1. Discover and advance
Cancer research
Dissociate tumor tissue
Isolate cancer stem cells
Enrich and detect
circulating tumor cells
Investigate endothelial
and progenitor cells

2. MACS® Technology by Miltenyi Biotec Sorting out a cell separation strategy
Providing a firm foundation for reliable results Choosing the optimal way of cell separation
Contents Propel your cancer research Positive selection Untouched isolation
Sequential sorting:
Depletion followed by positive selection
4 Push the envelope of innovation with MACS® Technology Magnetic labeling Magnetic labeling First magnetic
Comprehensive solutions for cancer research MACS® Technology, the recognized standard in cell separation, Cells of interest are Non-target cells are labeling
has supported oncology research and immunobiology for magnetically labeled magnetically labeled Non-target cells are
with MACS with a biotinylated magnetically labeled
5 From bench to bedside over 20 years. MicroBeads. antibody cocktail with a biotinylated
Translating discovery research into clinical therapy and Anti-Biotin antibody cocktail and
MicroBeads. Anti-Biotin
Benefit from MACS Technology MicroBeads.
6 Taking tumor tissue to task
Tumor tissue dissociation • Easily isolate rare cell populations
First magnetic
• Optimal recovery and excellent purity separation
7 Tumor immunology • Fast, convenient, and reliable Undesired cells are
Interaction between immune system and cancer cells • Gentle to cells retained in a MACS
Magnetic Column placed in a
• Automated cell separation with the separation MACS Separator while
8 The driving force of tumor development autoMACS® Pro Separator the unlabeled cells
Cancer stem cells Cells are separated in pass through.
• Compatible with flow cytometry a MACS Column
placed in a MACS
9 Targeting cancer stem cells • Cell separations can easily be scaled-up Separator.
Tools for the enrichment and analysis of CSCs • Bridges basic research and clinical applications The flow-through Second magnetic
fraction can be Magnetic labeling
collected as the separation
10 Hematological tumors About MACS MicroBeads negative fraction
Target cells are
Undesired cells are magnetically labeled
MACS MicroBeads are superparamagnetic particles of depleted of the
Multiple myeloma and B-CLL labeled cells. retained in a MACS with MicroBeads
approximately 50 nanometers in diameter. They are composed Column placed in a according to a subset
MACS Separator. marker.
11 Tumor vascularization of a biodegradable matrix, and it is therefore not necessary to
remove them from cells after the separation process. Elution of the The target cells pass
Endothelial cells, pericytes, and endothelial progenitors through the column
labeled cell fraction Second magnetic
• Colloidal, for easy handling, and short incubation times and are collected as separation
The column is the enriched,
12 Spreading the tumor • Small (50 nm), non-toxic, biodegradable removed from the unlabeled cell Target cells are
Circulating tumor cells separator. The fraction, depleted of retained in the column
• Detachment is not required for downstream experiments retained cells are while unlabeled cells
non-target cells.
eluted as the pass through. After
• Conjugated to highly specific monoclonal antibodies
13 Capture circulating tumor cells enriched, positively the column is
Tools for enrichment and analysis of CTCs selected cell fraction. removed from the
separator, the target
cells are eluted as the
14 Molecular analysis enriched, positively
Expression profiling and mitochondrial enrichment selected cell fraction.
Positive selection means that the desired target Untouched isolation is performed by Cell subsets can be isolated by first depleting the
16 Optimal conditions cells are magnetically labeled and isolated as the depletion of undesired cells. Non-target non-target cells and then positively selecting the
Cell culture magnetically retained cell fraction. cells are magnetically labeled and eliminated cell subsets of interest.
Positive selection is the most direct and specific from the cell mixture. The non-magnetically This strategy is useful if undesired cells in the
way to isolate the target cells from a heterog- labeled, untouched cell fraction contains the cell suspension express the same antigen that
17 Order information enous cell suspension. Binding of MicroBeads target cells. is used for positive selection of the target cells.
Place your order by fax, phone, or online! to the cell surface does not affect viability or For many different cell types, Miltenyi Biotec
function of the cells. Both fractions, labeled and offers optimized MACS Cell Isolation Kits contain-
unlabeled, can be recovered and used. ing pre-titrated cocktails of antibodies directed
21 References against non-target cells.
More than 13,000 studies used Miltenyi Biotec products
2 3

3. Push the envelope of innovation From bench to bedside
Comprehensive solutions for cancer research Translating discovery research into clinical therapy
Streamline your experiments Researchers working for researchers A bridge from laboratory to clinic
Miltenyi Biotec reagents, instruments, and services are As a premier biotechnology company, Miltenyi Biotec is We are aware of the many challenges faced by translational
designed to support scientists in achieving outstanding results. committed to the advancement of scientific understanding researchers. Bridging proof-of-principle research with
From sample preparation, through cell sorting and culture to and medicine by providing products and services for GMP-grade therapies isn't easy and we can help you
performing cell and molecular analyses. biomedical research and cellular therapy. overcome these challenges.
In today’s research environment the translation of discovery
MACS Sample Preparation MACS Cell Culture research into efficacious clinical treatments is of utmost Discover
The quality of an experiment The product portfolio for importance. Our product portfolio and vast interdisciplinary A portfolio of over 1,000 products is at your disposal, helping
strictly depends on the quality cell culture includes media expertise pays tribute to that fact. you to convert pioneering concepts into reality.
of the sample preparation. Use as well as recombinant
the innovative gentleMACS™ cytokines and growth
Dissociator for consistent, fast, factors up to GMP grade. Advance
and gentle dissociation and In addition, products for
homogenization of various effective cell activation and Countless researchers worldwide rely on our products to
tissues or cells in a closed expansion are available. advance their research; in fact, more than 13,000 peer reviewed
system. scientific publications support this claim.
Translate
Many of our reagents are available as research-grade and
GMP-grade products, making the transition to clinical therapy
that much easier. We also manufacture CE-marked instruments
and reagents for use in a clinical setting.
MACS Cell Separation MACSmolecular
A large panel of MACS We provide products for
MicroBeads and MicroBead Kits protein isolation and
Discover. Advance. Translate.
are available for the isolation detection, mRNA purification
of virtually any cell type. The and amplification, cDNA
cells can be separated manually synthesis and labeling,
using MACS Magnets, or microRNA analysis, as well as
automatically with the microarray technologies and
autoMACS® Pro Separator. instrumentation. Also we offer
genomic services: gene and
microRNA expression
analyses, array-CGH, and
bioinformatics.
MACS Cell Analysis CliniMACS®
We provide a large selection With the CliniMACS® Cell
of monoclonal antibodies and Separation System, Miltenyi
kits for fluorescence Biotec has successfully taken
microscopy and flow the step from research into
cytometry. The innovative clinic.
MACSQuant® Analyzer is an
extremely compact,
easy-to-use benchtop flow
cytometer. The instrument
is fully automated, enabling
absolute cell counting, and
rare cell analysis.
4 5

4. Taking tumor tissue to task Tumor immunology
Tumor tissue dissociation Interaction between immune system and cancer cells
Tissue dissociation that is The immune system plays a crucial role in host protection against subsequent tumor growth and angiogenesis. We bring you
carcinogenesis by eliminating tumor cells. However, some of the a large array of tools to advance your research in tumor
reliable, reproducible, and rapid tumor cells are not detected by the immune system and a variety immunology, taking you from bench to bedside.
of immunologic mechanisms contribute to tumor escape and
The analysis of tumor cell and stem cell populations requires Find out more at www.miltenyibiotec.com.
effective methods for tissue dissociation followed
by the isolation of viable cells.
Isolate viable cells from tumors with ease
using the gentleMACS™ Dissociator
Solid tumors are made up of a mixture of cell types which are
interconnected to each other and surrounded by an Tumor Lymphoid organ
extracellular matrix composed of a variety of proteins and Dendritic cell
polysaccharides. The gentleMACS™ Dissociator reliably
dissociates the extracellular matrix and cell adhesion IL-10
The gentleMACS Dissociator and gentleMACS Tubes are designed for components without harming cell integrity. TGF-β
efficient, reliable, and easy tissue dissociation. Dendritic
Monocyte
Specialized programs and protocols are optimized for tumor cell IL-4
dissociation. Preparate your single-cell suspensions from
Treg cell
various primary human or implanted IL-6
mouse tumors using: IL-10 MDSC Tumor TH2 cell
antigen Naive CD4+
• gentleMACS human tumor dissociation programs CSC T cell
TGF-β
• gentleMACS mouse tumor dissociation programs IL-2
• Tumor Dissociation Kits Macrophage
NK cell
IL-10 Treg cell
Automated dissociation of tissues assures that results are TGF-β
TGF-β IL-10
reproducible and reliable — all of that in a much shorter
CD8+ T cell
timeframe.
MDSC Macrophage
The gentleMACS™ Dissociator at a glance CD8+ T cell
Two types of gentleMACS Tubes are available: C Tubes and M Tubes.
C Tubes generate single-cell suspensions for cell biology applications • Time-saving automated tissue dissociation
(e.g. cell separation and cell culture). M Tubes allow for a thorough
homogenization of tissues or cells for molecular applications.
• Consistent, reliable results IL-4
iNKT cell IL-5
• Optimized programs for multiple applications IL-4 Monocyte IL-10
IL-10
• Closed system enabling sterile sample handling IL-13
IL-13
TGF-β CD8+ T cell
• Specific programs and protocols were developed
for cellular and molecular applications
B cell
Visit www.gentleMACS.com to learn more about how the Treg cell
TH2 cell
gentleMACS Dissociator can advance your research.
Dendritic cell
Circulating
tumor cell
MDSC: Myeloid-derived suppressor cell
CSC: Cancer stem cell
Tumor escape: Some tumor cells survive as they become insensitive to the elimination process due to genetic or epigenetic alterations.
These cells continue to proliferate in an uncontrolled manner and more immune cells are attracted to the tumor site.
6 7

5. The driving force of tumor development Targeting cancer stem cells
Cancer stem cells Tools for the enrichment and analysis of CSCs
Reinterpreting tumor biology Tumor type Cell surface marker Effective tools for cancer Before separation CD44+ Cells
Classical tumor biology asserts that any malignantly
Acute myeloid leukemia (AML)35 CD34+/CD38 –
stem cell research
Breast cancer36 ESA+/CD44+/CD24 –/Lineage –
transformed cell is immortal and may give rise
to other equally potent cancerous cells. Ovarian cancer37–39 CD133+ Isolate cancer stem cells with ease using our MicroBead
CD44+/CD117+ reagents and kits, which are optimized to ensure a high
Forward scatter
Forward scatter
Recent studies suggest that this hypothesis may not be the CD24+ purity and yield of target cells.
case, and that the clinical properties of human tumors may Glioblastoma* 40–42 CD133+
be the result of a small population of transformed stem cells CD15+ • Reliably isolate viable and pure populations of cancer
within the tumor — cancer stem cells. Medulloblastoma 40,41,43
CD133 + stem cells from solid tumors and cancer cell lines.
CD15+ • Isolate cells on your own schedule whenever
Small cell and non-small CD133+ the sample becomes available. CD44-PE CD44-PE
Cancer stem cells cell lung cancer44 • Target any cell marker of your choice.
Cancer stem cells (CSCs), also known as tumor-initiating cells Hepatocellular carcinoma45 CD45–/CD90+
• Use enriched samples for downstream applications
(TICs), are thought to drive the process of tumorigenesis on the
Prostate cancer⁵ CD44+/A2B1 hi/CD133+ such as flow cytometric or molecular analysis. CD+ cells were isolated from a mixture of U (CD+) and  (CD –)
basis of self-renewal and the generation of an aberrant tumor
Colon cancer 6,46–49
CD133 + cell lines and then isolated using the CD MicroBeads, an LS Column, and
cell upon CSC division. CSCs would therefore effectuate tumor a MidiMACS™ Separator. Cells were fluorescently stained with CD-PE and
CD44+
metastasis and tumor relapse; a theory that is contrary to CD26+
MicroBeads: reagents for the isolation analyzed by flow cytometry using the MACSQuant Analyzer.
classical tumor biology hypotheses.
Melanoma50–53 CD20+
of cancer stem cells
ABCB5+ MicroBeads reagents can be used directly or in combination
CD271+ for the enrichment or depletion of defined cell markers:
Possible implications of this hypothesis:
Pancreas adenocarcinoma54 CD44+/CD24+/EpCAM+ Original fraction Positive fraction
• Metastases are mediated by CSCs and not • CD133 MicroBead Kit1–8
Renal carcinoma 55
CD133 enhances vascularization • New: CD44 MicroBeads
any tumor cell.
Head and neck squamous cell CD44+ • New: CD24 MicroBead Kit
• CSCs are resistant to conventional chemotherapies carcinoma (HNSCC)56
and facilitate tumor relapse. • CD20 MicroBeads
CD44-APC
CD44-APC
* CD expression may be affected by cell culture conditions.
A better understanding of CSC pathogenesis would not only Cell surface markers of cancer stem cells in different types of tumors. • CD15 MicroBeads
serve to improve diagnostic procedures, but also to develop For a respective product list please refer to pages –.
• CD45 MicroBeads
therapies that specifically target these cells, hindering tumor
recurrence. • CD271 (LNGFR) MicroBead Kit
s
Read further to discover how Miltenyi Biotec can help Target any cell type from any species CD24-FITC CD24-FITC
you make strides in cancer research or visit:
For maximum flexibility, indirect magnetic labeling with
www.miltenyibiotec.com/csc.
MACS MicroBeads allow the use of any primary antibody for
cell isolation. Monoclonal or polyclonal primary antibodies CD -CD+ cells were isolated from CML cell line KZ. CD+ cells were
of your choice can be either unconjugated, biotinylated, or first depleted using the CD MicroBead Kit and then positively selected for
CD using the CD MicroBeads. Cells were fluorescently stained with
fluorochrome-conjugated.
CD-APC and CD-FITC and analyzed by flow cytometry using the
• Anti-Fluorochrome MicroBeads
MACSQuant Analyzer.
• Anti-Biotin MicroBeads
• Anti-Isotype MicroBeads
• Streptavidin MicroBeads
8 9

6. Hematological tumors Tumor vascularization
Multiple myeloma and B-CLL Endothelial cells, pericytes, and endothelial progenitors
High performance in hematological Novel tools to assess
Before separation CD34+ cells Before separation CD34+ cell fraction
cell enrichment and analysis Before separation Isolated iNKT+ cells
tumor vascularization Before separation Isolated iNKT+ cells
CD309 (VEGFR-2/KDR)-APC
Miltenyi Biotec continues to expand on a significant portfolio Vascularization of a developing solid tumor is considered to be
of MACS Products for hematological research. These include a key step in tumor growth, invasion and metastasis. New vessel
CD45-FITC
CD34-FITC
CD45-FITC
products for the investigation of normal hematopoiesis and formation involves the recruitment of endothelial progenitor
R5
reagents for the study of hematological malignancies. cells (EPCs) from bone marrow, resulting in an increase of EPC R4
levels in times of significant tumor growth.
Leukemic stem cells
It has been proposed that transformation of hematopoietic CD34-PE CD34-PE Using EPCs to evaluate tumor progression CD133/2 (293C3)-PE CD133/2 (293C3)-PE
stem cells results in the generation of leukemic stem cells (LSCs) Growing evidence suggests that the efficacy of anti-angiogenic
— tumor cells with uncontrollable self-renewal capabilities. therapies can be quantitated by enumerating circulating EPCs.
Flow cytometric analysis of CD+ cells isolated from peripheral blood Moreover, EPC numbers could also indicate tumor progression. CD+CD+CD (VEGFR-/KDR)+ EPCs were identified and enumerated
In order to elucidate the pathogenic processes behind this mononuclear cells (PBMCs) using the CD MicroBead Kit, an MS Column, from a leukocyte sample and analyzed using the MACSQuant Analyzer.
transformation, many researchers are currently focusing on and a MiniMACS™ Separator. Take the convenient route for EPC analysis using the
the identification, enrichment, and characterization of LSCs. EPC Enrichment and Enumeration Kit:
Accurately isolate LSCs within minutes: • Significantly reduces your analysis time by flow cytometry
• CD34 MicroBead Kit⁹¹⁰ • Optimized for use with the MACSQuant Analyzer for
Before separation CD138+ cells Before separation CD146+ cell fraction
Before separation Isolated iNKT+ cells walk-away sample processing, flow cytometric gating, Before separation Isolated iNKT+ cells
• CD34 MultiSort Kit¹¹
and EPC enumeration (coming soon)
• Special protocol developed for
EPCs are defined by the expression of CD34, CD133, and CD309
isolation of CD34+/CD38– cells¹²
and are considered to be a parameter for assessing a number of
CD19-APC
CD34-FITC
CD34-FITC
CD19-APC
diseases involving vascular repair.
Multiple myeloma
Isolate CD138+ cells with minimum hands-on time and a
Stem cells making a niche for themselves
maximum yield of target cells, even from weakly infiltrated
myeloma patient samples. Recent reports suggest the existence of perivascular–cancer
CD138-PE
CD138-PE stem cell niches; microenvironments where endothelial cells CD146-APC CD146-APC
• CD138 MicroBeads¹³¹⁴
and pericytes interact closely with self-renewing CSCs.
• Whole Blood CD138 MicroBeads
CD138+ plasma cells were isolated from human PBMCs using CD20 and CD138 We have developed specific MicroBeads for the efficient CD+ cells were separated from lipoaspirate using the CD MicroBead
Investigating Hodgkin’s lymphoma MicroBeads, an LD and two MS Columns, and appropriate MACS Separators. Cells enrichment of endothelial cells and pericytes: Kit, an LS Column, and a MidiMACS Separator. Cells were stained with
are fluorescently stained with CD138-PE and CD19-APC. CD-APC and CD-FITC.
The hallmark indicator of Hodgkin's lymphoma is the • CD146 MicroBead Kit
identification of CD30+/CD15+ Reed-Sternberg cells. • CD105 MicroBeads
These rare and highly fragile cells can be enriched using: • CD31 MicroBead Kit
• CD30 MicroBeads
Chronic lymphocytic leukemia
B cell chronic lymphocytic leukemia is one of the most common
types of leukemia. Isolation of untouched B cells can be
achieved from tumor cell-containing samples using:
• B Cell Isolation Kit (B-CLL)
10 11

7. Spreading the tumor Capture circulating tumor cells
Circulating tumor cells Tools for enrichment and analysis of CTCs
Unravelling the mechanisms Magnetic labeling of a
Achieve paramount performance in Enrich circulating tumor cells
of metastasis specific cell population
using MACS MicroBeads.
circulating tumor cell detection for discovery research
Circulating tumor cells (CTCs) are cells that are shed from the Analysis of circulating tumor cells is inherently limited by the MACS MicroBeads can be used for the isolation
primary tumor and enter the circulation where they can spread sensitivity of the detection system. Overcome these limitations of circulating tumor cells from a variety of sources.
to anatomical sites distant from the primary tumor and form with MACS Enrichment and Detection Kits. • Peripheral blood mononuclear cells (PBMCs)
metastases. • Circulating tumor cells are enriched
Retention of target cell • Bone marrow
population in a column. using the desired cell marker. • Lymphoid tissue
Towards a better understanding • Enriched cells can be directly stained while • Peripheral blood buffy coats
of circulating tumor cells in the column minimizing cell loss.
Circulating tumor cells are found at extremely low frequencies, • Stained cells are eluted and can be Consistent quality in CTC enrichment
often at the detection limit of many analytical techniques. immedately used for cell analysis.
Use one of the following MicroBead Reagents for the
This places a great challenge on their identification and
convenient enrichment of circulating tumor cells:
characterization. To overcome this, pre-enrichment of A complete kit for enrichment and detection
rare CTCs is necessary. 1. Elution of target cells.
• CD326 (EpCAM) MicroBeads21–27
The following Enrichment and Detection Kits have been
2. Fixation by adding Inside Fix. designed for optimal detection of circulating tumor cells: • ErbB-2 (HER2) MicroBeads23
Optimize the detection and analysis • CD326 (EpCAM) Tumor Cell Enrichment and Detection Kit • Carcinoma Cell Enrichment Kit28
of circulating tumor cells • ErbB-2 Tumor Cell Enrichment and Detection Kit • Anti-Melanoma (MCSP) Microbeads29,30
Circulating tumor cells can be easily enriched • Carcinoma Cell Enrichment and Detection Kit¹⁶-²⁰ • CD45 MicroBeads31–33
using the following markers prior to analysis: • Melanoma Cell Enrichment and Detection Kit Refer to www.miltenyibiotec.com/tumorcells for more details.
• CD326 (EpCAM)
For intracellular staining of cancer stem cells:
• ErbB-2 (HER2)
• Inside Stain Kit
• Anti-Melanoma (MCSP, NG2)
• Anti-Cytokeratin antibodies
• CD45
• Anti-Cytokeratines
1. Application of the fixed cells
onto a second column.
2. Permeabilization with
Inside Perm.
3. Application of staining reagents
onto the column.
Elution, substrate incubation and
flow cytometric or
immunocytochemical Immunocytochemical detection of breast cancer cells enriched using
evaluation. the Carcinoma Cell Enrichment and Detection Kit and stained with
Anti-Cytokeratin-FITC and Anti-FITC-Alkaline Phosphatase plus substrate.
In-column intracellular staining of CTCs isolated using
the MACS Technology
12 13

8. Molecular analysis
Expression profiling and mitochondrial enrichment
Excel in tumor molecular analyses State-of-the-art microRNA The faster approach to
MACSmolecular provides a highly innovative range of products Send sample—receive results expression profiling mitochondria enrichment
and services with a strong focus on microRNA and gene
Use one of the high-quality miRXplore™ Microarray Kits—reliable Many studies have described mitochondrial abnormalities in
expression profiling.
tools for extensive microRNA expression profiling. tumor tissues and cancer cell lines. Investigators often rely
Technical support for experimental
on density centrifugation for mitochondrial enrichment—a
design and microarray selection • Expert coverage of sequences
Convenient microarray services for cancer research time-consuming and laborious technique.
• microRNA miRXplore Microarrays • High sensitive microRNA profiling
For laboratories who have no or limited access to microarray • Agilent Whole Genome Microarrays Benefit from the Mitochondria Isolation Kit: a faster
technologies we offer a complete microarray service: from • Excellent specificity
and simplier procedure that is also more accurate.
sample preparation to the generation of a comprehensive • Consistent data
RNA extraction and quality control • High yields of isolated mitochondria
bioinfomatics report. • Sample independent normalization
• Maintains organelle integrity
We are an offically certified Agilent Service Provider with over Optional:
• High purity levels
10 years experience in this field. • Amplification and quality control
• SuperAmp Service1: 1–10,000 cells • Easy and straight forward operation
Our high-quality Agilent Microarray Services—from RNA 100
• Size-independent isolation
extraction to comprehensive bioinformatic services—result in 90
Synthesis and purification of 80
Relative signal intensity (%)
Hepatocellular carcinoma cell RNA
ready-to-publish data. For further information about our molecular services,
fluorescently labeled probes 70 Glioblastoma cell RNA
60 visit www.miltenyibiotec.com.
Hippocampus RNA
50
Microarray analysis couldn't be easier Microarray hybridization 40
CD4+ T cell RNA
• Send your samples to Miltenyi Biotec. 30
20
• Sample processing and analysis will be performed Image capture and
10
using stringent quality control standards. analysis of primary data 0
miR -27a miR -27a - mut1 miR -27a - mut2
• Our in-house bioinformatics team will compile
Optional: Bioinformatics Services 2 Reverse-complementary miR-27a sequence
a clear and comprehensive report of your data, including and synthetic variants
a record of all experimental steps and data analyses. • Cluster Analysis miR-27a GCGGAACT TAGCCACTGTGAA
• Discriminatory Genes Analysis mut1 GCGGAACT TACCCACTGTGAA
• Pathway Analysis mut2 GCGGACC T TACCCACTGTGAA
µMACS™ SuperAmp Technology for
single cell analysis Probe-target specificity of miRXplore Microarray
µMACS™ SuperAmp Technology enables gene expression Results and report
profiling down to a single cell. The source RNA can be derived Data on CD-ROM
from:
100
• cells sorted with MACS Technology 90
Relative signal intensity (%)
1 miRNAs cannot be amplified with the SuperAmp Service. 80
• laser-captured, microdissected cells 2 Please inquire for microRNA Bioinformatics Services. 70
• cells sorted by flow cytometry 60
50
• tissue biopsies 40
• 1–10,000 cells 30
20
10
0
miR-465A-5P miR-465B-5P miR-465C-5P miR-465D
miR-465 family
miR-465A-5P UAUUUAGAAUGGCACUGAUGUGA
miR-465B-5P UAUUUAGAAUGGUGCUGAUCUG
miR-465C-5P UAUUUAGAAUGGCGCUGAUCUG
miR-465D UAUUUAGAAUGGUACUGAUGUG
Specific detection of miR-465 family members
14 15