Evidence of Evolution by Natural Selection - how basic evolutionary principals can lead to complex diversity.

Evidence of Evolution by Natural Selection
How basic evolutionary principals can lead to complex diversity
“There is grandeur in this view of life…so simple a beginning
endless forms most beautiful and most wonderful have been, and
are being evolved.”
- Charles Darwin, The Origins of Species (1859)
Madison W Elsaadi Ms.c.
LSUHSC Shreveport
Dept. of Pharmacology, Toxicology, & Neuroscience
(See notes for explanations & links to papers/articles/exercises)

Outline
 Introduction
• The scientific method
• Darwin’s observations
• Why is evolution important?
• Comparison as scientific tool
• Phylogenetic tree
 The ways of change
• Mutations, genotype to phenotype
• Genetic drift
• Selection
• Hardy-Weinberg
• Exercise 1
• Adaptation
• Snake venom
• Giraffe’s long necks
• Case study: Shooting the Poop
 Speciation events
• Types of barriers
• Give examples
• Artificial reproduction of speciation event
• Tree of life
Primary reading: The Tangled
Bank – an introduction to
evolution . Carl Zimmer

 Reproductively isolated / Four separate ecosystems
 Made observations about nature
 Sea shell fossils at tip of mountains
 Phenotypic variations in related organisms in different habitats
 Beaks of related finches
The First Observations Made by Darwin

1. Variation: Members making up a population differ from each other, sometimes
exhibiting dramatic differences.
1. Inheritance: The variation witnessed was passed down, or inherited, from parent
to offspring.
1. Overpopulation: All populations produce more offspring than the environment’s
carrying capacity, resulting in a constant struggle for existence.
1. Differential reproductive success: Individuals better adapted for their
environment survive to reproduce more, and those offspring inheriting these
adapted traits survive better to produce more offspring.
o Alters the frequency of traits in the next generation, essentially
accumulating, thereby changing a population overtime.
4 Observations Which Led to The Theory of Evolution
by Natural Selection

Darwin hypothesized all life descended
from a single organism.
Descent with Modification
Diversity
Better adapted
Allele frequency
changes
Differential survival
Variant offspring
Single ancestor

Evolution is the process by which modern organisms
have descended from ancient ancestors. Evolution is
responsible for both the remarkable similarities we see
across all life and the amazing diversity of that life.
— but exactly how does it work?

How Scientists Study Evolution
Comparison between species
 What can scientists
compare?
• Morphology
• Nursing of young
• Mating behavior
• Fossil record
• Genetic sequence

Ways of Change Overview
Mutations, Genetic Drift, Gene Flow, & Natural Selection
Mutation: Random change in DNA. The green bug had
offspring with a mutation in gene coding for coloration.
Genetic Drift: change in the frequency of an allele in a
population due to random sampling of organisms.
Gene Flow: exchange of genes between populations, which
are usually of the same species. Migration into or out of a
population can change allele frequencies, as well as
introducing genetic variation into a population. Conversely,
emigration may remove genetic material.
Natural Selection: includes sexual selection, is the fact that
some traits make it more likely for an organism to survive and
reproduce. Population genetics describes natural selection by
defining fitness as a propensity or probability of survival and
reproduction in a particular environment.

Quick Review– The Central Dogma of Biology
Natural Selection
AATCG
GGTCAATATCGGA
GCGTGTTAAGCGTAAAGCGTTGACG

Quick Review– The Central Dogma of Biology
 An organism's DNA (genotype)
affects how it looks, how it behaves,
and its physiology — all aspects of its
life (phenotype).
 DNA is the “instruction book” of you.

 DNA can spontaneously change as it replicates via various mechanisms
 We’re exposed to mutagenic substances daily
 With each division exists a small chance that a given DNA locus will mutate
 Rate of mutation can be calculated
 Lynch et al. found that each time a cell divides, a 0.0000003% chance of
mutating exist at each site
Mutations: creating variation

 Mutations can be
1. Harmful, helpful, or neutral
2. Germinal or somatic
Familial Parkinson’s Disease: 10% of all PD cases
Sporadic PD: 90% of PD cases
Harmful, Germinal
Harmful, Somatic

When mutations increase fitness
What happens if a mutation causes a protein or system to perform more
efficiently, to conserve more energy, or ultimately increases fitness in some way?
Examples of human application?
 Adaptations to high altitudes (Tibet and Andes).
 Lactase persistence
 Menopause occurring later
 G127V conveys natural protection from Kuru. Found only in populations
vulnerable to Kuru in New Guinea.

Ways of Change
Genetic Drift
 One of basic mechanisms of evolution
 Changes due to chance
 Random evolutionary change
 Two types: Bottle Neck and Founder Effect
Genes of this
population made of
the lucky individuals

 Genetic drift has larger impact on smaller populations
 Leads to either elimination of one allele, or fixation of it
• If small population, genetic drift will favor rapid elimination of one allele,
thus fixation of the other
1.0 -
0.5 -
0.1 -
AlleleAfrequency
Alleleafrequency
Generations
N = 30
N = 30
N = 1000
Genetic Drift
Link to
simulation
website:
http://www.biol
ogy.arizona.edu/
evolution/act/dri
ft/drift.html

Genetic Drift Evidence
Large population &
high genetic diversity
Catastrophic event
Low population
Large population &
low genetic diversity

Natural Selection
Mechanism by which evolution occurs
Darwin argued that NS came about because
some individuals were more successful in their
environment and ultimately reproduced more.
Differential Reproductive SuccessI. Variation
II. Selection

Natural Selection
Evidence: The Peppered Moth
1848 Industrial Revolution 1895
 Peppered moth
• First recorded case of Darwin's natural selection in action
• 1950s paper validated in 2012 (link below)
Year 1848 1895
White
moth
98% 5%
Black
moth
2% 95%

“Here we show that the mutation event giving rise to industrial melanism in
Britain was the insertion of a large, tandemly repeated, transposable element
into the first intron of the gene cortex. Statistical inference based on the
distribution of recombined carbonaria haplotypes indicates that this
transposition event occurred around 1819, consistent with the historical
record. “
Natural Selection
Evidence: The Peppered Moth

 Positive selection: occurs when allele increases the reproductive success of an
individual
• Example: mutation allows bacteria to metabolize their food more efficiently.
Can also occur on existing mutation if the environment changes.
 Negative selection: occurs when an allele lowers the relative fitness of a genotype.
• Example: Mutation causes childhood disease which results in expiration
before age of reproduction
 Stabilizing selection: occurs when extreme forms of the trait are selected against
 Disruptive selection: occurs when natural selection favors both extremes of
continuous variation. Over time, the two extreme variations will become more
common and the intermediate states will be less common or lost.
Natural Selection
Types of Selection

This population of bugs have adapted
to their environment via positive
selection.
Present day human new born size has
stabilized at ~7 lbs due to stabilizing pressure
Natural Selection
Types of Selection

Natural Selection
Types of pressure
http://www.science.gov/topicpages/a/achieve+cryptic+coloration.html

Hardy Weinberg Equation
How to precisely quantify evolution within a given population?
Hardy & Weinberg demonstrated (independently) in early 1900s that although parents may
follow Mendel’s genetics, a population as a whole does not. Frequency of a given allele
within a population will remain unchanged IF natural selection or other evolutionary forces
are absent.
The equation expresses a principal known as Hardy-Weinberg equilibrium, which states:
“the amount of genetic variation in a population will remain constant from one generation
to the next in the absence of disturbing factors.”
p2 + 2pq + q2 = 1
• p = frequency of the "A" allele within population.
• q = frequency of the "a" allele within population.
• p2 represents the frequency of the homozygous genotype AA.
• q2 represents the frequency of the homozygous genotype aa.
• 2pq represents the frequency of the heterozygous genotype Aa.
• p + q = 1.

- No natural selection
- No mutations
- No migration
- Assumes large population
- Random mating (no preference)
Hardy Weinberg Equilibrium
Disruptive forces

q2 =
q =
p =
2pq =
N = 1000
Green = 655
Brown recessive
How many homozygous green?
Hardy Weinberg Equilibrium
Exercise
4/16
0.5
0.5
0.5
50% of
population is
heterozygotes
aa or q^2 = 345/1000 = .345
a or q = SQRT 0.345 = 0.59
1-.59 = .41 = p
P^2 = .41^2 = 0.1681
http://www.germanna.edu/documents/Hardy-
WeinbergEquilibriumSept2012_002.pdf

 A trait that (i) evolved by natural selection (ii) for its current, (iii) fitness-
enhancing function
 Thus, the ancestor-descendant relationship is essential in identifying
adaptions
 It is not the fastest, strongest, or smartest that survives, but rather it is
the one most willing to adapt to his or her environment
Adaptation
- Thermophiles
- Geothermal regions
- 41C – 122C
- Multiple adaptations to
survive in desert
- Camouflage

 Nature brims with complex adaptations
 Parts of the “system” must evolve into a synchronized system, acting as one unit
 Novel complex adaptations require new genes with new functions
Many genes required to produce
venomous molecules. Glands must
produce and store venom.
Fangs must deliver the venom.
Each part depends on the other
Adaptation

Adaptation
Gene duplication
 When genes duplicate = new function (if new function offers advantage)
 Duplication events result from faulty DNA replication machinery.
 Duplication creates redundancy and redundancy provides means of innovation
Both genes
perform same
task, lowering
work load
Both genes
perform old
task, lowering
work load and
allow both
genes to take
on new role
New gene
does nothing
Both genes
perform old
task
New gene takes on new task
previously unperformed

How did snake venom originate?
Why is venom from some snakes so
toxic while other snakes have no
venom?
Adaptation
The origin & decent of venom

Adaptation
Bryan Fry & colleagues Work Flow
Isolated venom glands from range of
snakes
Identified active genes
Half encoded for venom molecules,
which they sequenced
Snakes each had own cocktail
Drew phylogenetic tree based on
sequence of each venom gene.
Compared venom gene tree to previous
phylogenetic tree
Venom genes exhibited close kinship to
other venom genes from closely related
snake species
Pattern suggests venomous snakes
inherited genes for venom from common
ancestor, but gene was shaped differently
in each lineage
Crotamine searched for in all snakes and
vertebrae
Closest relative of crotamine is gene found
in pancreas of many snakes
Pigs, mice, & humans have closely related
defensins gene expressed in pancreas

Adaptation

To determine if a trait is an adaptation:
1. Determine the current utility of a trait
2. Demonstrate that individuals that possess the trait have higher fitness
3. Show that the trait evolved for the current purpose
Adaptation
Testing for adaptation
Keep in mind: not all traits are adaptations, and not all adaptations are “perfect”

 Observational studies - used when experiments are impractical
or inappropriate
 Experiments, including Experimental Evolution
 Comparative method - uses comparisons among species or
populations to test hypotheses about adaptation
Approaches to study adaptation

Adaptation
Observational study
 Used when experiments are impractical or inappropriate
 Identify trait of interest
 Identify traits utility to animal
 Identify traits effect on fitness
Lets test to see if a trait is an adaptation…
Example of adaptive hypothesis:
Giraffes have long necks because those with the longest necks are able to get the most food
and thus survive better
Trait of interest
Utility
Effect on fitness

Question: Why do giraffes have long necks?
Adaptive hypotheses:
1. Foraging
2. Male-male competition
Adaptation
Observational study

Does a long neck aid in foraging?
Explain how you would set up an experiment to test this
Experimental setup:
1.
2.
3.
Adaptation
Observational study
Identify comparable males
within a captive population.
Monitor feeding
Recorded feeding sessions
and expressed percent of
total bites by height
Result: most feeding is below neck Short and
long neck giraffes spend +95% of feeding
below head and +50% below neck.

Observation made: Head and
neck mass of males continues
to grow with age, while female
head/neck levels off.
Male Social Interactions
neck/head vs body % win
rel. big neck 64.6%
rel. small neck 4.7%
Male Female Social Interactions
neck/head vs body proportion (of N)
rel. big neck 61%
equal prop. 55%
rel. small neck 34%
Adaptation
Observational study

Case study 2: Shooting the poop

Shooting the Poop:
More than Good Housekeeping?
by
Kylee Grenis, Laurel C. Cepero, and Mayra C. Vidal
Department of Biological Sciences
University of Denver, Denver, CO
NATIONAL CENTER FOR CASE STUDY TEACHING IN SCIENCE

Epargyreus clarus
(Silver-spotted Skipper)
• Utilize three host plants
– All in pea family
• Build shelters in all
larval instars
– Use body length as ruler
– Silk ties
• Fling frass
4

Frass Flinging
Ballistic Defecation Video
47

Frass Flinging Distance
6
Source: Weiss, M. R. (2003). Good housekeeping: why do shelter-dwelling caterpillars fling their frass? Ecology Letters 6(4), 361–370. Used with permission of Wiley and Sons.

Why do caterpillars fling their
frass?
1. Come up with an adaptive hypothesis to explain
this behavior
2. How would you test this hypothesis?
7

Hygiene Hypothesis
8
Source: Weiss, M. R. (2003). Good housekeeping: Why do shelter-dwelling caterpillars fling their frass? Ecology Letters 6(4), 361–370. Used with permission of Wiley and Sons.

Crowding Hypothesis
9

Natural Enemies Hypothesis
10

Meet the Scientist
Dr. Martha R. Weiss
My research focuses on the role of
behavior, by both plants and
insects, in mediating interactions
among the two groups of
organisms. The sensory and
behavioral attributes of insects,
including vision, taste, smell, and
touch, as well as a capacity to learn
and remember, ultimately shape
the insects' ability to interact with
and exert selection on plants and on
other insects. Similarly, the active
behavior of plants allows them to
take advantage of insects' sensory
and behavioral capabilities.
11

Image Credits
• Slide 1
Description: Caterpillar cartoon.
Credit: Alice Vacca
Clearance: Licensed from Fotolia, ID#79041625.
• Slide 2 (left)
Description: Photo of dead caterpillar.
Credit: Teles
Source: Wikimedia Commons,
https://commons.wikimedia.org/wiki/File:Dead_caterpillar.JPG
Clearance: Public domain.
• Slide 2 (right)
Description: Photo of ants and caterpillar.
Credit: Paulo Oliveira
Clearance: Used with permission.
• Slide 2 (center)
Description: Photo of caterpillar on wet leaf.
Source: Wikimedia Commons,
https://commons.wikimedia.org/wiki/File:Dysphania_percota_caterpil
lar.jpg
Credit: AshLin
Clearance: Used in accordance with CC BY-SA 3.0.
• Slide 3 (left)
Description: Photo of shelter building silver spotted skipper.
Credit: Laurel C. Cepero, case author.
• Slide 3 (right, top)
Description: Photo of an opened oak leaf shelter.
Credit: Kylee Grenis, case author.
12
• Slide 3 (right, bottom)
Description: Photo of shelter building silver spotted
skipper.
• Slide 4
Description: Photo of Epargyraeus clarus adult
• Slide 5
Description: Image capture from video of frass
flinging.
Credit: Kylee Grenis, case author.
Source: https://youtu.be/hIwhUwXk4yo
• Slides 6, 8, 9 10
Description: Figures and tables from Weiss paper.
Credit: M.R. Weiss.
Source: Good housekeeping: Why do shelter-
dwelling caterpillars fling their frass? Ecology Letters
6(4), 361–370.
Clearance: Used with permission of Wiley and Sons.
• Slide 11
Description: Photo of Dr. Weiss.
Source: http://www.weisslab.org/people.html
Clearance: Used with permission.

The Origin of Species
Speciation events through out time

What defines a species?
2. Phenetic species concept: a species is a set of organisms that are
phenotypically similar and that look different from other sets of organisms.
3. Recognition species concept: a species is a set of organisms that can recognize
each other as potential mates.
A researcher’s choice of species concept often reflects his or her research focus. Making that
decision requires the scientist to commit to a species concept. For most purposes and for
communication with the general public, the biological species concept is used. Humans created
the concept of “species” for our own convenience.
1. The biological species concept defines a species as members of populations that
actually or potentially interbreed in nature, not according to similarity of
appearance.

What leads to speciation events?
 A key event in the evolution of a new species is the splitting in two of an original
population
 Reproductive barrier
 Geography, time, courtship, ecological, anatomical
 Reproductive barriers keep sexually reproducing species distinct
 Barriers are not fixed, but rather they can change
 The origin of a species is to a great extent, the origin of reproductive barriers

Types of speciation
Allopatric speciation, the most common form of speciation, occurs when populations of a
species become geographically isolated. When populations become separated, gene flow
between them ceases. Over time, the populations may become genetically different in response
to the natural selection imposed by their different environments.
Peripatric speciation, a sub-form of allopatric speciation, new species are formed in isolated,
smaller peripheral populations that are prevented from exchanging genes with the main
population.
Parapatric speciation is extremely rare. It occurs when populations are separated not by a
geographical barrier, such as a body of water, but by an extreme change in habitat. While
populations in these areas may interbreed, they often develop distinct characteristics and
lifestyles. Reproductive isolation in these cases is not geographic but rather temporal or
behavioral.
Sympatric speciation occurs when populations of a species that share the same habitat become
reproductively isolated from each other. This speciation phenomenon most commonly occurs
through polyploidy.

Reproducing speciation events in the lab
3-4 hours
50 flies
Artificial
reproductive
isolation
x16 generations
50 flies caught
in 10 minutes
Top and
bottom flying
flies mixed
Flies only
mated with
their own
breed!
If you accept the biological species concept, then a new species of flies was created in a lab
within only 16 generations. Required dramatic artificial selection (selecting first 50 flies) and
geographical barrier (separate cages)

Evidence of Evolution by Natural Selection - how basic evolutionary principals can lead to complex diversity.

Empfohlen

Empfohlen

Weitere ähnliche Inhalte

Was ist angesagt?

Was ist angesagt? (20)

Ähnlich wie Evidence of Evolution by Natural Selection - how basic evolutionary principals can lead to complex diversity.

Ähnlich wie Evidence of Evolution by Natural Selection - how basic evolutionary principals can lead to complex diversity. (20)

Kürzlich hochgeladen

Kürzlich hochgeladen (20)

Evidence of Evolution by Natural Selection - how basic evolutionary principals can lead to complex diversity.