SlideShare ist ein Scribd-Unternehmen logo
1 von 34
Evolving Prolog
gene expression programming
InfoQ.com: News & Community Site
• 750,000 unique visitors/month
• Published in 4 languages (English, Chinese, Japanese and Brazilian
Portuguese)
• Post content from our QCon conferences
• News 15-20 / week
• Articles 3-4 / week
• Presentations (videos) 12-15 / week
• Interviews 2-3 / week
• Books 1 / month
Watch the video with slide
synchronization on InfoQ.com!
http://www.infoq.com/presentations
/prolog
Presented at QCon New York
www.qconnewyork.com
Purpose of QCon
- to empower software development by facilitating the spread of
knowledge and innovation
Strategy
- practitioner-driven conference designed for YOU: influencers of
change and innovation in your teams
- speakers and topics driving the evolution and innovation
- connecting and catalyzing the influencers and innovators
Highlights
- attended by more than 12,000 delegates since 2007
- held in 9 cities worldwide
mndrix
The Problem
Lending Club
peer to peer loans
which ones are good?
data!
The Result
98% success
p2pquant.com
note selection
Genetic Algorithms
because giraffes
Candida Ferreira FTW!
Genotype
ATGCTTCGGCAAGACTCAAAAAATA
Phenotype
Ophrys apifera
xkcd 1259
Genotype : Phenotype
Source : AST
*b+a-aQab+//+b+babbabbbababbaaa
Investment strategy
and
FICO >
credit
inquiries <
700 2
Prolog
Why Prolog?
homoiconic
?- writeln(hi).
hi
?- X=writeln(hi).
X = writeln(hi).
?- call($X).
hi
logic variables
?- X=writeln(Message).
X = writeln(Message).
?- X=writeln(Message), Message=hi.
Message = hi,
X = writeln(hi).
?- call($X).
hi
*b+a-aQab+//+b+babbabbbababbaaa
declarative
Fitness Function
internal rate of return
Generations
you kids get off my lawn
98% satisfied
p2pquant.com
thanks
Watch the video with slide synchronization on
InfoQ.com!
http://www.infoq.com/presentations/prolog

Weitere ähnliche Inhalte

Mehr von C4Media

Shifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDShifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDC4Media
 
CI/CD for Machine Learning
CI/CD for Machine LearningCI/CD for Machine Learning
CI/CD for Machine LearningC4Media
 
Fault Tolerance at Speed
Fault Tolerance at SpeedFault Tolerance at Speed
Fault Tolerance at SpeedC4Media
 
Architectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsArchitectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsC4Media
 
ML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsC4Media
 
Build Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerBuild Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerC4Media
 
User & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleUser & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleC4Media
 
Scaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeScaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeC4Media
 
Make Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereMake Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereC4Media
 
The Talk You've Been Await-ing For
The Talk You've Been Await-ing ForThe Talk You've Been Await-ing For
The Talk You've Been Await-ing ForC4Media
 
Future of Data Engineering
Future of Data EngineeringFuture of Data Engineering
Future of Data EngineeringC4Media
 
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreAutomated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreC4Media
 
Navigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsNavigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsC4Media
 
High Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechHigh Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechC4Media
 
Rust's Journey to Async/await
Rust's Journey to Async/awaitRust's Journey to Async/await
Rust's Journey to Async/awaitC4Media
 
Opportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaOpportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaC4Media
 
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayDatadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayC4Media
 
Are We Really Cloud-Native?
Are We Really Cloud-Native?Are We Really Cloud-Native?
Are We Really Cloud-Native?C4Media
 
CockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseCockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseC4Media
 
A Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinA Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinC4Media
 

Mehr von C4Media (20)

Shifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDShifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CD
 
CI/CD for Machine Learning
CI/CD for Machine LearningCI/CD for Machine Learning
CI/CD for Machine Learning
 
Fault Tolerance at Speed
Fault Tolerance at SpeedFault Tolerance at Speed
Fault Tolerance at Speed
 
Architectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsArchitectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep Systems
 
ML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.js
 
Build Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerBuild Your Own WebAssembly Compiler
Build Your Own WebAssembly Compiler
 
User & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleUser & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix Scale
 
Scaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeScaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's Edge
 
Make Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereMake Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home Everywhere
 
The Talk You've Been Await-ing For
The Talk You've Been Await-ing ForThe Talk You've Been Await-ing For
The Talk You've Been Await-ing For
 
Future of Data Engineering
Future of Data EngineeringFuture of Data Engineering
Future of Data Engineering
 
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreAutomated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
 
Navigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsNavigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery Teams
 
High Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechHigh Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in Adtech
 
Rust's Journey to Async/await
Rust's Journey to Async/awaitRust's Journey to Async/await
Rust's Journey to Async/await
 
Opportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaOpportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven Utopia
 
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayDatadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
 
Are We Really Cloud-Native?
Are We Really Cloud-Native?Are We Really Cloud-Native?
Are We Really Cloud-Native?
 
CockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseCockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL Database
 
A Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinA Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with Brooklin
 

Kürzlich hochgeladen

AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024The Digital Insurer
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...apidays
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businesspanagenda
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherRemote DBA Services
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century educationjfdjdjcjdnsjd
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...Martijn de Jong
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
DBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor PresentationDBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor PresentationDropbox
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
Navi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Navi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot ModelNavi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Navi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot ModelDeepika Singh
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024The Digital Insurer
 
FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024The Digital Insurer
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobeapidays
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?Igalia
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxRustici Software
 
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...Zilliz
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodJuan lago vázquez
 
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...apidays
 

Kürzlich hochgeladen (20)

AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...2024: Domino Containers - The Next Step. News from the Domino Container commu...
2024: Domino Containers - The Next Step. News from the Domino Container commu...
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
DBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor PresentationDBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor Presentation
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Navi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Navi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot ModelNavi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot Model
Navi Mumbai Call Girls 🥰 8617370543 Service Offer VIP Hot Model
 
Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024Manulife - Insurer Transformation Award 2024
Manulife - Insurer Transformation Award 2024
 
FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024FWD Group - Insurer Innovation Award 2024
FWD Group - Insurer Innovation Award 2024
 
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptx
 
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
Emergent Methods: Multi-lingual narrative tracking in the news - real-time ex...
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
 
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
 

Evolving Prolog