SlideShare ist ein Scribd-Unternehmen logo
1 von 52
Bioinformatics: Intro to RNA-Seq
                         Analysis

                   Integrated Learning Session
                           Daniel Gaston, PhD
 Dr. Karen Bedard Lab, Department of Pathology

                           December 6th, 2012
Overview
   Introduction
       Considerations for RNA-Seq
       Computational Resources/Options
   Analysis of RNA-Seq Data
       Principle of analyzing RNA-Seq
       General RNA-Seq analysis pipeline
       “Tuxedo” pipeline
       Alternative tools
   Resources
       http://www.slideshare.net/DanGaston
Before You Start: Considerations for RNA-
Seq Analysis
   Next-Generation Sequencing experiments generate
    a lot of raw data
       25-40 GB/sample/replicate for most transcriptomes/tissue
        types/cell lines/conditions

   Require more computational resources than many
    labs routinely have available for analyse data
       At minimum several processing “cores” (8 minimum)
       Large amount of RAM (16GB+)
       Large amount of disk storage space for intermediate and
        final results files in addition to raw FastQ files
       Can be a significant amount of time per sample (days to
        week)
Computational Options
   Local (Large workstation or cluster)
   Remote Computer/Cluster
    (ComputeCanada/ACENet)
   Cloud Services
       Amazon Web Services
   Cloud/Local Bioinformatics „Portals”
       Galaxy
       Chipster
       GenomeSpace
       CloudBioLinux
       CloudMan
       BioCloudCentral (Interface to CloudMan, CloudBioLinux,
        etc)
RNA-Seq Analysis Workflow
So I Ran an RNA-Seq Experiment. Now
What?
   Need to go from raw “read” data to gene expression
    data
   We now have:
       De-multiplexed fastq files for each individual sample and
        replicate
   We want lists of:
       Differentially expressed genes/transcripts
       Potentially novel genes/transcripts
       Potentially novel splice junctions
       Potential fusion events
   Organize your data, programs, and additional
    resources (discussed later)
What is the Raw Data
   A single lane of Illumina HiSeq 2000 sequencing
    produces ~ 250 – 300 million “reads” of sequencing
   Can be paired or single-end sequencing (paired-end
    preferred)
   Various sequencing lengths (number of sequencing
    cycles)
       2x50bp, 2x75bp, 2x100bp, 2x150bp most common
       Cost versus amount of usable data
   True raw data is actually image data with colour
    intensities that are then converted into text (A, C, G,
    T and quality scores) called FastQ
FastQ
@M00814:1:000000000-A2472:1:1101:14526:1866 1:N:0:1
TGGAACATGCGTGCGNAGCCGAAAGTGTGTCCCCACTTTCATATGAAGAAAGAC
+
?????BBBBB9?+<+#,,6C>CAEEHHHFFHHHHFEHHHHHHHHHGHHHHHHHHHH


   FASTA format file with a header line, sequence line, and
    quality scores for every base in the sequenced read
   In Paired-End Sequencing one file for each “end” of
    sequencing (Primer 1 and Primer 2)
   Qualities scores are encoded with a single character
    representing a number. Most common encoding scheme
    is called Phred33. Old Illumina software used Phred64
    but current generation does not. (Illumina 1.3 – 1.7 is
    Phred64)
       Often needs to be set explicitly in alignment programs
General Analysis Pipeline

         Short-Read Alignment


        Transcript Reconstruction


         Abundance/Expression


        Visualization / Statisticss
What is Short-Read Alignment?




Paired-End Reads


Section of Reference
Chromosome
What’s Special About RNA-Seq


   Normally distance between paired-reads and size of
    insertions both constrained
   With RNA-Seq the source is mRNA, not genomic
    DNA
   Mapping to a reference genome, not transcriptome
   Need to account for introns, pairs can be much
    further apart than expected
Transcript Reconstruction: Intron/Exon
Junctions




Exon1               Exon 2               Exon 3
Transcript Reconstruction: Alternative
Splicing




Exon1                Exon 2              Exon 3
Transcript Reconstruction: Novel
Exon/Transcript Identification




Exon1               Exon 2     Exon X   Exon 3
Transcript Reconstruction: Fusion
Transcripts




Exon1                Exon 2         Exon 3




                 Gene 2 Exon 4
Transcript Reconstruction: Differential
Expression

                   Sample 1




                   Sample 2
What else can we look for?
   Combine with ChiP-Seq to differentiate various
    levels of regulation
   Integrative analyses to identify common elements
    (micro-RNA, transcription factors, molecular
    pathways, protein-DNA interactions)
   Combine with whole-exome or whole-genome
    sequencing
       Allele-specific expression
       Allelic imbalance
       LOH
       Large genomic rearrangements/abnormalities
Caution
   Need to differentiate between real data and artifacts
   Differentiate between biologically meaningful data
    and “noise”
   Sample selection, experimental design, biological
    replication (not technical replication), and robust
    statistical methods are important
   Looking at your data “by eye” is useful, but needs to
    be backed up by stats
   Avoid experimenter bias
   Try and be holistic in your analyses
Visualizing with IGV
“Tuxedo” Analysis Pipeline

                         Bowtie


                         Tophat


                       Cufflinks
      Cufflinks   Cuffcompare   Cuffmerge   Cuffdiff




                  CummeRbund
What you need before you begin
   The individual programs
   Reference genome (hg19/GRCh37)
       FASTA file of whole genome, each chromosome is a
        sequence entry
   Bowtie2 Index files for reference genome
       Index files are compressed representations of the
        genome that allow assembly to the reference efficiently
        and in parallel
   Gene/Transcript annotation reference (UCSC,
    Ensembl, ENCODE, etc)
       Gives information about the location of genes and
        important features such as location of introns, exons,
        splice junctions, etc
Step 0: Bowtie
   Bowtie forms the core of TopHat for short-read
    alignment
   Initial mapping of subset of reads (~5 million) to a
    reference transcriptome to estimate inner-distance
    mean/median and standard deviation for tophat
   This info can be retrieved from the library prep stage
    but is actually better to estimate from your final data
   Sample command-line:

    bowtie –x /path/to/transcriptome_ref.fa –q –phred33 –local –p 8 -1
    read1.fastq -2 read2.fastq –S output.sam
Step 1: Tophat
   Tophat is a short-read mapper capable of aligning
    reads to a reference genome and finding exon-exon
    junctions
   Can be provided a list of known junctions, do de
    novo junction discovery, or both
   Also has an option to find potential fusion-gene
    transcripts
   Sample command-line:

    tophat –p 8 –G gene_annotations.gtf –r inner_distance –mate-std-dev
    std_dev –o Output.dir /path/to/bowtie2indexes/genome read1.fastq
    read2.fastq
About TopHat Options
   -o: The path/name of a directory in which to place all
    of the TopHat output files
   -G path to and name of an annotation file so TopHat
    can be aware of known junctions
   Reference Genome: Given as path and “base
    name.” If reference genome saved as:
    /genomes/hg19/genome.fa then the relevant path
    and basename would be /genomes/hg19/genome
   Inner Distance = Fragment size – (2 x read length)
TopHat: Additional options
   --no-mixed
   --b2-very-sensitive
   --fusion-search
   Running above options on 6 processing cores on
    one sample took ~26 hours
Step 2: Cufflinks
   Cufflinks performs gene and transcript discovery
   Many possible options
       No novel discovery, use only a reference group of
        transcripts
       de novo mode (shown below, beginner‟s default)
       Mixed Reference-Guided Assembly and de novo
        discovery.
       Options for more robust normalization methods and error
        correction
   Sample command-line:

    cufflinks –p 8 –o Cufflinks.out/ accepted_hits.bam
Step 3: Cuffmerge
   Merges sample assemblies, estimate abundances,
    clean up transcriptome
   Sample command-line:

    cuffmerge –g gene_annotations.gtf –s /path/to/genome.fa –p 8
    text_list_of_assemblies.txt
Step 4: Cuffdiff
   Calculates expression levels of transcripts in
    samples
   Estimates differential expression between samples
   Calculates significance value for difference in
    expression levels between samples
   Also groups together transcripts that all start from
    same start site. Identify genes under
    transcriptional/post-transcriptional regulation
   Sample command-line:

    cuffdiff –o Output.dir/ –b /path/to/genome.fa –p 8 –L Cond1,Cond2 –u
    merged.gtf cond1.bam cond2.bam
Cuffdiff Output
   FPKM values for genes, isoforms, CDS, and groups of
    genes from same Transcription Start Site for each
    condition
       FPKM is the normalized “expression value” used in RNA-Seq
   Count files of above
   As above but on a per replicate basis
   Differential expression test results for genes, CDS,
    primary transcripts, spliced transcripts on a per sample
    (condition) comparison basis (Each possible X vs Y
    comparison unless otherwise specified)
       Includes identifiers, expression levels, expression difference
        values, p-values, q-values, and yes/no significance field
   Differential splicing tests, differential coding output,
    differential promoter use
Step 5: CummeRbund (R)




                         Trapnell et al., 2012
Visualization




                Trapnell et al., 2012
Help!
   Command X failed
       Keep calm
       Don‟t blame the computer
       Check input files and formats
       Google/SeqAnswers/Biostars
   Results looks “weird”
       Check the raw data
       Re-check the commands you used
   RNA-Seq analysis is an experiment:
       Maintain good records of what you did, like any other
        experiment
Alternative tools
   Alternative short-read alignment
       BWA -> Can not align RNA-Seq data
       GSNAP
       STAR -> Requires minimum of 30GB of RAM
   Alternative transcript reconstruction
       STAR
       Scripture
   Alternative Expression/Abundance Estimation
       DESeq
       DEXSeq
       edgeR
Resources
Software Websites
   TopHat          http://tophat.cbcb.umd.edu
   Cufflinks       http://cufflinks.cbcb.umd.edu
   STAR            http://gingeraslab.cshl.edu/STAR/
   Scripture

http://www.broadinstitute.org/software/scripture/

   Bioconductor    http://www.bioconductor.org/
       DEXSeq
       DESeq
       edgeR
   Blah
Additional Resources
   Differential gene and transcript expression analysis
    of RNA-Seq Experiments with TopHat and Cufflinks
    (2012) Nature Protocols. 7(3)
   www.biostars.org (Q&A site)
   SeqAnswers Forum
   GENCODE Gene Annotations
       http://www.gencodegenes.org/
       ftp://ftp.sanger.ac.uk/pub/gencode
   TopHat / Illumina iGenomes References and
    Annotation Files:
       http://tophat.cbcb.umd.edu/igenomes.html
Acknowledgements
   Dalhousie University          Dr. Graham Dellaire
       Dr. Karen Bedard          Montgomery Lab
       Dr. Chris McMaster         Stanford
       Dr. Andrew Orr                Dr. Stephen Montgomery
       Dr. Conrad Fernandez
                                  BHCRI CRTP Skills
       Dr. Marissa Leblanc
                                   Acquisition Program
       Mat Nightingale
       Bedard Lab
       IGNITE
Experimental Data for Genes of
                       Interest
UCSC Genome Browser
UCSC Genome Browser
MetabolicMine
MetabolicMine
NCI Pathway Interaction Database
The Cancer Genome Atlas
   Identify cancer subtypes, actionable driver
    mutations, personalized/genomic/precision medicine
   More than $275 million in funding from NIH
   Multiple research groups around the world
   20 cancer types being studied
   205 publications from the research network since
    late 2008
The Cancer Genome Atlas
The Cancer Genome Atlas
The Cancer Genome Atlas
UNIX/Linux command-line basics
What is UNIX?
   UNIX and UNIX-Like are a family of computer
    operating systems originally developed at AT&T‟s
    Bell Labs
       Apple OS X and iOS (UNIX)
       Linux (UNIX-Like)
Intro
   The terminal (command-line) isn‟t THAT scary.
    Maintaining a Linux environment can be challenging,
    but most of these analyses can also be done in an
    OS X environment
   Installing software can sometimes be cumbersome
    and confusing, however many standard
    bioinformatics programs and software libraries are
    fairly easy to set-up
   Working with the programs from the command-line
    will often give you a better appreciation for what the
    program does and what it requires
Terms to Know
   Path: The location of a directory, file, or command on
    the computer.
       Example: /Users/dan (OS X home directory)
The Commands You Need to Know
   ls: Lists the files in the current directory. Directories
    (folders) are just a special type of file themselves
   cd: Change directory
   pwd: View the full path of the directory you are
    currently in
   cat: Displays the contents of a file on the terminal
    screen
   head / tail : Displays the top or bottom contents of a
    file to the screen respectively

Weitere ähnliche Inhalte

Was ist angesagt?

LUGM-Update of the Illumina Analysis Pipeline
LUGM-Update of the Illumina Analysis PipelineLUGM-Update of the Illumina Analysis Pipeline
LUGM-Update of the Illumina Analysis Pipeline
Hai-Wei Yen
 

Was ist angesagt? (20)

Part 1 of RNA-seq for DE analysis: Defining the goal
Part 1 of RNA-seq for DE analysis: Defining the goalPart 1 of RNA-seq for DE analysis: Defining the goal
Part 1 of RNA-seq for DE analysis: Defining the goal
 
BITS - Comparative genomics: the Contra tool
BITS - Comparative genomics: the Contra toolBITS - Comparative genomics: the Contra tool
BITS - Comparative genomics: the Contra tool
 
LUGM-Update of the Illumina Analysis Pipeline
LUGM-Update of the Illumina Analysis PipelineLUGM-Update of the Illumina Analysis Pipeline
LUGM-Update of the Illumina Analysis Pipeline
 
Part 2 of RNA-seq for DE analysis: Investigating raw data
Part 2 of RNA-seq for DE analysis: Investigating raw dataPart 2 of RNA-seq for DE analysis: Investigating raw data
Part 2 of RNA-seq for DE analysis: Investigating raw data
 
Rna seq
Rna seq Rna seq
Rna seq
 
ChipSeq Data Analysis
ChipSeq Data AnalysisChipSeq Data Analysis
ChipSeq Data Analysis
 
RNA-seq: Mapping and quality control - part 3
RNA-seq: Mapping and quality control - part 3RNA-seq: Mapping and quality control - part 3
RNA-seq: Mapping and quality control - part 3
 
diffReps: automated ChIP-seq differential analysis package
diffReps: automated ChIP-seq differential analysis packagediffReps: automated ChIP-seq differential analysis package
diffReps: automated ChIP-seq differential analysis package
 
RNA-seq for DE analysis: extracting counts and QC - part 4
RNA-seq for DE analysis: extracting counts and QC - part 4RNA-seq for DE analysis: extracting counts and QC - part 4
RNA-seq for DE analysis: extracting counts and QC - part 4
 
Exome Sequencing
Exome SequencingExome Sequencing
Exome Sequencing
 
An introduction to RNA-seq data analysis
An introduction to RNA-seq data analysisAn introduction to RNA-seq data analysis
An introduction to RNA-seq data analysis
 
Part 5 of RNA-seq for DE analysis: Detecting differential expression
Part 5 of RNA-seq for DE analysis: Detecting differential expressionPart 5 of RNA-seq for DE analysis: Detecting differential expression
Part 5 of RNA-seq for DE analysis: Detecting differential expression
 
Tips for effective use of BLAST and other NCBI tools
Tips for effective use of BLAST and other NCBI toolsTips for effective use of BLAST and other NCBI tools
Tips for effective use of BLAST and other NCBI tools
 
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
NGS Targeted Enrichment Technology in Cancer Research: NGS Tech Overview Webi...
 
How giab fits in the rest of the world seqc2 tumor normal
How giab fits in the rest of the world   seqc2 tumor normalHow giab fits in the rest of the world   seqc2 tumor normal
How giab fits in the rest of the world seqc2 tumor normal
 
The Clinical Significance of Transcript Alignment Discrepancies
The Clinical Significance of Transcript Alignment DiscrepanciesThe Clinical Significance of Transcript Alignment Discrepancies
The Clinical Significance of Transcript Alignment Discrepancies
 
A Tovchigrechko - MGTAXA: a toolkit and webserver for predicting taxonomy of ...
A Tovchigrechko - MGTAXA: a toolkit and webserver for predicting taxonomy of ...A Tovchigrechko - MGTAXA: a toolkit and webserver for predicting taxonomy of ...
A Tovchigrechko - MGTAXA: a toolkit and webserver for predicting taxonomy of ...
 
New methods diploid assembly with graphs
New methods   diploid assembly with graphsNew methods   diploid assembly with graphs
New methods diploid assembly with graphs
 
Analysis of ChIP-Seq Data
Analysis of ChIP-Seq DataAnalysis of ChIP-Seq Data
Analysis of ChIP-Seq Data
 
Genome in a Bottle
Genome in a BottleGenome in a Bottle
Genome in a Bottle
 

Ähnlich wie Dgaston dec-06-2012

RNA-Seq_Presentation
RNA-Seq_PresentationRNA-Seq_Presentation
RNA-Seq_Presentation
Toyin23
 
Overview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence dataOverview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence data
Thomas Keane
 
20100516 bioinformatics kapushesky_lecture08
20100516 bioinformatics kapushesky_lecture0820100516 bioinformatics kapushesky_lecture08
20100516 bioinformatics kapushesky_lecture08
Computer Science Club
 

Ähnlich wie Dgaston dec-06-2012 (20)

Tools for Transcriptome Data Analysis
Tools for Transcriptome Data AnalysisTools for Transcriptome Data Analysis
Tools for Transcriptome Data Analysis
 
RNA-Seq_Presentation
RNA-Seq_PresentationRNA-Seq_Presentation
RNA-Seq_Presentation
 
RNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGSRNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGS
 
Rna seq pipeline
Rna seq pipelineRna seq pipeline
Rna seq pipeline
 
RNA-seq quality control and pre-processing
RNA-seq quality control and pre-processingRNA-seq quality control and pre-processing
RNA-seq quality control and pre-processing
 
Rnaseq forgenefinding
Rnaseq forgenefindingRnaseq forgenefinding
Rnaseq forgenefinding
 
Knowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and VariantsKnowing Your NGS Upstream: Alignment and Variants
Knowing Your NGS Upstream: Alignment and Variants
 
Apollo Collaborative genome annotation editing
Apollo Collaborative genome annotation editing Apollo Collaborative genome annotation editing
Apollo Collaborative genome annotation editing
 
RNA-Seq
RNA-SeqRNA-Seq
RNA-Seq
 
rnaseq2015-02-18-170327193409.pdf
rnaseq2015-02-18-170327193409.pdfrnaseq2015-02-18-170327193409.pdf
rnaseq2015-02-18-170327193409.pdf
 
RNA-seq differential expression analysis
RNA-seq differential expression analysisRNA-seq differential expression analysis
RNA-seq differential expression analysis
 
20140711 4 e_tseng_ercc2.0_workshop
20140711 4 e_tseng_ercc2.0_workshop20140711 4 e_tseng_ercc2.0_workshop
20140711 4 e_tseng_ercc2.0_workshop
 
Sequence assembly
Sequence assemblySequence assembly
Sequence assembly
 
Introduction to Apollo for i5k
Introduction to Apollo for i5kIntroduction to Apollo for i5k
Introduction to Apollo for i5k
 
Overview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence dataOverview of methods for variant calling from next-generation sequence data
Overview of methods for variant calling from next-generation sequence data
 
20100516 bioinformatics kapushesky_lecture08
20100516 bioinformatics kapushesky_lecture0820100516 bioinformatics kapushesky_lecture08
20100516 bioinformatics kapushesky_lecture08
 
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsUsing VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research Workflows
 
Using VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research WorkflowsUsing VarSeq to Improve Variant Analysis Research Workflows
Using VarSeq to Improve Variant Analysis Research Workflows
 
Thesis biobix
Thesis biobixThesis biobix
Thesis biobix
 
Apollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research CommunityApollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research Community
 

Mehr von Dan Gaston

Genomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and PathologyGenomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and Pathology
Dan Gaston
 

Mehr von Dan Gaston (11)

Population and evolutionary genetics 1
Population and evolutionary genetics 1Population and evolutionary genetics 1
Population and evolutionary genetics 1
 
2016 ngs health_lecture
2016 ngs health_lecture2016 ngs health_lecture
2016 ngs health_lecture
 
Human genetics evolutionary genetics
Human genetics   evolutionary geneticsHuman genetics   evolutionary genetics
Human genetics evolutionary genetics
 
Genomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and PathologyGenomics, Bioinformatics, and Pathology
Genomics, Bioinformatics, and Pathology
 
2015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and22015 Bioc4010 lecture1and2
2015 Bioc4010 lecture1and2
 
2016 Dal Human Genetics - Genomics in Medicine Lecture
2016 Dal Human Genetics - Genomics in Medicine Lecture2016 Dal Human Genetics - Genomics in Medicine Lecture
2016 Dal Human Genetics - Genomics in Medicine Lecture
 
Bioc4700 2014 Guest Lecture
Bioc4700   2014 Guest LectureBioc4700   2014 Guest Lecture
Bioc4700 2014 Guest Lecture
 
Protein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human HealthProtein Evolution: Structure, Function, and Human Health
Protein Evolution: Structure, Function, and Human Health
 
Bioc4010 sample questions
Bioc4010 sample questionsBioc4010 sample questions
Bioc4010 sample questions
 
Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2Bioc4010 lectures 1 and 2
Bioc4010 lectures 1 and 2
 
Bioinformatics in Gene Research
Bioinformatics in Gene ResearchBioinformatics in Gene Research
Bioinformatics in Gene Research
 

Kürzlich hochgeladen

Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
vu2urc
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
Earley Information Science
 

Kürzlich hochgeladen (20)

The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your Business
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdfThe Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
The Role of Taxonomy and Ontology in Semantic Layers - Heather Hedden.pdf
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
Breaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountBreaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path Mount
 
Histor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slideHistor y of HAM Radio presentation slide
Histor y of HAM Radio presentation slide
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men
 
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 

Dgaston dec-06-2012

  • 1. Bioinformatics: Intro to RNA-Seq Analysis Integrated Learning Session Daniel Gaston, PhD Dr. Karen Bedard Lab, Department of Pathology December 6th, 2012
  • 2. Overview  Introduction  Considerations for RNA-Seq  Computational Resources/Options  Analysis of RNA-Seq Data  Principle of analyzing RNA-Seq  General RNA-Seq analysis pipeline  “Tuxedo” pipeline  Alternative tools  Resources  http://www.slideshare.net/DanGaston
  • 3. Before You Start: Considerations for RNA- Seq Analysis  Next-Generation Sequencing experiments generate a lot of raw data  25-40 GB/sample/replicate for most transcriptomes/tissue types/cell lines/conditions  Require more computational resources than many labs routinely have available for analyse data  At minimum several processing “cores” (8 minimum)  Large amount of RAM (16GB+)  Large amount of disk storage space for intermediate and final results files in addition to raw FastQ files  Can be a significant amount of time per sample (days to week)
  • 4. Computational Options  Local (Large workstation or cluster)  Remote Computer/Cluster (ComputeCanada/ACENet)  Cloud Services  Amazon Web Services  Cloud/Local Bioinformatics „Portals”  Galaxy  Chipster  GenomeSpace  CloudBioLinux  CloudMan  BioCloudCentral (Interface to CloudMan, CloudBioLinux, etc)
  • 6. So I Ran an RNA-Seq Experiment. Now What?  Need to go from raw “read” data to gene expression data  We now have:  De-multiplexed fastq files for each individual sample and replicate  We want lists of:  Differentially expressed genes/transcripts  Potentially novel genes/transcripts  Potentially novel splice junctions  Potential fusion events  Organize your data, programs, and additional resources (discussed later)
  • 7. What is the Raw Data  A single lane of Illumina HiSeq 2000 sequencing produces ~ 250 – 300 million “reads” of sequencing  Can be paired or single-end sequencing (paired-end preferred)  Various sequencing lengths (number of sequencing cycles)  2x50bp, 2x75bp, 2x100bp, 2x150bp most common  Cost versus amount of usable data  True raw data is actually image data with colour intensities that are then converted into text (A, C, G, T and quality scores) called FastQ
  • 8. FastQ @M00814:1:000000000-A2472:1:1101:14526:1866 1:N:0:1 TGGAACATGCGTGCGNAGCCGAAAGTGTGTCCCCACTTTCATATGAAGAAAGAC + ?????BBBBB9?+<+#,,6C>CAEEHHHFFHHHHFEHHHHHHHHHGHHHHHHHHHH  FASTA format file with a header line, sequence line, and quality scores for every base in the sequenced read  In Paired-End Sequencing one file for each “end” of sequencing (Primer 1 and Primer 2)  Qualities scores are encoded with a single character representing a number. Most common encoding scheme is called Phred33. Old Illumina software used Phred64 but current generation does not. (Illumina 1.3 – 1.7 is Phred64)  Often needs to be set explicitly in alignment programs
  • 9. General Analysis Pipeline Short-Read Alignment Transcript Reconstruction Abundance/Expression Visualization / Statisticss
  • 10. What is Short-Read Alignment? Paired-End Reads Section of Reference Chromosome
  • 11. What’s Special About RNA-Seq  Normally distance between paired-reads and size of insertions both constrained  With RNA-Seq the source is mRNA, not genomic DNA  Mapping to a reference genome, not transcriptome  Need to account for introns, pairs can be much further apart than expected
  • 14. Transcript Reconstruction: Novel Exon/Transcript Identification Exon1 Exon 2 Exon X Exon 3
  • 17. What else can we look for?  Combine with ChiP-Seq to differentiate various levels of regulation  Integrative analyses to identify common elements (micro-RNA, transcription factors, molecular pathways, protein-DNA interactions)  Combine with whole-exome or whole-genome sequencing  Allele-specific expression  Allelic imbalance  LOH  Large genomic rearrangements/abnormalities
  • 18. Caution  Need to differentiate between real data and artifacts  Differentiate between biologically meaningful data and “noise”  Sample selection, experimental design, biological replication (not technical replication), and robust statistical methods are important  Looking at your data “by eye” is useful, but needs to be backed up by stats  Avoid experimenter bias  Try and be holistic in your analyses
  • 20. “Tuxedo” Analysis Pipeline Bowtie Tophat Cufflinks Cufflinks Cuffcompare Cuffmerge Cuffdiff CummeRbund
  • 21. What you need before you begin  The individual programs  Reference genome (hg19/GRCh37)  FASTA file of whole genome, each chromosome is a sequence entry  Bowtie2 Index files for reference genome  Index files are compressed representations of the genome that allow assembly to the reference efficiently and in parallel  Gene/Transcript annotation reference (UCSC, Ensembl, ENCODE, etc)  Gives information about the location of genes and important features such as location of introns, exons, splice junctions, etc
  • 22. Step 0: Bowtie  Bowtie forms the core of TopHat for short-read alignment  Initial mapping of subset of reads (~5 million) to a reference transcriptome to estimate inner-distance mean/median and standard deviation for tophat  This info can be retrieved from the library prep stage but is actually better to estimate from your final data  Sample command-line: bowtie –x /path/to/transcriptome_ref.fa –q –phred33 –local –p 8 -1 read1.fastq -2 read2.fastq –S output.sam
  • 23. Step 1: Tophat  Tophat is a short-read mapper capable of aligning reads to a reference genome and finding exon-exon junctions  Can be provided a list of known junctions, do de novo junction discovery, or both  Also has an option to find potential fusion-gene transcripts  Sample command-line: tophat –p 8 –G gene_annotations.gtf –r inner_distance –mate-std-dev std_dev –o Output.dir /path/to/bowtie2indexes/genome read1.fastq read2.fastq
  • 24. About TopHat Options  -o: The path/name of a directory in which to place all of the TopHat output files  -G path to and name of an annotation file so TopHat can be aware of known junctions  Reference Genome: Given as path and “base name.” If reference genome saved as: /genomes/hg19/genome.fa then the relevant path and basename would be /genomes/hg19/genome  Inner Distance = Fragment size – (2 x read length)
  • 25. TopHat: Additional options  --no-mixed  --b2-very-sensitive  --fusion-search  Running above options on 6 processing cores on one sample took ~26 hours
  • 26. Step 2: Cufflinks  Cufflinks performs gene and transcript discovery  Many possible options  No novel discovery, use only a reference group of transcripts  de novo mode (shown below, beginner‟s default)  Mixed Reference-Guided Assembly and de novo discovery.  Options for more robust normalization methods and error correction  Sample command-line: cufflinks –p 8 –o Cufflinks.out/ accepted_hits.bam
  • 27. Step 3: Cuffmerge  Merges sample assemblies, estimate abundances, clean up transcriptome  Sample command-line: cuffmerge –g gene_annotations.gtf –s /path/to/genome.fa –p 8 text_list_of_assemblies.txt
  • 28. Step 4: Cuffdiff  Calculates expression levels of transcripts in samples  Estimates differential expression between samples  Calculates significance value for difference in expression levels between samples  Also groups together transcripts that all start from same start site. Identify genes under transcriptional/post-transcriptional regulation  Sample command-line: cuffdiff –o Output.dir/ –b /path/to/genome.fa –p 8 –L Cond1,Cond2 –u merged.gtf cond1.bam cond2.bam
  • 29. Cuffdiff Output  FPKM values for genes, isoforms, CDS, and groups of genes from same Transcription Start Site for each condition  FPKM is the normalized “expression value” used in RNA-Seq  Count files of above  As above but on a per replicate basis  Differential expression test results for genes, CDS, primary transcripts, spliced transcripts on a per sample (condition) comparison basis (Each possible X vs Y comparison unless otherwise specified)  Includes identifiers, expression levels, expression difference values, p-values, q-values, and yes/no significance field  Differential splicing tests, differential coding output, differential promoter use
  • 30. Step 5: CummeRbund (R) Trapnell et al., 2012
  • 31. Visualization Trapnell et al., 2012
  • 32. Help!  Command X failed  Keep calm  Don‟t blame the computer  Check input files and formats  Google/SeqAnswers/Biostars  Results looks “weird”  Check the raw data  Re-check the commands you used  RNA-Seq analysis is an experiment:  Maintain good records of what you did, like any other experiment
  • 33. Alternative tools  Alternative short-read alignment  BWA -> Can not align RNA-Seq data  GSNAP  STAR -> Requires minimum of 30GB of RAM  Alternative transcript reconstruction  STAR  Scripture  Alternative Expression/Abundance Estimation  DESeq  DEXSeq  edgeR
  • 35. Software Websites  TopHat http://tophat.cbcb.umd.edu  Cufflinks http://cufflinks.cbcb.umd.edu  STAR http://gingeraslab.cshl.edu/STAR/  Scripture http://www.broadinstitute.org/software/scripture/  Bioconductor http://www.bioconductor.org/  DEXSeq  DESeq  edgeR  Blah
  • 36. Additional Resources  Differential gene and transcript expression analysis of RNA-Seq Experiments with TopHat and Cufflinks (2012) Nature Protocols. 7(3)  www.biostars.org (Q&A site)  SeqAnswers Forum  GENCODE Gene Annotations  http://www.gencodegenes.org/  ftp://ftp.sanger.ac.uk/pub/gencode  TopHat / Illumina iGenomes References and Annotation Files:  http://tophat.cbcb.umd.edu/igenomes.html
  • 37. Acknowledgements  Dalhousie University  Dr. Graham Dellaire  Dr. Karen Bedard  Montgomery Lab  Dr. Chris McMaster Stanford  Dr. Andrew Orr  Dr. Stephen Montgomery  Dr. Conrad Fernandez  BHCRI CRTP Skills  Dr. Marissa Leblanc Acquisition Program  Mat Nightingale  Bedard Lab  IGNITE
  • 38. Experimental Data for Genes of Interest
  • 44. The Cancer Genome Atlas  Identify cancer subtypes, actionable driver mutations, personalized/genomic/precision medicine  More than $275 million in funding from NIH  Multiple research groups around the world  20 cancer types being studied  205 publications from the research network since late 2008
  • 49. What is UNIX?  UNIX and UNIX-Like are a family of computer operating systems originally developed at AT&T‟s Bell Labs  Apple OS X and iOS (UNIX)  Linux (UNIX-Like)
  • 50. Intro  The terminal (command-line) isn‟t THAT scary. Maintaining a Linux environment can be challenging, but most of these analyses can also be done in an OS X environment  Installing software can sometimes be cumbersome and confusing, however many standard bioinformatics programs and software libraries are fairly easy to set-up  Working with the programs from the command-line will often give you a better appreciation for what the program does and what it requires
  • 51. Terms to Know  Path: The location of a directory, file, or command on the computer.  Example: /Users/dan (OS X home directory)
  • 52. The Commands You Need to Know  ls: Lists the files in the current directory. Directories (folders) are just a special type of file themselves  cd: Change directory  pwd: View the full path of the directory you are currently in  cat: Displays the contents of a file on the terminal screen  head / tail : Displays the top or bottom contents of a file to the screen respectively