B1 vitamini

1. Case report
Analysis of thiamine transporter genes in sporadic beriberi
Valentina Bravata Dr. a
, Luigi Minafra Ph.D. a
, Graziella Callari M.D. b
,
Cecilia Gelfi Ph.D. a,c
, Luigi Maria Edoardo Grimaldi M.D. b,*
a
Istituto di bioimmagini e fisiologia molecolare CNRdLATO, Cefalu PA, Scilly, Italy
b
U.O. Neurologia, Fondazione Istituto “San RaffaeledG. Giglio,” Cefalu PA, Scilly, Italy
c
Department of Biomedical Sciences for Health, University of Milan, Milan, Italy
a r t i c l e i n f o
Article history:
Received 4 June 2013
Accepted 10 October 2013
Keywords:
Thiamine
Beriberi
Mutations
SLC19 A2
SLC19 A3
SLC25 A19
a b s t r a c t
Objective: Thiamine or vitamin B1 deficiency diminishes thiamine-dependent enzymatic activity,
alters mitochondrial function, impairs oxidative metabolism, and causes selective neuronal death.
We analyzed for the first time, the role of all known mutations within three specific thiamine
carrier genes, SLC19 A2, SLC19 A3, and SLC25 A19, in a patient with atrophic beriberi, a multiorgan
nutritional disease caused by thiamine deficiency.
Methods: A 44-year-old male alcoholic patient from Morocco developed massive bilateral leg
edema, a subacute sensorimotor neuropathy, and incontinence. Despite normal vitamin B1 serum
levels, his clinical picture was rapidly reverted by high-dose intramuscular thiamine treatment,
suggesting a possible genetic resistance. We used polymerase chain reaction followed by amplicon
sequencing to study all the known thiamine-related gene mutations identified within the Human
Gene Mutation Database.
Results: Thirty-seven mutations were tested: 29 in SLC19 A2, 6 in SLC19 A3, and 2 in SLC25 A19.
Mutational analyses showed a wild-type genotype for all sequences investigated.
Conclusion: This is the first genetic study in beriberi disease. We did not detect any known mu-
tation in any of the three genes in a sporadic dry beriberi patient. We cannot exclude a role for
other known or unknown mutations, in the same genes or in other thiamine-associated genes, in
the occurrence of this nutritional neuropathy.
Ó 2014 Elsevier Inc. All rights reserved.
Introduction
ThiamineorvitaminB1 isahydrosolublevitaminthatcomprises
pyrimidine and thiazole rings joined by a methylene bridge [1].
Thiamine phosphoesters are cofactors for several enzymes
involved in carbohydrate metabolism, respiratory chain, synthesis
of neurotransmitters, and nucleic acid precursors [2]. Thiamine
deficiency diminishes the thiamine-dependent enzyme activity,
alters mitochondrial function, impairs oxidative metabolism,
and causes selective neuronal death [3–5]. This deficiency can
be caused by an inadequate consumption of thiamine, increased
need, or impaired absorption. In alcoholism, these conditions
coexist and seem to be responsible for a vitamin deficiencies;
in alcoholics, thiamine deficiency may result from an inadequate
dietary intake, impaired thiamine absorption in the gastrointes-
tinal tract, reduced liver storage, and decrease in the trans-
formation of thiamine into its active form [6].
The main manifestations of thiamine deficiency affect the
cardiovascular system (also known as wet beriberi), and the
peripheral and central nervous systems (also defined as dry
beriberi and Wernicke-Korsakoff syndrome [WKS]) [2].
Dry beriberi is a neurologic syndrome that results from
intracellular deficiency of the coenzyme thiamine pyrophos-
phate (TPP), the active form of thiamine. The characteristic
symptoms involve the lower extremities, with paresthesias and
pain in the feet, decreased deep-tendon reflexes at the ankle and
knee, loss of vibratory and position sense, and foot drop. Cerebral
beriberi may begin with subtle affective changes and memory
impairment, progressing through confusion with ataxia and
ophthalmoplegia, to lethargy, coma, and death [7].
VB and LM contributed equally to this work. All authors participated in the
conception, design, interpretation, and elaboration of the findings of the study.
All authors read and approved the final manuscript. The authors declare that
they have no competing interests.
* Corresponding author: Tel.: þ39 0921 92 0362; fax: þ39 0921 92 0405.
E-mail address: Luigi.grimaldi@hsr.it (L. M. Edoardo Grimaldi).
0899-9007/$ - see front matter Ó 2014 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.nut.2013.10.008
Contents lists available at ScienceDirect
Nutrition
journal homepage: www.nutritionjrnl.com
Nutrition 30 (2014) 485–488

2. In detail, thiamine is an essential cofactor of four important
enzymes in cellular metabolism: transketolase (TK) within the
pentose phosphate pathway (PPP), pyruvate dehydrogenase
complex (PDHC), alphaketoglutarate dehydrogenase (KGDHC) in
the tricarboxylic acid (TCA) cycle and branched chain ketoacid
dehydrogenase (BCKDC) of amino acid catabolism. In the central
nervous system, vitamin B1 has a key role in glucose metabolism;
80% of brain thiamine is in the form of thiamine diphosphate
(cofactor for KGDHC, PDHC, and TK enzymes) [8]. Furthermore,
the human body itself cannot produce this vitamin; therefore
thiamine must be obtained from exogenous sources (i.e., diet),
through absorption in the intestine. In the cell, imported thiamin
is converted to its active forms, mainly TPP, via the action of
thiamin pyrophosphokinase (TPKase), a rate-limiting enzyme
that plays an important role in regulating cellular thiamin ho-
meostasis. The cellular transport of the vitamin is mediated by
specific carriers identified, characterized, and codified by genes
associated to thiamine deficiency and neurologic disease.
The solute carrier (SLC) group of membrane transport pro-
teins includes more 300 members organized into 47 families [6].
Because folate and thiamine play vital roles in cellular meta-
bolism, their specific transporters are of biological importance
and, consequently their function disruption, mediated by genetic
mutations, can be expected to lead to serious clinical complica-
tions [9]. Most members of the SLC group are located in the outer
cell membrane, but some members are found in intracellular
organelles.
The SLC19 gene family of solute carriers is composed of three
transporter proteins with significant structural similarity, trans-
port mechanisms, and substrates with different structures and
ionic charges, named SLC19 A1, SLC19 A2, and SLC19 A3 [9]. The first
oneisa folatecarrier, whereastheothers arethiaminetransporters.
Gene expression studies have shown that the thiamine trans-
porters SLC19 A2 and SLC19 A3 are well expressed in several tissues
such as the intestine, placenta, kidneys, and brain. Moreover, some
data suggest that individuals with variants of these two genes may
be particularly susceptible to thiamine deficiency [6].
The SLC19 A2 gene (also known as THTR-1) maps on chro-
mosome 1 at 1 q23.3, contains six exons spanning 22.5 kb, and
codes for a protein containing 12 transmembrane domains and
two N-glycosylation sites [10–15]. This transporter is very spe-
cific for thiamine and no other organic cations are recognized as
substrates by themselves. Analysis of SLC19 A2 mutations
revealed significant heterogeneity, although the majority are
predicted to be null, with premature translation termination due
to nonsense or frame shift mutations [16].
SLC19 A3 (also known as THTR-2) is a second thiamine
transporter expressed ubiquitously in humans and many other
mammals. The SLC19 A3 gene maps on chromosome 2 at 2 q37
and consists of five coding exons [17]. Human SLC19 A3 exhibits
particularly high expression in kidneys, liver, and placenta.
Allelic variants of the SLC19 A3 could potentially be involved in a
variety of diseases including neural tube defects, diabetes, ane-
mia, deafness, and epilepsy [18].
Cell TPP is used either in the cytoplasm or is imported into the
mitochondria via a carrier-mediated process that involves the
mitochondrial TPP transporter, encoded by the SLC25 A19 gene
[19–21].
The SLC25 A19 gene maps on chromosome 17 at 17 q25,
contains nine exons and codes for a protein that has been
described as a mitochondria inner membrane transporter for
both deoxynucleotides and TPP. SLC25 A19 gene mutations cause
a metabolic disorder characterized by severe congenital micro-
cephaly, neuropathy, and bilateral striatal necrosis [22–24].
At present, no association has been reported between
thiamine-related genes and both forms of beriberi.
To our knowledge, no studies have examined all thiamine-
related mutations in the three genes simultaneously and no
genetic association studies between the beriberi disease and
these carriers have yet been performed.
Therefore, the purpose of our study was to analyze the role of
three specific thiamine-carrier genes, SLC19 A2, SLC19 A3, and
SLC25 A19, testing their known thiamine-related mutations,
which may contribute to the susceptibility of thiamine deficiency
in a case of sporadic dry beriberi patient.
Case presentation
A 44-year-old man with an ongoing history of alcohol abuse
was admitted to our hospital because of a history of subacute
progression over 2 wk of difficulty in walking, followed by dys-
esthesia in both hands, hypoesthesia from the transverse um-
bilical line downward, and bladder dysfunction. The day of
admission he developed in a few hours a massive edema with
pain and sensitive deficit in both lower limbs and feet. The
neurologic examination showed a severe paraparesis with mild
bilateral flaccid hypotonus, weak symmetrical upper limbs and
absent lower limbs reflexes, hypoesthesia with a D7–D8 level,
and a bilateral lower limb hypopallesthesia. Coordination was
normal, standing and walking could not be assessed, and he
reported difficulty initiating micturition.
Excessive alcohol use can cause neurologic or hepatic prob-
lems with signs of regional brain damage and cognitive dysfunc-
tion. Changes are more severe and other brain regions are
damaged in patients who have additional vitamin B1 deficiency
[25]. Routine laboratory exam with vitamin levels (including
thiamine), lactate, and pyruvate were normal. Cerebral and spinal
magnetic resonance imaging, as well as cerebrospinal fluid ex-
amination, was also normal. An electromyogram showed a distal
and proximal symmetrical motor axonopathy. Antiganglioside
antibodies were not found.
We initially considered a subacute axonal neuropathy (acute
motor-sensory axonal neuropathy type) and the patient was
treated with high-dose IV steroids and subsequent immuno-
globulin therapy with no benefit.
In the hypothesis of a nutritional deficiency sensory-motor
axonal chronic polyneuropathy, we started a 10 d regimen of
IV 100 mg/d thiamine followed by 30 d with 50 mg/d orally.
Thirty minutes after the first IV dose, a significant reduction of
foot edema was noted with progressive recovery of strength in
the lower limbs. During the following 10 d, the patient started to
walk with support for about 70 m without interruption and
continued the rehabilitation therapy until complete remission.
Final diagnosis was “acute thiamine deficiency neuropathy,”
better known as “atrophic or dry beriberi” [26–28]. Because
thiamine blood levels of this patient were in the normal range
throughout his clinical course, we hypothesized a possible
thiamine resistance somewhere in the metabolic cascade of the
vitamin.
To assess whether mutations in thiamine metabolism-related
genes were associated with beriberi, we performed a systematic
mutational analysis of three specific thiamine carriers previously
associated with neurologic diseases in the context of a thiamine
deficiency.
For selecting the known SLC19 A2 (NG_008255), SLC19 A3
(NG_016359), and SLC25 A19 (NG_008274) thiamine-related
mutations the Human Gene Mutation Database (HGMD; http://
www.hgmd.cf.ac.uk) was used. The SLC19 A2 gene shows 29
V. Bravata et al. / Nutrition 30 (2014) 485–488486

3. mutations (i.e., 16 missense/nonsense, 1 splicing, 7 small de-
letions, 3 small insertions, and 2 small insertions/deletions
[indels]). The SLC19 A3 gene exhibits 6 mutations (i.e. 4 missense
mutations, 1 splicing, and 1 small insertion). The SLC25 A19 gene
displays 2 missense mutations.
Material and methods
Thiamine measurement
Total serum thiamine concentration was measured with routine laboratory
exam performed by high-performance liquid chromatography according to
a standard procedure [29].
Genetic analysis
The oligonucleotide primers were designed by Primer3 software (http//
fokker.wi.mit.edu/primer3) and tested for their human specificity using the
National Center for Biotechnology Information’s database. Total genomic DNA
was extracted from peripheral whole blood using QIAamp DNA blood mini kit
according to the manufacturer’s specifications (Qiagen). After quality and
quantity analysis, polymerase chain reaction (PCR) reactions were performed
with 50 ng of genomic DNA in a total volume of 50 mL containing 1Â PCR Gold
Buffer, 1.5 mM di MgCl2, 200 mM dNTPs, 200 nM of forward and reverse primer
mix, 1.25 U of AmpliTaq Gold DNA Polymerase (Applied Biosystems). The thermal
cycle profile employed a 5-min denaturing step at 94C, followed by 35 cycles at
94C for 45 sec, 56C to 60C for 45 sec, 72C for 45 sec, and a final extension step
of 5 min at 72C. Primer sequences (forward and reverse) used to obtain
amplicons containing the gene sequences to be tested and the type of mutations
analyzed for each gene, are shown in Table 1. Quality and dosage of PCR products
were assessed on the Bioanalyzer instrument (Agilent Technologies) following
the manufacturer’s standard protocol. PCR amplicons were purified using QIA-
quick PCR purification kit according to the manufacturer’s specifications (Qia-
gen). To perform DNA sequencing, purified amplicons were labeled with BigDye
Terminator v3.1 Cycle Sequencing Kit following the manufacturer’s standard
protocol (Applied Biosystems). The thermal cycle profile employed a 1-min
denaturing step at 96C, followed by 25 cycles at 96C for 10 sec, 54C for 5
sec, 60C for 3 min. Labeled samples were purified with X-terminator purification
kit according to manufacturer’s standard protocol and loaded in 3500-Dx Genetic
Analyzer (Applied Biosystems) for separation by capillary electrophoresis. Elec-
tropherograms and sequence files were analyzed using Sequencing Analysis and
SeqScape softwares (Applied Biosystems).
The primer sequences selected for PCR reactions, the types of mutations
detected for each gene and their relative protein codon localizations are shown in
Table 1. Mutational analysis revealed a wild-type genotype for all sequences
tested.
Written informed consent was obtained from the patient for publication of
this case report and any accompanying images. A copy of the written consent is
available for review by the editor-in-chief of this journal. The informed consent
according to the Helsinki Declaration and the study were approved by the Ethical
Committee of the San Raffaele G. Giglio Hospital, Cefalu, Italy (CE 2012/127).
Conclusions
A healthy diet contains enough thiamine levels. Today, beri-
beri occurs mostly in patients who abuse alcohol because
drinking does not allow thiamine absorption and storage [30].
Thiamine deficiency may occur in the presence of a defect of its
intracellular transport or clearance. Individuals with genetic
variants of thiamine transporters genes SLC19 A2 and SLC19 A3
may be particularly susceptible to thiamine deficiency [7,8]. The
Table 1
Primer sequences selected for PCR reactions, number of amplicons obtained for SLC19 A1, SLC19 A2, and SLC25 A19 genes, types of mutations detected, and relative protein
codon localization
Gene symbol Oligos Sequence (forward
and reverse 5’-3’)
Missense codon n
Nonsense
codon n
Small insertion
codon n
Small deletion
codon n
Splicing
intron n
Small indels
codon n
SLC19 A2 amplicon 1 F: Gtcgcgaatgctggttctt
R: Cagtcacgctaagccacatt
41.51 66
SLC19 A2 amplicon 2 F: Ccaggtcttcaatgaaatttatcc
R: Cagcaaaagccactgaaaca
93, 138, 143, 158, 172 162
SLC19 A2 amplicon 3 F: Tgtcctagggcaaatccttg
R: Ccatagcttgaatgaatgaatga
201, 230 233
SLC19 A2 amplicon 4 F: Acctgccagagagtgaatgg
R: Ccaagagggagtttgctgtt
250
SLC19 A2 amplicon 5 F: Tgggcctgtaaattgctttc
R: Cccaccacgaccctctatta
355
SLC19 A2 amplicon 6 F: GcaacagcatttgtgtagcaR:
Tgagccaaaatacatacgttgc
358
SLC19 A2 amplicon 7 F: Ccaggtcttcaatgaaatttatcc
R: Cagcaaaagccactgaaaca
95, 142 151, 188
SLC19 A2 amplicon 8 F: Acctgccagagagtgaatgg
R:ccaagagggagtttgctgtt
253 241, 252
SLC19 A2 amplicon 9 F: Tgggcctgtaaattgctttc
R: Cccaccacgaccctctatta
294
SLC19 A2 amplicon 10 F: Gcaacagcatttgtgtagca
R: Tgagccaaaatacatacgttgc
390 368, 382
SLC19 A2 amplicon 11 F: Gcgcagaacaagactccatc
R: Aggcaatttcagtggctgtg
80
SLC19 A2 amplicon 12 F: Ctggtcaacttggggagaaa
R: Aaggccactggcatctacc
4
SLC19 A3 amplicon 1 F: Ccatggattgttacagaacttca
R: Ctctgcactggtcaggttttt
23, 44 24
SLC19 A3amplicon 2 F: Ggctgtgaagagcagaaacc
R: Gacggggtttcactgcattag
320
SLC19 A3amplicon 3 F: Ctgaatgtggaacgctatgc
R: Aaggttgagaaatttttgaggtt
422
SLC19 A3 amplicon 4 F: Ccacattcaggtcgatcaca
R: Tgcaattgactaaaatccttctga
3
SLC25 A19 amplicon 1 F: Tgttccagggctaaaaccac
R: Ggtctttgattcggacagga
125
SLC25 A19 amplicon 2 F: Gggtcacgggtgatgtattt
R: Tgcatgacagagcgagattc
177
PCR, polymerase chain reaction
V. Bravata et al. / Nutrition 30 (2014) 485–488 487

4. aim of this study was to assess some of the potential traits of
genetic susceptibility to thiamine deficiency in an incidental dry
beriberi patient.
Sequencing analysis of the known SLC19 A2, SLC19 A3, and
SLC25 A19 thiamine-related mutations showed a wild-type ge-
notype for all sequences tested. We cannot exclude that other
known or unknown mutations, in the same genes or in other
thiamine-associated ones, may foster the occurrence of this
nutritional neuropathy. Additionally, thiamine utilization by
neuronal and others cells included transport but also various
events such as dephosphorylation, regulation of gene expression,
enzyme assembly, under the control of other specific protein
families [31]. It is therefore possible to hypothesize the in-
volvement of factors, not yet studied, in other steps of thiamine
metabolism that affects thiamine deficiency in beriberi disease.
This is the first genetic study of any kind in beriberi disease.
To our knowledge, no studies describe the possible associations
between gene mutations and beriberi disease. For this reason,
this field is still to be explored and clarified. Additionally, it
would be useful to use nutrigenetic studies to elucidate the
interaction between diet, genes, and disease with a common
ultimate goal to optimize health and to provide powerful ap-
proaches to understanding the complex relationship between
metabolites, genetic alterations, and the biological system as
a whole.
References
[1] Patterson MC. From stargazing chicks to seizing infants: Thiamine defi-
ciency redux. Neurology 2009;73:824–5.
[2] Singleton CK, Martin PR. Molecular mechanisms of thiamine utilization.
Curr Mol Med 2001;1:197–207.
[3] Hazell AS, Todd KG, Butterworth RF. Mechanisms of neuronal cell death in
Wernicke’s encephalopathy. Metab Brain Dis 1998;13:97–122.
[4] Gibson GE, Zhang H. Interactions of oxidative stress with thiamine ho-
meostasis promote neurodegeneration. Neurochem 2002;40:493–504.
[5] Ke ZJ, De Giorgio LA, Volpe BT, Gibson GE. Reversal of thiamine deficiency-
induced neurodegeneration. J Neuropathol Exp Neurol 2003;62:195–207.
[6] Guerrini I, Thomson AD, Gurling HM. Molecular genetics of alcohol-related
brain damage. Alcohol Alcohol 2009;44:166–70.
[7] Cole PD, Kamen BA. “Beriberi” interesting! J Pediatr Hematol Oncol 2003;
25:924–6.
[8] Scharfe C, Hauschild M, Klopstock T, Janssen AJ, Heidemann PH,
Meitinger T, et al. A novel mutation in the thiamine responsive megalo-
blastic anaemia gene SLC19 A2 in a patient with deficiency of respiratory
chain complex I. J Med Genet 2000;37:669–73.
[9] Ganapathy V, Smith SB, Prasad PD. SLC19: The folate/thiamine transporter
family. Pflugers Arch-Eur J Physiol 2004;447:641–6.
[10] Diaz GA, Banikazemi M, Oishi K, Desnick RJ, Gelb BD. Mutations in a new
gene encoding a thiamine transporter cause thiamine-responsive mega-
loblastic anaemia syndrome. Nat Genet 1999;22:309–12.
[11] Dutta B, Huang W, Molero M, Kekuda R, Leibach FH, Devoe LD, et al. Cloning
of the human thiamine transporter, a member of the folate transporter
family. J Biol Chem 1999;274:31925–9.
[12] Fleming JC, Tartaglini E, Steinkamp MP, Schorderet DF, Cohen N, Neufeld EJ.
The gene mutated in thiamineresponsive anaemia with diabetes and
deafness (TRMA) encodes a functional thiamine transporter. Nat Genet
1999;22:305–8.
[13] Labay V, Raz T, Baron D, Mandel H, Williams H, Barrett T, et al. Mutations in
SLC19 A2 cause thiamine responsive megaloblastic anaemia associated
with diabetes mellitus and deafness. Nat Genet 1999;22:300–4.
[14] Oishi K, Hofmann S, Diaz GA, Brown T, Manwani D, Ng L, et al. Targeted
disruption of SLC19 a2, the gene encoding the high affinity thiamin
transporter Thtr-1, causes diabetes mellitus, sensorineural deafness and
megaloblastosis in mice. Hum Mol Genet 2002;11:2951–60.
[15] Neufeld EJ, Fleming JC, Tartaglini E, Steinkamp MP. Thiamine-responsive
megaloblastic anemia syndrome: A disorder of high-affinity thiamine
transport. Blood Cells Mol Dis 2001;27:135–8.
[16] Bergmann AK, Sahai I, Falcone JF, Fleming J, Bagg A, Borgna-Pignati C, et al.
Thiamine-responsive megaloblastic anemia: Identification of novel com-
pound heterozygotes and mutation update. Pediatr 2009;155:888–92.
[17] Eudy JD, Spiegelstein O, Barber RC, Wlodarczyk BJ, Talbot J, Finnell RH.
Identification and characterization of the human and mouse SLC19 A3
gene: A novel member of the reduced folate family of micronutrient
transporter genes. Mol Genet Metab 2000;71:581–90.
[18] Zeng WQ, Al-Yamani E Jr, Acierno JS, Slaugenhaupt S, Gillis T, MacDonald ME,
et al. Biotin-responsive basal ganglia disease maps to 2 q36.3 and is due to
mutations in SLC19 A3. Am J Hum Genet 2005;77:16–26.
[19] Lindhurst MJ, Fiermonte G, Song S, Struys E, De Leonardis F,
Schwartzberg PL, et al. Knockout of Slc25 a19 causes mitochondrial thia-
mine pyrophosphate depletion, embryonic lethality, CNS malformations,
and anemia. Proc Natl Acad Sci U S A 2006;103:15927–32.
[20] Palmieri F. Diseases caused by defects of mitochondrial carriers: A review.
Biochem Biophys Acta 2008;1777:564–78.
[21] Rindi G, Patrini C. Thiamin. Encylcopedia of dietary supplements 2005;1:
677–86.
[22] Kelley RI, Robinson D, Puffenberger EG, Strauss KA, Morton DH. Amish lethal
microcephaly: A new metabolic disorder with severe congenital micro-
cephaly and 2-ketoglutaric aciduria. Am J Med Genet 2002;112:318–26.
[23] Siu VM, Ratko S, Prasad AN, Prasad C, Rupar CA. Amish microcephaly:
Long-term survival and biochemical characterization. Am J Med Genet A
2010;152:1747–51.
[24] Spiegel R, Shaag A, Edvardson S, Mandel H, Stepensky P, Shalev SA, et al.
SLC25 A19 Mutation as a cause of neuropathy and bilateral striatal necrosis.
Ann Neurol 2009;66:419–24.
[25] Harper C. The neuropathology of alcohol-related brain damage. Alcohol
Alcohol 2009;44(2):136–40.
[26] Faigle R, Mohme M, Levy M. Dry beriberi mimicking Guillain-Barre syn-
drome as the first presenting sign of thiamine deficiency. Eur J Neurol
2012;19:e14–5.
[27] Howard AJ, Kulkarni O, Lekwuwa G, Emsley HC. Rapidly progressive pol-
yneuropathy due to dry beriberi in a man: A case report. J Med Case Rep
2010;21(4):409.
[28] Koike H, Ito S, Morozumi S, Kawagashira Y, Iijima M, Hattori N, et al.
Rapidly developing weakness mimicking Guillain-Barre syndrome in
beriberi neuropathy: Two case reports. Nutrition 2008;24:776–80.
[29] Bohrer D, Cıcero do Nascimento P, Ramirez AG, MendoncA JKA, de
Carvalho LM, Pomblum SCG. Determination of thiamine in blood serum
and urine by high-performance liquid chromatography with direct injec-
tion and post-column derivatization. Microchem J 2004;78:71–6.
[30] Koppel BS. Nutrition and alcohol-related neurologic disorders. In:
Goldman L, Schafer AI, editors. Cecil medicine. 24th ed. Philadelphia, Pa:
Saunders Elsevier; 2011.
[31] Lieberman MC, Tartaglini E, Fleming JC, Neufeld EJ. Deletion of SLC19 A2,
the high affinity thiamine transporter, causes selective inner hair cell loss
and an auditory neuropathy phenotype. J Assoc Res Otolaryngol 2006;7:
211–7.
V. Bravata et al. / Nutrition 30 (2014) 485–488488