Define DNA fingerprint and DNA fingerprinting.
Explain some terms related to DNA fingerprinting.
Describe the method of collection and preservation of biological samples.
Describe the uses of DNA fingerprinting.
Describe the types of DNA fingerprinting.
Describe the steps of DNA fingerprinting.
Call Girls Ahmedabad Just Call 9630942363 Top Class Call Girl Service Available
DNA fingerprinting
1. DNA Fingerprinting
Dr. Md. Mohiuddin Masum
Bangabandhu Sheikh Mujib Medical University
Dhaka, Bangladesh.
2.
3.
4. Define DNA fingerprint and DNA fingerprinting
Explain some terms related to DNA fingerprinting
Describe the method of collection and preservation of
biological samples
Describe the uses of DNA fingerprinting
Describe the types of DNA fingerprinting
Describe the steps of DNA fingerprinting
Objectives
5.
6. A small set of DNA variation
that is very likely to be different
in all unrelated individuals,
thereby being as unique to individuals
as are fingerprint
DNA Fingerprint
7. A method used to identify an individual from a
sample of DNA
by looking at unique patterns
in their DNA sequence
DNA Fingerprinting
www.yourgenome.org
8. Also known as,
DNA Fingerprinting
DNA profiling
DNA testing
DNA typing
Genetic fingerprinting
13. Terms related to DNA fingerprinting
Polymorphism
http://groups.molbiosci.northwestern.edu//DNA_polymorphism
14. Terms related to DNA fingerprinting
DNA Polymorphism
http://groups.molbiosci.northwestern.edu//DNA_polymorphism
Single nucleotide polymorphism (SNP)
Minisatellite or variable number of tandem repeat
(VNTR)
Microsatellite or short tandem repeat (STR)
15. Terms related to DNA fingerprinting
Junk DNA
Proteomics & Genomics/Dr. Vikash Kumar Dubey
95%
16. Terms related to DNA fingerprinting
Tandem repeat
www.bio.miami.edu/dana/dox/vntr.html
18. Terms related to DNA fingerprinting
Minisatellite or VNTR
AGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGA
https://en.wikipedia.org/wiki/Variable_number_tandem_repeat
19. Terms related to DNA fingerprinting
Microsatellite or STR
ATGCCATGCCATGCCATGCCATGCC
https://en.wikipedia.org/wiki/Microsatellite
20. Terms related to DNA fingerprinting
Restriction endonuclease
Escheria coli EcoRI
5’ GAATTC 3’
3’ CTTAAG 5’
5’ G AATTC 3’
3’ CTTAA G 5’
https://en.wikipedia.org/wiki/Restriction_enzyme
21. Blood
Saliva
Semen
Tissue from personal item
From stored sample
Hair follicle
Sources of DNA evidence
33. Restriction fragment length
polymorphism (RFLP)
Polymerase chain reaction amplification
of short tandem repeat (PCR/STR)
Types of DNA fingerprinting
34. RFLP
Types of DNA fingerprinting
DNA
extraction
Restriction
digestion
Electrophoresis
Transfer of DNA to
membrane
Hybridization of
DNA
X-ray
38. 13 CODIS core STR loci
with chromosomal position
Types of DNA fingerprinting
39. Types of DNA fingerprinting
Restriction fragment length
polymorphism (RFLP)
Polymerase chain reaction
amplification of short tandem
repeats (PCR/SRT)
More sample needed Less sample needed
Fresh DNA sample needed Fresh DNA sample not always
mandatory
No chance of amplification of
contamination
Chance amplification of
contamination
Require more time Require less time
Analysis is costly. Analysis is cheap than RFLP
Conventional fingerprint of an individual comes from finger tip and unique for an individual. This is used for identification of a person in forensic lab, police station etc. However, the major drawback of the conventional fingerprints is that it can be changed by surgery. There is another type of fingerprint unique to an individual called DNA fingerprint. This remains same in all body parts, tissues and cells as well as cannot be altered by any known methods. Thus, DNA fingerprint method is becoming primary method for identifying an individual.
Conventional fingerprint of an individual comes from finger tip and unique for an individual. This is used for identification of a person in forensic lab, police station etc. However, the major drawback of the conventional fingerprints is that it can be changed by surgery. There is another type of fingerprint unique to an individual called DNA fingerprint. This remains same in all body parts, tissues and cells as well as cannot be altered by any known methods. Thus, DNA fingerprint method is becoming primary method for identifying an individual.
The process of DNA fingerprinting was invented by Sir Alec Jeffrey at the University of Leicester in 1984
the first case (March 1985) was not strictly a forensic case but one of immigration. The first application of DNA fingerprinting saved a young boy from deportation.
Colin Pitchfork was the first criminal caught based on DNA fingerprinting evidence. He was arrested in 1986 for the rape and murder of two girls and was sentenced in 1988.
To compare the victim’s or suspect’s DNA profile to the recovered crime-scene DNA, the laboratory will need to have their known biological samples available for a side-by-side comparison. These known samples are called reference samples.
The DNA profiling of each individual is unique because of the diverse in polymorphic regions present in genome of every individual. These polymorphic regions used for identification are the non-coding regions of the genome. The polymorphic regions of the DNA do not code for proteins and which make-up 95% of our genetic DNA. Hence these regions are therefore called the ―junk DNA‖. Although these ―junk DNA‖ regions do not code for proteins, they are involved in regulating gene expression, they help in reading of other genes that code for protein and are a large portion of the chromosome structure.
Best sample to take from a dead body for DNA testing:
Blood, tissue or hair roots can be collected from a body.
If the body is decomposed, the best samples are long bones such as the humerus or femur.
However, we can also work with teeth.
METHODS OF COLLECTION:
· Whole blood Sample: Sterile needle should be used while withdrawing or collecting blood.
· Blood stain: Should be picked up preferably on sterile cotton gauge using sterile forceps and blade.
· Seminal stain: Should not be touched by hand especially the stain portion. Should be picked up with sterile forceps.
· Hard Tissues: Bones-- bones should be picked up using gloves, Kept at a place where there are no chances of environmental contamination. It should be allowed to dry completely.
· Soft Tissues: Body organs should be collected using forces and wearing gloves. It should be kept in a sterile container.
· Hair: Hair roots are preferred for the analysis. Hair roots should be picked up using sterile forceps.
Can you guess which one is Sara and which one is Miss Ellis?
Dr Ian Findlay at the Australian Genome Research Facility, the University of Queensland, developed the now patented technique which has the same level of accuracy achieved by traditional DNA fingerprinting methods.