SlideShare ist ein Scribd-Unternehmen logo
1 von 22
Human Genome Project Determine the entire sequence of the human genome. 3 billion base pairs Problem: It’s really big!
Genome Sequencing As of 6/ 25/ 04 1128 genome projects: 199  complete (includes 28 eukaryotes) 508  prokaryotic genomes in progress 421  eukaryotic genomes in progress smallest: archaebacterium  Nanoarchaeum equitans  500 kb Bacillus anthracis  (anthrax)  5228 kb S. cerivisiae  (yeast)  12,069 kb Arabidopsis thaliana  115,428 kb Drosophila melanogaster  (fruit fly)  137,000 kb Anopheles gambiae  (malaria mosquito)  278,000 kb Oryza sativa  (rice)  420,000 kb Mus musculus  (mouse)  2,493,000 kb Homo sapiens  (human)  2,900,000 kb http:// www. genomesonline. org/ 1980 -  $10/bp 2001 -  $0.1 / bp S. cerevisiae 200x H. sapiens 200x A. dubia
 
Human Genome Project timeline E. coli   Drosophila   C. elegans   Yeast NRC Recommends HGP U.S. HGP Begins 1990 1995 2000 Human Gene Map (16,000 genes) Human Gene Map (30,181 genes) Goal for Human  Genetic Map Exceeded Physical Map Covers 98% of Genome Pilot Human  Sequencing Begins Full-Scale Human  Sequencing Begins Human draft   Phil Hieter
Completion of the genome 4-5 coverage 9x coverage 99.99 % acc GenBank entries double every 18 months “ Working Draft”  “ Complete”
Completion of the genome The current genome sequence (Build 35) contains  2.85  billion nucleotides interrupted by only  341  gaps.  It covers approximately  99%  of the euchromatic genome and is accurate to an error rate of approximately  1 event per 100,000  bases. Human genome seems to encode only  20,000-25,000  protein-coding genes   International   Human   Genome   Sequencing   Consortium . Finishing the euchromatic sequence of the human genome. Nature  2004  Oct 21;431(7011):931-45.
Institutes  that produced 85 % of the sequence 1. Whitehead Institute for Biomedical Research , Center for Genome  Research, Cambridge, MA 2.  The Sanger Centre , Cambridge, UK 3.  Washington University Genome Sequencing Center , St. Louis, MI 4.  US Department of Energy , JGI, Walnut Creek, CA 5.  Baylor College of Medicine Human Genome Sequencing Center ,  Houston, TX Countries: USA, UK, Japan, Germany, China, France
Genome Sequencing Genome: 3 Gb Cut genome into large pieces Clone into BACs: 100 kb Order based on sequence features ( markers ) = mapping Cut again Sequence AGAACAGGACGTATGTGGT TGTGGTTTTCTACTCC CTACTCCTGTGTT TTGTAAGTGAGAACA Assemble each BAC … TTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTT… Assemble entire sequence
 
 
 
What does the sequence mean? TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGTCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACATACAAAATAATACCTCAGTGTAACCTCTGTTTGTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGTTATTCATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTTTCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTTTCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATATTCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGTCATAATTTTATCTTTTATATACATTGATATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATGAAAAGCCTTTCCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATACCTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTCTAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTTTATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGATGATTTTTGATTGGAAATACATTAAATCTATAAGCCAAATTGGAGATTATTGATATATTAACAAAAATGAGTTTTCCAGTCCATGAATGTATGCACATTATAAAATTCATTCTTAAGTATGTCATTTTTTAAGTTTTAGTTTCAGCAGTATATGTTTGTTACATAGGTAAACTCCTGTCATGGGGGTTAGTTGTACAGGTTATTTTATCATCCAGGCATAAAGCCCAGTACCCAGTAGTTATCTTTTCTGCTCCTCTCCCTCCTGTCACCCTCCACTCTCAAGTAGACCCCAGTTTCTGTTGTTCTCTTCTTTGCATTAATGACTTCTCATCATTTAGATTGCACTTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTTAGTTTGCTAAGGATAACCACCTCCATCTCCATCCATGTTCCCACAAAAGACATGATCTCCTTTTTTATGGCTGCATATTATTCCATGGTATATATGTACCACATTTTCTTTATCCAATCTGTCATTGATGGACATTTAGGTTGTTTCCACATCATTGCCGTTGTAAATACTGCTGCAGTGAATATTCGTGTGTATGTCTTTATGGTAGAATGATTTATATTCCTCTGGGTATATTTCCAAGTAATGGGATGGTTGGGTCAAATGGTAATTCTGCTTTTAGCTTTTTGAGGAATTGCCATATTGCCTTTCACAACGGTTGAACTAATTTATACTCCCAAGAGTGTATAAGTTGTTCCTTTTTCTCTGCAACCTCGACATCACCTGTTATTTATGACTTTTATATAATAGCCATTCTGCTGGTCTGAGATGGTATCTCATTATGATTTTGATTTGCATTTCTCTAATGCTCAGTGATATTGAGCTTGGCTGCATATATGTCTTCTTTTAAAAATATCTGTTCATGTCCTTTGCCTAATTTATAACGGGGTTGTTTGTTTTTCTCTTGTAAATTTGTTTAAGTTCCTTATAGATTCTAGGTATTAAACCTTTTTTCAGAGGCGTGGCTTGCAAATATTTTCTCCCATTCTATAGGTTGTCTGTTTATTCTGTTGATAGTTTCCCTTGCTGTGCAGAAGCTCTTAACTTTAATTAGATCCGACTTGTCAATTTTTGCTTTGGTCGCAATTGCTTTTGATGTTATTGTCGTGAAATCTTTGCTAGTTCTTAGGTCCAGGATGATATTGCCCAAGTTGTCTTCCAGGGCTTTTATAATTTTGGATTTTACATTTAAGTCTTAATATATTTATTAAATTTGTTAGGGTTTCAGGATACAAGGACAATATAGCAGCAAACAATGTAAAAGTAAAATCTGAAAAATAATAGAAAACAGTTTAATTGAACACTTTACCATTATGTAATGCCCTTCTTTGTCTTTCCTGATCTTTGTTGGTTTGAAGTTCAAAAAAGACAAACTTAATGGTACAATAGGTATTGTAGATTTCAGGACTTTCTGTATAAAATATTTTGTATATATGAATAGATCATTTTTTATTTCCAGTCTTTAAACATTTTCTTAACATTTTCTTCTATTGCTTCACTTCACTCGCTAGGACCATCAGGACAGTGTTGAACAGAAATTGTCAGACTGATCATCACAACTTTTTCTAGATTTTAGAAGGAAATTTTTCTTTATTTCAACATAAAGCAGCATGTTAATGCCAAGTTTTAATATGTGTTATCAGATTGAAATTTTTTTGTATATTTCTACATTACCAAGAATTTTTAGCAAGAGTTTTTGTTGAGTTTTAATTTAAAAATCATTTGTTAATTTCATCTGATTTTTTTATTTCTCTTTTTACCTTAAGAGATTAAACTGACTACAGATTGAATATAAACAAACAAACAAACAAACAAAAACTCTAAAATGCTGTGGATCAACACCACTTAGTAATTTGTATACTTGGATTCAATTTGCTGAAATTTTGTTAGACATTTTTGCGTCGATATTTATGAGGGATGTTGATCTGTAAAAGTATTAAAATGCCTTTGACAGATTTTGATAGCAGTGTTATTCTGGCCTAATAAATCAAACTGAGGTATGATCCTTCCTTTTCTATTTCTTAATAGCATTTTTAAAATTGGTGGTTTTTTCCTTCCTTAGTGAAATTTACCAGCAAAGTAACAGGCCTTATATTTCTCTTGTGGAAATATTTTAATTTCAAATTAATGGTATTTTGTTCTTGTAGGGTGGTAATTTTCTCTGTGTTTGGTCTTAATGGACTCTTAGCTGATCACCCAGTTACTCAGCGAGGTCTCTTCACTCTGGAAGAGCTGGAACTCCAGTGTGTTTTAGTGCAGCATGACCACGGGTATTACCGTTCAACATTTAGGCTTTATCAGTGATAACTATTTGTCCTCATGGAGTTTTTGCCGCTGGGCCTACACAGTTTAGGCTTCAGCTTAGAACACATAATGAATTCTTATGCAGATTTCTGCCCACCTTTGACCTTTCATGATTTCCTCTTCTTGGGTAAGCTGCCTTATTAATCTGATACACTTCAGCAGTCCAGAACTACACTCTTTCCCTTCTCTGCTCTTGGAGATGACTCTTTTGTCTGAGATTCACTTTGCTGTGCTGAAAAAGAAAAGTGCTTCAAGGAAGATACCAAGGAAAATCACAGGGCTCATTTATGTATTTCTCTTCTTTCAAGGACTACAGCTTTGTGTTGCCTATGTTCAATTTCTGAAAATAATTAGAGCATATATACTCTGTGTGAGAAGGCAAATCCAGACAGTTAGTTTGTATGACTAGAAGCAGAAGTCTACATGGAGAATTTTACTTAACTGTGTTATAGTTTCTTTAATTATTTCAAGAGTATGTTTAATGTTCCACAGATCTCATTCTATAAATCTTTATCATCTTAGAGCTCTGATACTATTTAGAATTACTATTCCTTCAAATAAGAGATTAGAAACAGGGTTATATTTGGGGTAGGTTGACTTACTTTTCTGGGAACCAAAGCATATTAAATTGACCAGTTTTAACACACTTCTATGTATGCACAAAGATATATATTTACATTCTGCAAAATCATTCTTTCCTTTTTGAATTTGAAAAGGATCTTTGGTATACAGATATTCAATAGCCAGCCTGAAGATTCATTTGAATTCATTTAATGTTTAGATTCACTACATGAAATGATCCAGAAGAGAGTACTCAAATATAAGTATCTATAACGATGGAAATATACATCTCCACTGCCCAAGATGGTAGTCATGAGTCAATATTGATCATGTGAGACGTGGCAAGTGTTACTCAGGGTCTCAATATTTAAATGTATTAAGCTTTAATTAATGTAAATTTGAATTTAGCAAAACATGTATAGCTTGTGGTTACTGTTTTATTCAGTGCCAATATAGAACATTTCCATGATTACAGAAAGTTATCTTAGAATACTCAGTTCTGGACTATTTTATCTGGCTAAATTAAATGTTAAAATATTACAAATTCATCTTCAGGCTGGCTGTTGAATATTTTTATAGCAAAAGTCATTTATAAATTTAAAACTCAAATAATTATCTTTTTCAATATGTAAAATATGTCTTTACATATTCTACTCCCTTCTTACATACATATTCTGATGTAACATAGGTATTCTCTTATTCATGCACACTGAAATGACAACATAAATAATTTTACTAAGTGTCACCATATAAAAAACTTTGAACAAAATCAGATTATATCACTGTGGATATTTCTATTTTGAACTAACTTAGATGATAATTTTAATCTATATCCTAGATGAACTTTAAATCAATAAAATCTCTCAATGGTGTTATAAATCTCAAGCCATTAGCCACTGATTATCCCATTTTTATTCTTTTCATATTAATTTTATTGCCATGTATGAATGCTGTAGCATCCATGTTTAAATACTAGTTAACAAAATGCACTGGCATCAGATACAATAAGGATGAAATGAGATATAATTAGGACTCTGGTAACACACATAAAATTGGAAAGATACCCTGAAATTCAAGCCAAGAAGATATTTATCCAGCTTATTTTATTTTGAGACAGAGTCTTGCTCTCTCACTCAGGCTGGAGTGCAGTGGACCATTCTAGGCTCGCTCCAACCTCTGTCTCCCAAATTGAAGTAATTCTCGTGCCTCAATCTCCCGAGTAGCTGGGATTACAGGCATGTGTCACCAAGCCTGGCTGATTTTTGTAGTTTTAGTAGAGACGGGGTTTCACCATGATGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAGTGACTGGAACACCTCGGCCTCCTAAAGTGCTGGGATTACAGACGAGAGCCACTGAACAGCTTTGATCCAACTTATTTGGATGAATGAGTTACATATTTTACATTAAATCTGTTATTGTGATAATTCTTCATGTTATTTTCCATGTATAGATTTATATATAATGTAATTTTAATTTTTTTTCACCGGAGAGTATAAACAACAATTATTTTATAAACAGGATAATAAAAATAAGACAAAAATTGTTGAAATGTCTTCATTTGACTACTAACTTTTTACATGTTTGTTACTTTGAAGCTGTTATCAATACTTGTGATGTATTACAATTAAGTAAAGATTTAAAGATGCCATTTTTAACTTATTATGACACAAAGTCTATAAATTCTTATATTTTGAGATTTGTATTTAAATAACTTGTGAAATTTAATTTTAAAATAAAATTTCTTCTATGGATTGGTCTTCAATCGAGGCATAAAAAGGAATATAACAGTGTGGCACTATAACTTCTATATTGAATTTCTATATTATTTAACACAATTATAATTTTGCTAATGAATTGTAATGTTTTTAAAAAGCTAGGTGAATTTTATTAAATTCATTACATGGCGATAACACAGAGAAAACATTTTGGGGATTCTTTTAAAATGGTATGTACAAAAGCTTAAAAGTTGTTATGTAGTGGCAGAGATAAAAAAGTAAAACAAAAAAAAGCTTAAAAGTTTGCTTTACTATTTATAGGCTCATAAGTGTAAGTGTGCCAGAAAATGAAAAAGAAAGGAGAGAAATTATAAATAACTGTGTGGAAAACACAGATAAAGCATAAAGATAGAATATAAAGATAGAAGCATTTTAATATGAGGCAGTGATGGCTTTTTGAAGAATCCCAACTAAGGACCTACTTTTAGTTAATAAATAATATGTTTCTAATCCCTATATTGTCCACAGCAACCTTTTTAGGACATGGAGCAGTGACTATGAGTGCCAGAAGGCAAGAGTAGAAGCAATTGTAAAATCATGAACACTAGTTTGTAAAATCCTCACTGAGATATAATATCTGTTTGCCTCTACCTTAGAATTATTAATGTCTTGAGGGCTGGGA A very small piece of chromosome 21
 
What’s in a genome? Genes   (i. e., protein coding) But. . . only <2% of the human genome encodes proteins Other than protein coding genes, what is there? •  genes for noncoding RNAs (rRNA, tRNA, miRNAs, etc.) •  structural sequences (scaffold attachment regions) R egulatory sequences • “ junk” (including transposons, retroviral insertions, etc.)
 
 
 
Genome overview ,[object Object],[object Object],[object Object],[object Object],[object Object]
Application to Medicine and Biology ,[object Object],[object Object],[object Object],[object Object]
The next steps ,[object Object],[object Object],[object Object],[object Object]
Chimpanzee   Sequencing   and   Analysis   Consortium .  Initial sequence of the chimpanzee genome and comparison with the human genome.   Nature  2005  Sep 1;437(7055):69-87.  Thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements.  98,6  % identitity to human genome sequence Differences in gene/exon structures
Apparent differences between humans and great apes in the incidence or severity   of medically important conditions (excluding differences explained by obvious anatomical   differences ). Medical Condition  Humans  Great Apes Definite HIV progression to AIDS  Common  Very rare Influenza A symptomatology  Moderate to severe  Mild Hepatitis B/C late complications  Moderate to severe  Mild P. falciparum  malaria  Susceptible  Resistant Menopause  Universal  Rare Likely E. coli  K99 gastroenteritis  Resistant  Sensitive? Alzheimer’s disease pathology  Complete  Incomplete Coronary atherosclerosis  Common  Uncommon Epithelial cancers  Common  Rare

Weitere ähnliche Inhalte

Was ist angesagt? (20)

Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
encode project
encode project encode project
encode project
 
HGP, the human genome project
HGP, the human genome projectHGP, the human genome project
HGP, the human genome project
 
The Human Genome Project
The Human Genome Project The Human Genome Project
The Human Genome Project
 
Bioinformatics lecture 1
Bioinformatics lecture 1Bioinformatics lecture 1
Bioinformatics lecture 1
 
Human genome project by M.Sohail Riaz Hashmi
Human genome project by M.Sohail Riaz HashmiHuman genome project by M.Sohail Riaz Hashmi
Human genome project by M.Sohail Riaz Hashmi
 
Protein micro array
Protein micro arrayProtein micro array
Protein micro array
 
Functional genomics, and tools
Functional genomics, and toolsFunctional genomics, and tools
Functional genomics, and tools
 
Databases pathways of genomics and proteomics
Databases pathways of genomics and proteomics Databases pathways of genomics and proteomics
Databases pathways of genomics and proteomics
 
Human genome project - Decoding the codes of life
Human genome project - Decoding the codes of lifeHuman genome project - Decoding the codes of life
Human genome project - Decoding the codes of life
 
Microarray
MicroarrayMicroarray
Microarray
 
Genes, Genomics and Proteomics
Genes, Genomics and Proteomics Genes, Genomics and Proteomics
Genes, Genomics and Proteomics
 
Genomics
GenomicsGenomics
Genomics
 
Omics era
Omics eraOmics era
Omics era
 
Ncbi
NcbiNcbi
Ncbi
 
Genomics(functional genomics)
Genomics(functional genomics)Genomics(functional genomics)
Genomics(functional genomics)
 
Genomics
GenomicsGenomics
Genomics
 
Kegg
KeggKegg
Kegg
 
Single Nucleotide Polymorphism (SNP)
Single Nucleotide Polymorphism (SNP)Single Nucleotide Polymorphism (SNP)
Single Nucleotide Polymorphism (SNP)
 

Andere mochten auch

MT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomesMT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomesDell EMC World
 
The Human Genome Project - Part II
The Human Genome Project - Part IIThe Human Genome Project - Part II
The Human Genome Project - Part IIhhalhaddad
 
Cracking the code of life
Cracking the code of lifeCracking the code of life
Cracking the code of lifegmtrainor3
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part Ihhalhaddad
 
Human genome project 2007
Human genome project 2007Human genome project 2007
Human genome project 2007Hesham Gaber
 
The human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duffThe human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duffguest73a974
 
The Human Genome Project - Part III
The Human Genome Project - Part IIIThe Human Genome Project - Part III
The Human Genome Project - Part IIIhhalhaddad
 
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...Institut Pasteur de Madagascar
 

Andere mochten auch (11)

Human genome project ()
Human genome project ()Human genome project ()
Human genome project ()
 
MT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomesMT115 Precision Medicine: Integrating genomics to enable better patient outcomes
MT115 Precision Medicine: Integrating genomics to enable better patient outcomes
 
Ammonia
AmmoniaAmmonia
Ammonia
 
Human Genome
Human Genome Human Genome
Human Genome
 
The Human Genome Project - Part II
The Human Genome Project - Part IIThe Human Genome Project - Part II
The Human Genome Project - Part II
 
Cracking the code of life
Cracking the code of lifeCracking the code of life
Cracking the code of life
 
The Human Genome Project - Part I
The Human Genome Project - Part IThe Human Genome Project - Part I
The Human Genome Project - Part I
 
Human genome project 2007
Human genome project 2007Human genome project 2007
Human genome project 2007
 
The human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duffThe human genome project vlad mike mike leo duff
The human genome project vlad mike mike leo duff
 
The Human Genome Project - Part III
The Human Genome Project - Part IIIThe Human Genome Project - Part III
The Human Genome Project - Part III
 
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
Comment procéder pour traquer les marqueurs génétiques de résistance aux arte...
 

Ähnlich wie L14 human genome

Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative GenomicsMicrobial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative GenomicsJonathan Eisen
 
Real-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerReal-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerJoe Parker
 
Human genome project
Human genome projectHuman genome project
Human genome projectDilip jaipal
 
2014 whitney-research
2014 whitney-research2014 whitney-research
2014 whitney-researchc.titus.brown
 
Genome sequencing
Genome sequencingGenome sequencing
Genome sequencingShital Pal
 
Beiko dcsi2013
Beiko dcsi2013Beiko dcsi2013
Beiko dcsi2013beiko
 
Human genome project
Human genome projectHuman genome project
Human genome projectShital Pal
 
Human genome project (2) converted
Human genome project (2) convertedHuman genome project (2) converted
Human genome project (2) convertedGAnchal
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics finalRainu Rajeev
 
Human genome project
Human genome projectHuman genome project
Human genome projectRakesh R
 
Unilag workshop complex genome analysis
Unilag workshop   complex genome analysisUnilag workshop   complex genome analysis
Unilag workshop complex genome analysisDr. Olusoji Adewumi
 
Clase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdfClase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdfNoraCRuizGuevara
 
Marzillier_09052014.pdf
Marzillier_09052014.pdfMarzillier_09052014.pdf
Marzillier_09052014.pdf7006ASWATHIRR
 

Ähnlich wie L14 human genome (20)

Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative GenomicsMicrobial Phylogenomics (EVE161) Class 13 - Comparative Genomics
Microbial Phylogenomics (EVE161) Class 13 - Comparative Genomics
 
THE human genome
THE human genomeTHE human genome
THE human genome
 
Real-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe ParkerReal-time Phylogenomics: Joe Parker
Real-time Phylogenomics: Joe Parker
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Introduction to 16S Microbiome Analysis
Introduction to 16S Microbiome AnalysisIntroduction to 16S Microbiome Analysis
Introduction to 16S Microbiome Analysis
 
Lecture 1,2
Lecture 1,2Lecture 1,2
Lecture 1,2
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
2014 whitney-research
2014 whitney-research2014 whitney-research
2014 whitney-research
 
Genome sequencing
Genome sequencingGenome sequencing
Genome sequencing
 
Beiko dcsi2013
Beiko dcsi2013Beiko dcsi2013
Beiko dcsi2013
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human genome project (2) converted
Human genome project (2) convertedHuman genome project (2) converted
Human genome project (2) converted
 
bai2
bai2bai2
bai2
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics final
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human encodeproject
Human encodeprojectHuman encodeproject
Human encodeproject
 
Unilag workshop complex genome analysis
Unilag workshop   complex genome analysisUnilag workshop   complex genome analysis
Unilag workshop complex genome analysis
 
Clase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdfClase 2 - Genoma Humano proyecto conicet.pdf
Clase 2 - Genoma Humano proyecto conicet.pdf
 
Marzillier_09052014.pdf
Marzillier_09052014.pdfMarzillier_09052014.pdf
Marzillier_09052014.pdf
 
Genome project.pdf
Genome project.pdfGenome project.pdf
Genome project.pdf
 

Mehr von MUBOSScz

Neuroscience sofia ultimo2
Neuroscience sofia ultimo2Neuroscience sofia ultimo2
Neuroscience sofia ultimo2MUBOSScz
 
BIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERSBIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERSMUBOSScz
 
Captain’s role
Captain’s roleCaptain’s role
Captain’s roleMUBOSScz
 
Tooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestineTooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestineMUBOSScz
 
Respiratory syst copy
Respiratory syst   copyRespiratory syst   copy
Respiratory syst copyMUBOSScz
 
Practicals 3 digestive system iii
Practicals 3   digestive system iiiPracticals 3   digestive system iii
Practicals 3 digestive system iiiMUBOSScz
 
Epithelium copy
Epithelium   copyEpithelium   copy
Epithelium copyMUBOSScz
 
Cytology copy
Cytology   copyCytology   copy
Cytology copyMUBOSScz
 
Connective tissue proper copy
Connective tissue proper   copyConnective tissue proper   copy
Connective tissue proper copyMUBOSScz
 
Cartilage, bone copy
Cartilage, bone   copyCartilage, bone   copy
Cartilage, bone copyMUBOSScz
 
Cardiovascular system copy
Cardiovascular system   copyCardiovascular system   copy
Cardiovascular system copyMUBOSScz
 
Bone, cartilage copy
Bone, cartilage   copyBone, cartilage   copy
Bone, cartilage copyMUBOSScz
 
Blood development copy
Blood development   copyBlood development   copy
Blood development copyMUBOSScz
 
Tissue processing
Tissue processingTissue processing
Tissue processingMUBOSScz
 
Section a dermatology
Section a dermatologySection a dermatology
Section a dermatologyMUBOSScz
 
Oncology section a
Oncology section aOncology section a
Oncology section aMUBOSScz
 
Section b dermatology
Section b dermatologySection b dermatology
Section b dermatologyMUBOSScz
 
Working and training in the national health service a guide for im gs final
Working and training in the national health service   a guide for im gs finalWorking and training in the national health service   a guide for im gs final
Working and training in the national health service a guide for im gs finalMUBOSScz
 
Histology slide guide
Histology slide guideHistology slide guide
Histology slide guideMUBOSScz
 

Mehr von MUBOSScz (20)

Neuroscience sofia ultimo2
Neuroscience sofia ultimo2Neuroscience sofia ultimo2
Neuroscience sofia ultimo2
 
BIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERSBIOCHEMISTRY II EXAM ANSWERS
BIOCHEMISTRY II EXAM ANSWERS
 
Cz uk
Cz ukCz uk
Cz uk
 
Captain’s role
Captain’s roleCaptain’s role
Captain’s role
 
Tooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestineTooth, esophagus, stomach, small intestine
Tooth, esophagus, stomach, small intestine
 
Respiratory syst copy
Respiratory syst   copyRespiratory syst   copy
Respiratory syst copy
 
Practicals 3 digestive system iii
Practicals 3   digestive system iiiPracticals 3   digestive system iii
Practicals 3 digestive system iii
 
Epithelium copy
Epithelium   copyEpithelium   copy
Epithelium copy
 
Cytology copy
Cytology   copyCytology   copy
Cytology copy
 
Connective tissue proper copy
Connective tissue proper   copyConnective tissue proper   copy
Connective tissue proper copy
 
Cartilage, bone copy
Cartilage, bone   copyCartilage, bone   copy
Cartilage, bone copy
 
Cardiovascular system copy
Cardiovascular system   copyCardiovascular system   copy
Cardiovascular system copy
 
Bone, cartilage copy
Bone, cartilage   copyBone, cartilage   copy
Bone, cartilage copy
 
Blood development copy
Blood development   copyBlood development   copy
Blood development copy
 
Tissue processing
Tissue processingTissue processing
Tissue processing
 
Section a dermatology
Section a dermatologySection a dermatology
Section a dermatology
 
Oncology section a
Oncology section aOncology section a
Oncology section a
 
Section b dermatology
Section b dermatologySection b dermatology
Section b dermatology
 
Working and training in the national health service a guide for im gs final
Working and training in the national health service   a guide for im gs finalWorking and training in the national health service   a guide for im gs final
Working and training in the national health service a guide for im gs final
 
Histology slide guide
Histology slide guideHistology slide guide
Histology slide guide
 

Kürzlich hochgeladen

Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWEREMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWERMadyBayot
 
"I see eyes in my soup": How Delivery Hero implemented the safety system for ...
"I see eyes in my soup": How Delivery Hero implemented the safety system for ..."I see eyes in my soup": How Delivery Hero implemented the safety system for ...
"I see eyes in my soup": How Delivery Hero implemented the safety system for ...Zilliz
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...apidays
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024The Digital Insurer
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century educationjfdjdjcjdnsjd
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoffsammart93
 
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...apidays
 
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu SubbuApidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbuapidays
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Miguel Araújo
 
AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024The Digital Insurer
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyKhushali Kathiriya
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...apidays
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxRustici Software
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native ApplicationsWSO2
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAndrey Devyatkin
 

Kürzlich hochgeladen (20)

Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWEREMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
EMPOWERMENT TECHNOLOGY GRADE 11 QUARTER 2 REVIEWER
 
"I see eyes in my soup": How Delivery Hero implemented the safety system for ...
"I see eyes in my soup": How Delivery Hero implemented the safety system for ..."I see eyes in my soup": How Delivery Hero implemented the safety system for ...
"I see eyes in my soup": How Delivery Hero implemented the safety system for ...
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot TakeoffStrategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
 
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
 
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu SubbuApidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : Uncertainty
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptx
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native Applications
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
 

L14 human genome

  • 1. Human Genome Project Determine the entire sequence of the human genome. 3 billion base pairs Problem: It’s really big!
  • 2. Genome Sequencing As of 6/ 25/ 04 1128 genome projects: 199 complete (includes 28 eukaryotes) 508 prokaryotic genomes in progress 421 eukaryotic genomes in progress smallest: archaebacterium Nanoarchaeum equitans 500 kb Bacillus anthracis (anthrax) 5228 kb S. cerivisiae (yeast) 12,069 kb Arabidopsis thaliana 115,428 kb Drosophila melanogaster (fruit fly) 137,000 kb Anopheles gambiae (malaria mosquito) 278,000 kb Oryza sativa (rice) 420,000 kb Mus musculus (mouse) 2,493,000 kb Homo sapiens (human) 2,900,000 kb http:// www. genomesonline. org/ 1980 - $10/bp 2001 - $0.1 / bp S. cerevisiae 200x H. sapiens 200x A. dubia
  • 3.  
  • 4. Human Genome Project timeline E. coli Drosophila C. elegans Yeast NRC Recommends HGP U.S. HGP Begins 1990 1995 2000 Human Gene Map (16,000 genes) Human Gene Map (30,181 genes) Goal for Human Genetic Map Exceeded Physical Map Covers 98% of Genome Pilot Human Sequencing Begins Full-Scale Human Sequencing Begins Human draft Phil Hieter
  • 5. Completion of the genome 4-5 coverage 9x coverage 99.99 % acc GenBank entries double every 18 months “ Working Draft” “ Complete”
  • 6. Completion of the genome The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers approximately 99% of the euchromatic genome and is accurate to an error rate of approximately 1 event per 100,000 bases. Human genome seems to encode only 20,000-25,000 protein-coding genes International Human Genome Sequencing Consortium . Finishing the euchromatic sequence of the human genome. Nature 2004 Oct 21;431(7011):931-45.
  • 7. Institutes that produced 85 % of the sequence 1. Whitehead Institute for Biomedical Research , Center for Genome Research, Cambridge, MA 2. The Sanger Centre , Cambridge, UK 3. Washington University Genome Sequencing Center , St. Louis, MI 4. US Department of Energy , JGI, Walnut Creek, CA 5. Baylor College of Medicine Human Genome Sequencing Center , Houston, TX Countries: USA, UK, Japan, Germany, China, France
  • 8. Genome Sequencing Genome: 3 Gb Cut genome into large pieces Clone into BACs: 100 kb Order based on sequence features ( markers ) = mapping Cut again Sequence AGAACAGGACGTATGTGGT TGTGGTTTTCTACTCC CTACTCCTGTGTT TTGTAAGTGAGAACA Assemble each BAC … TTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTT… Assemble entire sequence
  • 9.  
  • 10.  
  • 11.  
  • 12. What does the sequence mean? TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTAATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGTCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATATATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACATACAAAATAATACCTCAGTGTAACCTCTGTTTGTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGTTATTCATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTTTCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTTTCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATATTCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGTCATAATTTTATCTTTTATATACATTGATATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATGAAAAGCCTTTCCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATACCTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTCTAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTTTATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGATGATTTTTGATTGGAAATACATTAAATCTATAAGCCAAATTGGAGATTATTGATATATTAACAAAAATGAGTTTTCCAGTCCATGAATGTATGCACATTATAAAATTCATTCTTAAGTATGTCATTTTTTAAGTTTTAGTTTCAGCAGTATATGTTTGTTACATAGGTAAACTCCTGTCATGGGGGTTAGTTGTACAGGTTATTTTATCATCCAGGCATAAAGCCCAGTACCCAGTAGTTATCTTTTCTGCTCCTCTCCCTCCTGTCACCCTCCACTCTCAAGTAGACCCCAGTTTCTGTTGTTCTCTTCTTTGCATTAATGACTTCTCATCATTTAGATTGCACTTGTAAGTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTTAGTTTGCTAAGGATAACCACCTCCATCTCCATCCATGTTCCCACAAAAGACATGATCTCCTTTTTTATGGCTGCATATTATTCCATGGTATATATGTACCACATTTTCTTTATCCAATCTGTCATTGATGGACATTTAGGTTGTTTCCACATCATTGCCGTTGTAAATACTGCTGCAGTGAATATTCGTGTGTATGTCTTTATGGTAGAATGATTTATATTCCTCTGGGTATATTTCCAAGTAATGGGATGGTTGGGTCAAATGGTAATTCTGCTTTTAGCTTTTTGAGGAATTGCCATATTGCCTTTCACAACGGTTGAACTAATTTATACTCCCAAGAGTGTATAAGTTGTTCCTTTTTCTCTGCAACCTCGACATCACCTGTTATTTATGACTTTTATATAATAGCCATTCTGCTGGTCTGAGATGGTATCTCATTATGATTTTGATTTGCATTTCTCTAATGCTCAGTGATATTGAGCTTGGCTGCATATATGTCTTCTTTTAAAAATATCTGTTCATGTCCTTTGCCTAATTTATAACGGGGTTGTTTGTTTTTCTCTTGTAAATTTGTTTAAGTTCCTTATAGATTCTAGGTATTAAACCTTTTTTCAGAGGCGTGGCTTGCAAATATTTTCTCCCATTCTATAGGTTGTCTGTTTATTCTGTTGATAGTTTCCCTTGCTGTGCAGAAGCTCTTAACTTTAATTAGATCCGACTTGTCAATTTTTGCTTTGGTCGCAATTGCTTTTGATGTTATTGTCGTGAAATCTTTGCTAGTTCTTAGGTCCAGGATGATATTGCCCAAGTTGTCTTCCAGGGCTTTTATAATTTTGGATTTTACATTTAAGTCTTAATATATTTATTAAATTTGTTAGGGTTTCAGGATACAAGGACAATATAGCAGCAAACAATGTAAAAGTAAAATCTGAAAAATAATAGAAAACAGTTTAATTGAACACTTTACCATTATGTAATGCCCTTCTTTGTCTTTCCTGATCTTTGTTGGTTTGAAGTTCAAAAAAGACAAACTTAATGGTACAATAGGTATTGTAGATTTCAGGACTTTCTGTATAAAATATTTTGTATATATGAATAGATCATTTTTTATTTCCAGTCTTTAAACATTTTCTTAACATTTTCTTCTATTGCTTCACTTCACTCGCTAGGACCATCAGGACAGTGTTGAACAGAAATTGTCAGACTGATCATCACAACTTTTTCTAGATTTTAGAAGGAAATTTTTCTTTATTTCAACATAAAGCAGCATGTTAATGCCAAGTTTTAATATGTGTTATCAGATTGAAATTTTTTTGTATATTTCTACATTACCAAGAATTTTTAGCAAGAGTTTTTGTTGAGTTTTAATTTAAAAATCATTTGTTAATTTCATCTGATTTTTTTATTTCTCTTTTTACCTTAAGAGATTAAACTGACTACAGATTGAATATAAACAAACAAACAAACAAACAAAAACTCTAAAATGCTGTGGATCAACACCACTTAGTAATTTGTATACTTGGATTCAATTTGCTGAAATTTTGTTAGACATTTTTGCGTCGATATTTATGAGGGATGTTGATCTGTAAAAGTATTAAAATGCCTTTGACAGATTTTGATAGCAGTGTTATTCTGGCCTAATAAATCAAACTGAGGTATGATCCTTCCTTTTCTATTTCTTAATAGCATTTTTAAAATTGGTGGTTTTTTCCTTCCTTAGTGAAATTTACCAGCAAAGTAACAGGCCTTATATTTCTCTTGTGGAAATATTTTAATTTCAAATTAATGGTATTTTGTTCTTGTAGGGTGGTAATTTTCTCTGTGTTTGGTCTTAATGGACTCTTAGCTGATCACCCAGTTACTCAGCGAGGTCTCTTCACTCTGGAAGAGCTGGAACTCCAGTGTGTTTTAGTGCAGCATGACCACGGGTATTACCGTTCAACATTTAGGCTTTATCAGTGATAACTATTTGTCCTCATGGAGTTTTTGCCGCTGGGCCTACACAGTTTAGGCTTCAGCTTAGAACACATAATGAATTCTTATGCAGATTTCTGCCCACCTTTGACCTTTCATGATTTCCTCTTCTTGGGTAAGCTGCCTTATTAATCTGATACACTTCAGCAGTCCAGAACTACACTCTTTCCCTTCTCTGCTCTTGGAGATGACTCTTTTGTCTGAGATTCACTTTGCTGTGCTGAAAAAGAAAAGTGCTTCAAGGAAGATACCAAGGAAAATCACAGGGCTCATTTATGTATTTCTCTTCTTTCAAGGACTACAGCTTTGTGTTGCCTATGTTCAATTTCTGAAAATAATTAGAGCATATATACTCTGTGTGAGAAGGCAAATCCAGACAGTTAGTTTGTATGACTAGAAGCAGAAGTCTACATGGAGAATTTTACTTAACTGTGTTATAGTTTCTTTAATTATTTCAAGAGTATGTTTAATGTTCCACAGATCTCATTCTATAAATCTTTATCATCTTAGAGCTCTGATACTATTTAGAATTACTATTCCTTCAAATAAGAGATTAGAAACAGGGTTATATTTGGGGTAGGTTGACTTACTTTTCTGGGAACCAAAGCATATTAAATTGACCAGTTTTAACACACTTCTATGTATGCACAAAGATATATATTTACATTCTGCAAAATCATTCTTTCCTTTTTGAATTTGAAAAGGATCTTTGGTATACAGATATTCAATAGCCAGCCTGAAGATTCATTTGAATTCATTTAATGTTTAGATTCACTACATGAAATGATCCAGAAGAGAGTACTCAAATATAAGTATCTATAACGATGGAAATATACATCTCCACTGCCCAAGATGGTAGTCATGAGTCAATATTGATCATGTGAGACGTGGCAAGTGTTACTCAGGGTCTCAATATTTAAATGTATTAAGCTTTAATTAATGTAAATTTGAATTTAGCAAAACATGTATAGCTTGTGGTTACTGTTTTATTCAGTGCCAATATAGAACATTTCCATGATTACAGAAAGTTATCTTAGAATACTCAGTTCTGGACTATTTTATCTGGCTAAATTAAATGTTAAAATATTACAAATTCATCTTCAGGCTGGCTGTTGAATATTTTTATAGCAAAAGTCATTTATAAATTTAAAACTCAAATAATTATCTTTTTCAATATGTAAAATATGTCTTTACATATTCTACTCCCTTCTTACATACATATTCTGATGTAACATAGGTATTCTCTTATTCATGCACACTGAAATGACAACATAAATAATTTTACTAAGTGTCACCATATAAAAAACTTTGAACAAAATCAGATTATATCACTGTGGATATTTCTATTTTGAACTAACTTAGATGATAATTTTAATCTATATCCTAGATGAACTTTAAATCAATAAAATCTCTCAATGGTGTTATAAATCTCAAGCCATTAGCCACTGATTATCCCATTTTTATTCTTTTCATATTAATTTTATTGCCATGTATGAATGCTGTAGCATCCATGTTTAAATACTAGTTAACAAAATGCACTGGCATCAGATACAATAAGGATGAAATGAGATATAATTAGGACTCTGGTAACACACATAAAATTGGAAAGATACCCTGAAATTCAAGCCAAGAAGATATTTATCCAGCTTATTTTATTTTGAGACAGAGTCTTGCTCTCTCACTCAGGCTGGAGTGCAGTGGACCATTCTAGGCTCGCTCCAACCTCTGTCTCCCAAATTGAAGTAATTCTCGTGCCTCAATCTCCCGAGTAGCTGGGATTACAGGCATGTGTCACCAAGCCTGGCTGATTTTTGTAGTTTTAGTAGAGACGGGGTTTCACCATGATGGCCAGGCTGGTCTTGAACTCCTGGCCTCAAGTGACTGGAACACCTCGGCCTCCTAAAGTGCTGGGATTACAGACGAGAGCCACTGAACAGCTTTGATCCAACTTATTTGGATGAATGAGTTACATATTTTACATTAAATCTGTTATTGTGATAATTCTTCATGTTATTTTCCATGTATAGATTTATATATAATGTAATTTTAATTTTTTTTCACCGGAGAGTATAAACAACAATTATTTTATAAACAGGATAATAAAAATAAGACAAAAATTGTTGAAATGTCTTCATTTGACTACTAACTTTTTACATGTTTGTTACTTTGAAGCTGTTATCAATACTTGTGATGTATTACAATTAAGTAAAGATTTAAAGATGCCATTTTTAACTTATTATGACACAAAGTCTATAAATTCTTATATTTTGAGATTTGTATTTAAATAACTTGTGAAATTTAATTTTAAAATAAAATTTCTTCTATGGATTGGTCTTCAATCGAGGCATAAAAAGGAATATAACAGTGTGGCACTATAACTTCTATATTGAATTTCTATATTATTTAACACAATTATAATTTTGCTAATGAATTGTAATGTTTTTAAAAAGCTAGGTGAATTTTATTAAATTCATTACATGGCGATAACACAGAGAAAACATTTTGGGGATTCTTTTAAAATGGTATGTACAAAAGCTTAAAAGTTGTTATGTAGTGGCAGAGATAAAAAAGTAAAACAAAAAAAAGCTTAAAAGTTTGCTTTACTATTTATAGGCTCATAAGTGTAAGTGTGCCAGAAAATGAAAAAGAAAGGAGAGAAATTATAAATAACTGTGTGGAAAACACAGATAAAGCATAAAGATAGAATATAAAGATAGAAGCATTTTAATATGAGGCAGTGATGGCTTTTTGAAGAATCCCAACTAAGGACCTACTTTTAGTTAATAAATAATATGTTTCTAATCCCTATATTGTCCACAGCAACCTTTTTAGGACATGGAGCAGTGACTATGAGTGCCAGAAGGCAAGAGTAGAAGCAATTGTAAAATCATGAACACTAGTTTGTAAAATCCTCACTGAGATATAATATCTGTTTGCCTCTACCTTAGAATTATTAATGTCTTGAGGGCTGGGA A very small piece of chromosome 21
  • 13.  
  • 14. What’s in a genome? Genes (i. e., protein coding) But. . . only <2% of the human genome encodes proteins Other than protein coding genes, what is there? • genes for noncoding RNAs (rRNA, tRNA, miRNAs, etc.) • structural sequences (scaffold attachment regions) R egulatory sequences • “ junk” (including transposons, retroviral insertions, etc.)
  • 15.  
  • 16.  
  • 17.  
  • 18.
  • 19.
  • 20.
  • 21. Chimpanzee Sequencing and Analysis Consortium . Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 2005 Sep 1;437(7055):69-87. Thirty-five million single-nucleotide changes, five million insertion/deletion events, and various chromosomal rearrangements. 98,6 % identitity to human genome sequence Differences in gene/exon structures
  • 22. Apparent differences between humans and great apes in the incidence or severity of medically important conditions (excluding differences explained by obvious anatomical differences ). Medical Condition Humans Great Apes Definite HIV progression to AIDS Common Very rare Influenza A symptomatology Moderate to severe Mild Hepatitis B/C late complications Moderate to severe Mild P. falciparum malaria Susceptible Resistant Menopause Universal Rare Likely E. coli K99 gastroenteritis Resistant Sensitive? Alzheimer’s disease pathology Complete Incomplete Coronary atherosclerosis Common Uncommon Epithelial cancers Common Rare