1. Special thanks to Dr. David Marks, Kevin Dorn, and LSSURP at
University of Minnesota sponsored by NSF-REU in
Molecular Genetics & Proteomics
Pennycress (Thalspi Arvense L.), a member of the plant family Brassicaceae, is considered a
weed in American agricultural fields. However, recent field trials have shown that Pennycress
can be used as a winter annual in novel double cropping systems with soybean or corn.
Pennycress seeds have high oil content that can be used as a feedstock for biodiesel
production. Additionally, fall planted Pennycress is an effective cover crop that naturally
controls spring weed growth. With these unique agronomic properties, Pennycress has a
potential of becoming a promising non-food biofuel feedstock. In order to develop a widely
deployable double-cropping system, a line of fast maturing Pennycress is necessary to ensure
the early June harvest, making it easier to follow with a soybean or corn crop.
To address this goal, we are investigating the mechanisms controlling flowering in
Pennycress. Like many other plants, winter annual Pennycress utilizes cold temperature as an
environmental cue to go dormant during winter months and flower in the warm spring. This
period of cold exposure that promotes flowering is known as vernalization. Using the
extensive knowledge of these processes in the related model plant species Arabidopsis
thaliana, we are characterizing the Pennycress homologs of the key regulators of flowering
and vernalization. The main goal of this project is to study FT, a downstream floral integrator
gene, and VRN1 an upstream component responsible for vernalization sensitivity, for future
genetic manipulation to create an ideal line of Pennycress for use in the field.
• Used information from Arabidopsis Thaliana to study FT and VRN1 in Pennycress.
• Clone and sequence FT and VRN1.
• Analyze mRNA expression VRN1 under different conditions.
1. Designed FT and VRN1 primers with appropriate 5’ and 3’ cohesive ends.
2. Extracted RNA and created cDNA libraries from plants under different conditions:
unvernalized, vernalized, and flowering
3. Performed PCR reaction with FT and VRN1 with designed primers using different cDNA
libraries.
4. TOPO cloned FT and VRN1 into pCR4®-TOPO, transformed recombinant plasmid into
competent Escherichia coli and PCR screened for positive transformants.
5. Ligated VRN1 into pEGAD-35S::RED, transformed recombinant plasmid into competent
E.coli and PCR screened for positive transformants.
6. Sequenced VRN1 fragments as well as pEGAD-35S::RED_VRN1 .
7. qPCR for VRN1 using different cDNA libraries to obtain the expression level and
UBQ10 for nomalization.
Characterization of Flowering-time
Regulating Genes in Thlaspi Arvense L.
INTRODUCTION
CONCLUSION
METHOD LITERATURE CITED
ACKNOWLEDGEMENT
RESULTS
Duc Dang, Kevin Dorn, David Marks
University of Minnesota, College of Biological Sciences, Department of Plant Biology
Life Sciences Summer Undergraduate Research Program
CONSTRUCTS
Fig. 3. Map of pEGAD expression vector, a T-DNA vector
with 35S promoter constitutively expressed in most plants, a
multiple cloning site locus after dsRED, and a plant selection
marker (BASTA)
Fig. 8. Phylogram generated based on the alignment of VRN1 partial sequence
in Pennycress and CDS in other species in Brassicaceae family
7 colonies
Fig. 6. PCR screening results from 7 colonies
of E.coli transformants. Presence of VRN1 in
recombinant pEGAD is confirmed by gel
electrophoresis
OBJECTIVES
MAIN CROP COVER CROP
Plant pennycress
Harvest soybean/corn
Plant soybean/corn
Harvest Pennycress seed
Fig. 1. Double-cropping system of Pennycress and soybean
Fig. 2. Outline of flowering pathway
in Arabidopsis Thaliana
1 kb
ladder
VRN1
FT Study
Fig. 4. Map of pCR®4-TOPO Vector, which has two
antibiotic selective markers (Kanamycin and Ampicillin)
and a ccdB E.coli lethal gene fused with LacZα fragment for
direct positive selection
• Partial VRN1 sequence has 1005 bp, with the last codon of GGA.
• The presence of start codon couldn’t be confirmed, and thus an open reading frame
(ORF) has not been obtained.
• Partial sequence shows high consensus with VRN1 coding sequences (CDS) of other
species in Brassicaceae
1 kb
0.5 kb
1.5 kb
Fig. 7. Relative expression of VRN1 in Pennycress plants under different conditions with regard
to the expression of UBQ10 (Polyubiquitin gene)*
*Data is preliminary. UBQ10 primer efficiency has to be confirmed under different conditions.
Lanes and Content
1: 1 kb ladder
2: 100 bp ladder
3: FT/EcoRI(+)
BamHI(-)
4: FT/AgeI(+)
EcoRI(-)
5: FT/EcoRI
6: FT/StuI
7: FT/BamHI
1 2 3 4
1 kb
0.5 kb
1.5 kb 1 kb
0.5 kb
1.5 kb
1 2 5 6 7
VRN1 Study
Fig. 9. Inconclusive results of amplifying FT from combined cDNA of vernalized and
unvernalized plants using designed primers.
(a) is the agarose gel of PCR products, and (b) is the one of restriction digestion.
(a) (b)
1 2
21
0.5 kb
1 kb
0.5 kb
1 kb
(c)(-)
control
Lanes and Content
1: 1 kb ladder
2: 100 bp ladder
(c): PCR products of 3 colonies
of positive transformants.
(d): PCR products of 4 colonies
of positve transformants(d)
Fig. 10. Inconclusive results on agarose gel of
PCR products from positive transformants with
pCR4®TOPO vector.
• Partial coding sequence of VRN1 in Pennycress was obtained and is highly
conserved across other species (Fig. 7) in Brassicaceae family.
• Preliminary chart of VRN1 expression in Pennycress under three different
conditions supported the prediction of high number of VRN1 transcripts in
vernalized plants for complete repression of FLC to promote flowering.
• FT TOPO cloning results are inconclusive. Further steps to improve primer
efficiency and other different methods of cloning are suggested.
0
1
2
3
4
5
6
7
8
Vernalized
Unvernalized
Flowering
(vernalized)
Relativeexpression
Developmental Condition
Vernalized
Unvernalized
Flowering
(vernalized)
FUTURE RESEARCH
• VRN1 Forward Primer with E.coRI site
5' – TC|GAATTC|ATGCCACGCCCTTTCTTCCA - 3'
Fig. 5. First 50 nucleotides of VRN1 coding sequence alignment from species in Brassicaceae family
Species order from top to bottom:
1. Arabidopsis thaliana
2. Arabidopsis lyrata
3. Thellungiella halophila
4. Brassica rapa cultivar
• Determine final VRN1 sequence and obtain full expression profile
• Develop a transformation protocol in Pennycress (in progress)
• Overexpress VRN1 in pennycress and look for developmental phenotypes
• Knock down VRN1 in Pennycress using RNA interference
Dong-Hwan K., Mark D. , Sibum S., and Richard M. A. 2009.
Vernalization: Winter and the Timing of Flowering in Plants. Annu. Rev.
Cell Dev. Biol. 2009.25:277-299
Yoshibumi K. 2004. Genetic Regulation of Time to Flower in Arabidopsis
Thaliana. Annu. Rev. Plant Biol. 2004. 55:521–35
Fall
LateWinter
Late Spring
Early
Summer