main classes of repetitive DNA
• Constitute ~45% of the human genome.
• They involve RNA intermediates (retro-elements) or
DNA intermediates (DNA transposons - 3% of human genome).
Examples
Short interspersed elements (SINEs); They are retro-tranposons, DNA
segments that move via an RNA intermediate
ü These include Alu repeats, most abundant repeated DNA in primates!
ü Short, about 300 bp, about 1 million copies!
ü Cause new mutations in humans!
Long interspersed elements (LINEs); !
• Moderately abundant, long repeats!
• LINE1 family: most abundant!
• Up to 7000 bp long, about 50,000 copies!
• Retrotransposons!
• Encode reverse transcriptase and other enzymes required for transposition!
• Cause new mutations in humans!
• Homologous repeats found in all mammals and many other animals!
1. Interspersed repeats
Retroposons - repetitive
DNA fragments which
are inserted into
chromosomes after
they had been reverse
transcribed from any
RNA molecule
Retrotransposons - encode reverse transcriptase (RT). Therefore, they are
autonomous elements with regard to transposition activity
15. Five main classes of repetitive DNA cont.
Page 547
These genes have a stop codon or frameshift mutation
and do not encode a functional protein. They commonly
arise from retro-transposition, or following gene duplication
and subsequent gene loss.
2. Processed pseudogenes
16. Five main classes of repetitive DNAcont.
Page 546
(i) Microsatellites: from one to a dozen base pairs
Examples: (A)n, (CA)n, (CGG)n (CCCA)n (GGGT)n
These may be formed by replication slippage.
(ii) Minisatellites: a dozen to 500 base pairs
Simple sequence repeats of a particular length and
composition occur preferentially in different species.
In humans, an expansion of triplet repeats such as CAG
is associated with at least 14 disorders (including
Huntington s disease).
3. Simple sequence repeats
17. Five main classes of repetitive DNA
Page 547
• These are blocks of about 1 kilobase to 300 kb that are
copied intra- or inter- chromosomally, about 5% of the
human genome consists of segmental duplications.
• Duplicated regions often share very high (99%) sequence
identity.
• As an example, consider a group of lipocalin genes on
human chromosome 9.
4. Segmental duplications
18. Five main classes of repetitive DNA
These include telomeric repeats (e.g. TTAGGG in
humans) and centromeric repeats (e.g. a 171 base pair
repeat of α satellite DNA in humans).
Such repetitive DNA can span millions of base pairs,
and it is often species-specific.
5. Blocks of tandem repeats
19. Finding genes in eukaryotic DNA
Types of genes include: -
• protein-coding genes
• pseudogenes
• functional RNA genes
-tRNA - transfer RNA
-rRNA - ribosomal RNA
-snoRNA - small nucleolar RNA
-snRNA - small nuclear RNA
-miRNA - microRNA
Page 552
Two of the biggest challenges in understanding any
eukaryotic genome are
• defining what a gene is, and
• identifying genes within genomic DNA
20. Finding genes in eukaryotic DNA
Protein-coding genes are relatively easy to find in
prokaryotes, because the gene density is high (about
one gene per kilobase).
In eukaryotes, gene density is lower, and exons are
interrupted by introns.
Page 553
21. Eukaryotic gene prediction distinguish several kinds of exons
There are several kinds of exons:
- noncoding
- initial coding exons
- internal exons
- terminal exons
- some single-exon genes are intronless
22. Eukaryotic chromosomes can be dynamic
Chromosomes can be highly dynamic, in several ways.
• Whole genome duplication (auto-polyploidy) can occur,
as in yeast (Chapter 15) and some plants.
• The genomes of two distinct species can merge, as in the
mule (male donkey, 2n = 62 and female horse, 2n = 64)
• An individual can acquire an extra copy of a chromosome
(e.g. Down syndrome, TS13, TS18)
• Chromosomes can fuse; e.g. human chromosome 2 derives
from a fusion of two ancestral primate chromosomes
• Chromosomal regions can be inverted (hemophilia A)
• Portions of chromosomes can be deleted
• Segmental and other duplications occur
• Chromatin diminution can occur (Ascaris)
Page 565
23. denaturation – renaturation of DNA!
- Tm : melting temperature - position in melting profile
where 50% is single-stranded!
24. Denaturation and Renaturation!
• Heating double stranded DNA can overcome the hydrogen
bonds holding it together and cause the strands to separate
resulting in denaturation of the DNA!
• When cooled relatively weak hydrogen bonds between bases
can reform and the DNA renatures!
TACTCGACATGCTAGCAC!
ATGAGCTGTACGATCGTG!
Double stranded DNA!
TACTCGACATGCTAGCAC!
ATGAGCTGTACGATCGTG!
Double stranded DNA!
TACTCGACATGCTAGCAC!
ATGAGCTGTACGATCGTG!
Denatured DNA!
Single stranded DNA!
25. !
Renaturation!
!
!- Renaturation is NOT simply the reverse of denaturation!
! !- Collision of complementary strands required !
! !- nucleic acid strands are negatively charged in the phosphate moiety !
! ! !a -1 charge per nucleotide => repulsion !
! ! ! !=> hence : requires shielding to allow strands to approach !
! ! ! ! ! one another (use of Na+ or K+ salts)!
! !!
!- Four parameters in renaturation kinetics!
! !1) Concentration of cations!
! !2) Incubation temperature (usually 20 to 25 °C below Tm)!
! !3) DNA concentration (related to complexity of the DNA )!
! !4) Size of the fragments!
!
26. !
!
!
!
DNA denaturation and renaturation : strategic aspects!
native DNA!
fast chilling!
slow chilling!
very limited renaturation!
(palindromes?)!
almost complete
renaturation!
Hyperchromicity effect : disruption of the stacking !
=> 30 to 40 % increase of UV (260 nm) absorption!
27. Denaturation and Renaturation!
• DNA with a high guanine and cytosine content has relatively
more hydrogen bonds between strands!
• This is because for every GC base pair 3 hydrogen bonds
are made while for AT base pairs only 2 bonds are made !
• Thus higher GC content is reflected in higher melting or
denaturation temperature!
50 % GC content Intermediate melting temperature!
!
67 % GC content –!
High melting temperature!
TGCTCGACGTGCTCG!
ACGAGCTGCACGAGC!
33 % GC content –!
Low melting temperature!
TACTAGACATTCTAG!
ATGATCTGTAAGATC!
TACTCGACAGGCTAG!
ATGAGCTGTCCGATC!
28. Comparison of melting temperatures can be used to
determine the GC content of an organisms genome!
OD260!
0!
1.0!
65 70 75 80 85 90 95
Temperature (oC)!
Tm = 85 oC!Tm = 75 oC!
Double
stranded
DNA!
Single
strand
ed
DNA!
Relatively
low GC
content!
Relatively
high GC
content!
Tm is the
temperature at
which half the
DNA is melted!
29. !
!
!
!
Idealized course of reassociation, expresssed in a Cot diagram.!
Fully
denaturated!
at the start : !
At the end of !
renaturation!
Reaction is halfway!
30. • The value of k can be experimentally derived from a re-association
curve (Cot curve).!
• This value depends on:-!
ü cation concentration, !
ü temperature, !
ü fragment size, etc. !
!
!!
• Genomes (especially eukaryotic genomes) may contain-!
! !- unique sequences (single copy)!
! !- moderately repeated sequences!
! !- highly repetitive DNA!
!
• Cot analysis allows characterisation of sequence complexity in
terms of different subclasses of sequences depending on degree
of repetitivity, and also allows fractionation of the different
subsets.!
33. !
!
!
!
Complexity log N (number of base pairs)!
Contributions !
of the different!
DNA-compounds!
Repetitive DNA!
Unique DNA!
mixture!
degree of repetition!
pure mixed!pure mixed!
Theoretical Cot-curve of a DNA, that consists of a mixture of two equal parts of DNA !
sequences of a particular of repetitive degree.!
The larger and more complex an organisms genome is, the longer it will take for
complimentary strands to bum into one another and hybridize!
36. Hybridization!
• Because DNA sequences will seek out and hybridize with
other sequences with which they base pair in a specific way
much information can be gained about unknown DNA using
single stranded DNA of known sequence!
!
• Short sequences of single stranded DNA can be used as
probes to detect the presence of their complimentary
sequence in any number of applications including:!
– Southern blots!
– Northern blots (in which RNA is probed)!
– In situ hybridization!
– Dot blots . . .!
• In addition, the renaturation or hybridization of DNA in
solution can tell much about the nature of organism s
genomes!
37. Hybridization!
TACTCGACAGGCTAG!
CTGATGGTCATGAGCTGTCCGATCGATCAT!
DNA from source X !
TACTCGACAGGCTAG!
Hybridization
Because the source of any
single strand of DNA is
irrelevant, merely the
sequence is important, DNA
from different sources can
form double helix as long as
their sequences are
compatible!
DNA from source Y !