SlideShare ist ein Scribd-Unternehmen logo
1 von 15
Downloaden Sie, um offline zu lesen
Inzicht in waterkwaliteit:
Een ‘wereld’ te ontdekken
Jan Hardeman
Sr. Account Manager Horticulture
Frank Hoeberichts
Product Manager Horticulture
Eurofins Horti
2
– Laboratorium in Wageningen
– Ongeveer 700.000 monsters per jaar
– Circa 250 werknemers
– 4 business units:
• Agro
• Manure
• Horti
• Field Services
Monitoring in uw kas
3
1. Uitgangswater
2. Water oplosbare meststoffen
3. Druppelwater
4. Gewasonderzoek
5. Substraatonderzoek
6. Drainwater
7. Waterzuivering  residu/pesticiden
8. Ontsmetter  microbiologie
Hoe is het microleven te bepalen in water?
4
– Uitplaten (kolonie-vormende eenheden): goede indicator van de
microbiologische activiteit met gebruik van voedingsbodems
– BodemlevenMonitor dmv gaschromatografie:
PLFA-analyse met behulp van GCMS techniek
– DNA Multiscan: monitoren van vooraf gedefinieerde
ziekteverwekkers
– DNA Microbioom analyses: al het leven op naam brengen
Uitplaten
5
BodemlevenMonitor
6
Proef: van der Knaap
0
1000
2000
3000
4000
mei juni juli augustus
mg
C/kg
Microbiële biomassa in kokos
mineraal organisch
‒ Absolute microbiële biomassa
‒ PLFA methode
‒ Meting bodemleven in categorieën:
• Gram-positief
• Actinomyceten
• Gram-negatief
• Saprofyten
• Mycorrhizae
• Protozoa
DNA analyses: Wat is het microbioom?
7
‒ Alle DNA van één organisme samen noemt
men het genoom
• Eén organisme
• Bijv. het menselijke genoom, het
tomaten-genoom
‒ Microbioom = het geheel aan soorten
micro-organismen in een bepaalde
levensgemeenschap, bijv:
• Darm-microbioom, bodem-microbioom
‒ Eén gram aarde bevat >1 miljard bacteriële
cellen
‒ Het belang van een “gezond” microbioom
wordt steeds meer erkend
Het meten van DNA kan op verschillende
manieren
8
‒ Polymerase chain reaction (PCR)
‒ Quantitative PCR (Q-PCR)
‒ Blotten (= DNA Multiscan)
‒ Sequencing (DNA volgorde bepalen)
• Sanger sequencing
• Next Generation Sequencing
(= Microbioom analyse)
DNA Multiscan
9
‒ DNA meting m.b.v. PCR + blot
‒ DNA van verschillende plant pathogenen is
aanwezig op membraan (blot)
‒ Indien plant pathogeen-DNA aanwezig in monster:
positief signaal = zwarte stip op blot
‒ Semi-kwantitatief: intensiteit spot wordt omgezet
naar score tussen 0 en 6
‒ Alleen detectie van vooraf geselecteerde
pathogenen
DNA Multiscan paketten
10
code naam
151 Paprika
152 Tomaat
153 Komkommer
154 Roos
155 Gerbera
159 Aardbei
160 DNA Previscan
161 Trichoderma
162 Glasgroente
163 Siergewassen
170 Glastuinbouw uitgebreid
171 Houtige gewassen
172 Gras- en sportvelden
174 Vollegrondsgewassen
183 Bacteriën
Zie voor de volledige lijst: www.eurofins-horti.com/nl-nl/dna-multiscan
Nieuw! - Microbioom analyse
11
Biologisch monster
DNA DNA fragmenten
DNA sequenties
Determinatie soort(en)
GTCTAGTAGCTAGCCGTG
AAGTGACACGATGCACGATTCGATG
CTTAACGTACGGATTCTATGAGTCAG
CTAGCTAGCTGTTACGTATCGT
TCATAGTTACGTATCGT
ACCATGATGCTATGTAGTAAGCCT
ACTCCGAGATTAATAGAATGGCCAG
Voorbeeld: gietwater vs. mat
12
‒ Overzicht samenstelling
microbioom
‒ Schimmels en bacteriën
‒ Genus- of soortniveau
‒ Relatief: % van het DNA dat
toebehoort aan organisme
Grip krijgen met analyses
13
Eurofins ontwikkelt:
– Meststoffen en biostimulanten analyses
(inhoudstoffen, nutriënten etc.)
– Pyrolyse methode (kwaliteit organische stof)
– DNA Microbioom analyses
Kunnen we microleven voeden met
specifieke (koolstof)bronnen uit substraat of
meststoffen/biostimulanten?
Wat zijn de relaties met weerbaarheid tegen
ziekteverwekkers?
Een ‘wereld’ te ontdekken
• Meer grip krijgen op samenspel van
chemische, fysische en biologische
processen rondom de wortel
Hartelijk dank voor uw aandacht
15
Jan Hardeman
Sr. Account Manager Horticulture
E: JanHardeman@eurofins.com
M: +31 (0)6 52002168
Frank Hoeberichts
Product Manager Horticulture
E: FrankHoeberichts@eurofins.com
M: +31 (0)6 153 412 38

Weitere ähnliche Inhalte

Empfohlen

Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
Kurio // The Social Media Age(ncy)
 
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them wellGood Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Saba Software
 

Empfohlen (20)

Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
Unlocking the Power of ChatGPT and AI in Testing - A Real-World Look, present...
 
12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work12 Ways to Increase Your Influence at Work
12 Ways to Increase Your Influence at Work
 
ChatGPT webinar slides
ChatGPT webinar slidesChatGPT webinar slides
ChatGPT webinar slides
 
More than Just Lines on a Map: Best Practices for U.S Bike Routes
More than Just Lines on a Map: Best Practices for U.S Bike RoutesMore than Just Lines on a Map: Best Practices for U.S Bike Routes
More than Just Lines on a Map: Best Practices for U.S Bike Routes
 
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
Ride the Storm: Navigating Through Unstable Periods / Katerina Rudko (Belka G...
 
Barbie - Brand Strategy Presentation
Barbie - Brand Strategy PresentationBarbie - Brand Strategy Presentation
Barbie - Brand Strategy Presentation
 
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them wellGood Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
Good Stuff Happens in 1:1 Meetings: Why you need them and how to do them well
 

Presentatie_Eurofins_-_Jan_Hardeman___Frank_Hoeberichts.pdf

  • 1. Inzicht in waterkwaliteit: Een ‘wereld’ te ontdekken Jan Hardeman Sr. Account Manager Horticulture Frank Hoeberichts Product Manager Horticulture
  • 2. Eurofins Horti 2 – Laboratorium in Wageningen – Ongeveer 700.000 monsters per jaar – Circa 250 werknemers – 4 business units: • Agro • Manure • Horti • Field Services
  • 3. Monitoring in uw kas 3 1. Uitgangswater 2. Water oplosbare meststoffen 3. Druppelwater 4. Gewasonderzoek 5. Substraatonderzoek 6. Drainwater 7. Waterzuivering  residu/pesticiden 8. Ontsmetter  microbiologie
  • 4. Hoe is het microleven te bepalen in water? 4 – Uitplaten (kolonie-vormende eenheden): goede indicator van de microbiologische activiteit met gebruik van voedingsbodems – BodemlevenMonitor dmv gaschromatografie: PLFA-analyse met behulp van GCMS techniek – DNA Multiscan: monitoren van vooraf gedefinieerde ziekteverwekkers – DNA Microbioom analyses: al het leven op naam brengen
  • 6. BodemlevenMonitor 6 Proef: van der Knaap 0 1000 2000 3000 4000 mei juni juli augustus mg C/kg Microbiële biomassa in kokos mineraal organisch ‒ Absolute microbiële biomassa ‒ PLFA methode ‒ Meting bodemleven in categorieën: • Gram-positief • Actinomyceten • Gram-negatief • Saprofyten • Mycorrhizae • Protozoa
  • 7. DNA analyses: Wat is het microbioom? 7 ‒ Alle DNA van één organisme samen noemt men het genoom • Eén organisme • Bijv. het menselijke genoom, het tomaten-genoom ‒ Microbioom = het geheel aan soorten micro-organismen in een bepaalde levensgemeenschap, bijv: • Darm-microbioom, bodem-microbioom ‒ Eén gram aarde bevat >1 miljard bacteriële cellen ‒ Het belang van een “gezond” microbioom wordt steeds meer erkend
  • 8. Het meten van DNA kan op verschillende manieren 8 ‒ Polymerase chain reaction (PCR) ‒ Quantitative PCR (Q-PCR) ‒ Blotten (= DNA Multiscan) ‒ Sequencing (DNA volgorde bepalen) • Sanger sequencing • Next Generation Sequencing (= Microbioom analyse)
  • 9. DNA Multiscan 9 ‒ DNA meting m.b.v. PCR + blot ‒ DNA van verschillende plant pathogenen is aanwezig op membraan (blot) ‒ Indien plant pathogeen-DNA aanwezig in monster: positief signaal = zwarte stip op blot ‒ Semi-kwantitatief: intensiteit spot wordt omgezet naar score tussen 0 en 6 ‒ Alleen detectie van vooraf geselecteerde pathogenen
  • 10. DNA Multiscan paketten 10 code naam 151 Paprika 152 Tomaat 153 Komkommer 154 Roos 155 Gerbera 159 Aardbei 160 DNA Previscan 161 Trichoderma 162 Glasgroente 163 Siergewassen 170 Glastuinbouw uitgebreid 171 Houtige gewassen 172 Gras- en sportvelden 174 Vollegrondsgewassen 183 Bacteriën Zie voor de volledige lijst: www.eurofins-horti.com/nl-nl/dna-multiscan
  • 11. Nieuw! - Microbioom analyse 11 Biologisch monster DNA DNA fragmenten DNA sequenties Determinatie soort(en) GTCTAGTAGCTAGCCGTG AAGTGACACGATGCACGATTCGATG CTTAACGTACGGATTCTATGAGTCAG CTAGCTAGCTGTTACGTATCGT TCATAGTTACGTATCGT ACCATGATGCTATGTAGTAAGCCT ACTCCGAGATTAATAGAATGGCCAG
  • 12. Voorbeeld: gietwater vs. mat 12 ‒ Overzicht samenstelling microbioom ‒ Schimmels en bacteriën ‒ Genus- of soortniveau ‒ Relatief: % van het DNA dat toebehoort aan organisme
  • 13. Grip krijgen met analyses 13 Eurofins ontwikkelt: – Meststoffen en biostimulanten analyses (inhoudstoffen, nutriënten etc.) – Pyrolyse methode (kwaliteit organische stof) – DNA Microbioom analyses Kunnen we microleven voeden met specifieke (koolstof)bronnen uit substraat of meststoffen/biostimulanten? Wat zijn de relaties met weerbaarheid tegen ziekteverwekkers?
  • 14. Een ‘wereld’ te ontdekken • Meer grip krijgen op samenspel van chemische, fysische en biologische processen rondom de wortel
  • 15. Hartelijk dank voor uw aandacht 15 Jan Hardeman Sr. Account Manager Horticulture E: JanHardeman@eurofins.com M: +31 (0)6 52002168 Frank Hoeberichts Product Manager Horticulture E: FrankHoeberichts@eurofins.com M: +31 (0)6 153 412 38