Suche senden
Hochladen
01 knapsack using backtracking
•
Als PPT, PDF herunterladen
•
17 gefällt mir
•
53,128 views
M
mandlapure
Folgen
Technologie
Melden
Teilen
Melden
Teilen
1 von 22
Jetzt herunterladen
Empfohlen
Knapsack Problem
Knapsack Problem
Jenny Galino
Given a set of non-negative integers, and a value sum, determine if there is a subset of the given set with sum equal to given sum.
sum of subset problem using Backtracking
sum of subset problem using Backtracking
Abhishek Singh
DAA
daa-unit-3-greedy method
daa-unit-3-greedy method
hodcsencet
For Students
Greedy Algorihm
Greedy Algorihm
Muhammad Amjad Rana
Inference rules for quantifiers, Unification and lifting, generalized modus ponens, unification.
Unification and Lifting
Unification and Lifting
Megha Sharma
Subset sum problem is to find subset of elements that are selected from a given set whose sum adds up to a given number K. We are considering the set contains non-negative values. It is assumed that the input set is unique (no duplicates are presented).
Sum of subset problem.pptx
Sum of subset problem.pptx
V.V.Vanniaperumal College for Women
Search techniques in ai, Uninformed : namely Breadth First Search and Depth First Search, Informed Search strategies : A*, Best first Search and Constraint Satisfaction Problem: criptarithmatic
Control Strategies in AI
Control Strategies in AI
Amey Kerkar
Its Al About Data Structure and Algorithm Analysis
Greedy algorithm
Greedy algorithm
International Islamic University
Empfohlen
Knapsack Problem
Knapsack Problem
Jenny Galino
Given a set of non-negative integers, and a value sum, determine if there is a subset of the given set with sum equal to given sum.
sum of subset problem using Backtracking
sum of subset problem using Backtracking
Abhishek Singh
DAA
daa-unit-3-greedy method
daa-unit-3-greedy method
hodcsencet
For Students
Greedy Algorihm
Greedy Algorihm
Muhammad Amjad Rana
Inference rules for quantifiers, Unification and lifting, generalized modus ponens, unification.
Unification and Lifting
Unification and Lifting
Megha Sharma
Subset sum problem is to find subset of elements that are selected from a given set whose sum adds up to a given number K. We are considering the set contains non-negative values. It is assumed that the input set is unique (no duplicates are presented).
Sum of subset problem.pptx
Sum of subset problem.pptx
V.V.Vanniaperumal College for Women
Search techniques in ai, Uninformed : namely Breadth First Search and Depth First Search, Informed Search strategies : A*, Best first Search and Constraint Satisfaction Problem: criptarithmatic
Control Strategies in AI
Control Strategies in AI
Amey Kerkar
Its Al About Data Structure and Algorithm Analysis
Greedy algorithm
Greedy algorithm
International Islamic University
Artificial Intelligence: Introduction, Typical Applications. State Space Search: Depth Bounded DFS, Depth First Iterative Deepening. Heuristic Search: Heuristic Functions, Best First Search, Hill Climbing, Variable Neighborhood Descent, Beam Search, Tabu Search. Optimal Search: A * algorithm, Iterative Deepening A* , Recursive Best First Search, Pruning the CLOSED and OPEN Lists
State Space Search in ai
State Space Search in ai
vikas dhakane
Finite automata examples
Finite automata examples
ankitamakin
8 queens problem using back tracking
8 queens problem using back tracking
Tech_MX
Greedy Algorithms By Sandeep Vishwakarma
Greedy algorithms
Greedy algorithms
sandeep54552
Tried Simplifying the N-Queen Problem a bit. Hope it helps
The n Queen Problem
The n Queen Problem
Sukrit Gupta
Backtracking
Backtracking
subhradeep mitra
5th chapter
Generating code from dags
Generating code from dags
indhu mathi
This is the presentation on N queen problem
N queen problem
N queen problem
Ridhima Chowdhury
P, NP, NP-Complete, and NP-Hard Reductionism in Algorithms NP-Completeness and Cooks Theorem NP-Complete and NP-Hard Problems Travelling Salesman Problem (TSP) Travelling Salesman Problem (TSP) - Approximation Algorithms PRIMES is in P - (A hope for NP problems in P) Millennium Problems Conclusions
P, NP, NP-Complete, and NP-Hard
P, NP, NP-Complete, and NP-Hard
Animesh Chaturvedi
Artificial Intelligence: Introduction, Typical Applications. State Space Search: Depth Bounded DFS, Depth First Iterative Deepening. Heuristic Search: Heuristic Functions, Best First Search, Hill Climbing, Variable Neighborhood Descent, Beam Search, Tabu Search. Optimal Search: A * algorithm, Iterative Deepening A* , Recursive Best First Search, Pruning the CLOSED and OPEN Lists
I.BEST FIRST SEARCH IN AI
I.BEST FIRST SEARCH IN AI
vikas dhakane
AND/OR graph & AO* algorithem .this is simple problem redusing ppt by arun singh
Problem reduction AND OR GRAPH & AO* algorithm.ppt
Problem reduction AND OR GRAPH & AO* algorithm.ppt
arunsingh660
This slides gives a strong overview of backtracking algorithm. How it came and general approaches of the techniques. Also some well-known problem and solution of backtracking algorithm.
BackTracking Algorithm: Technique and Examples
BackTracking Algorithm: Technique and Examples
Fahim Ferdous
This presentation discusses briefly about Dempster Shafer Theory in Artificial Intelligence
Dempster shafer theory
Dempster shafer theory
Dr. C.V. Suresh Babu
This Presentation will Use to develop your knowledge and doubts in Knapsack problem. This Slide also include Memory function part. Use this Slides to Develop your knowledge on Knapsack and Memory function
Knapsack problem and Memory Function
Knapsack problem and Memory Function
Barani Tharan
AI_Session 7 Greedy Best first search algorithm. pptx
AI_Session 7 Greedy Best first search algorithm.pptx
AI_Session 7 Greedy Best first search algorithm.pptx
Asst.prof M.Gokilavani
Np complete
Np complete
Dr. C.V. Suresh Babu
Define Greedy algorithm. solution for knapsack problem using greedy approach
Greedy Algorithm - Knapsack Problem
Greedy Algorithm - Knapsack Problem
Madhu Bala
Problem-solving in AI.
Lecture 3 problem solving
Lecture 3 problem solving
Vajira Thambawita
This Presentation discusses he following topics: Introduction Need for Problem formulation Problem Solving Components Definition of Problem Problem Limitation Goal or Solution Solution Space Operators Examples of Problem Formulation Well-defined Problems and Solution Examples of Well-Defined Problems Constraint satisfaction problems (CSPs) Examples of constraint satisfaction problem Decision problem
Problem Formulation in Artificial Inteligence Projects
Problem Formulation in Artificial Inteligence Projects
Dr. C.V. Suresh Babu
State Space Representation and Search
State Space Representation and Search
State Space Representation and Search
Hitesh Mohapatra
Knapsack using greedy algorithm with simple example
Knapsack
Knapsack
Karthik Chetla
pengantar kecerdasan buatan logika fuzzy. arsitektur komputer. salah satu materi untuk memahami cara kerja logika fuzzy
1 blind search
1 blind search
Rahel Amanda
Weitere ähnliche Inhalte
Was ist angesagt?
Artificial Intelligence: Introduction, Typical Applications. State Space Search: Depth Bounded DFS, Depth First Iterative Deepening. Heuristic Search: Heuristic Functions, Best First Search, Hill Climbing, Variable Neighborhood Descent, Beam Search, Tabu Search. Optimal Search: A * algorithm, Iterative Deepening A* , Recursive Best First Search, Pruning the CLOSED and OPEN Lists
State Space Search in ai
State Space Search in ai
vikas dhakane
Finite automata examples
Finite automata examples
ankitamakin
8 queens problem using back tracking
8 queens problem using back tracking
Tech_MX
Greedy Algorithms By Sandeep Vishwakarma
Greedy algorithms
Greedy algorithms
sandeep54552
Tried Simplifying the N-Queen Problem a bit. Hope it helps
The n Queen Problem
The n Queen Problem
Sukrit Gupta
Backtracking
Backtracking
subhradeep mitra
5th chapter
Generating code from dags
Generating code from dags
indhu mathi
This is the presentation on N queen problem
N queen problem
N queen problem
Ridhima Chowdhury
P, NP, NP-Complete, and NP-Hard Reductionism in Algorithms NP-Completeness and Cooks Theorem NP-Complete and NP-Hard Problems Travelling Salesman Problem (TSP) Travelling Salesman Problem (TSP) - Approximation Algorithms PRIMES is in P - (A hope for NP problems in P) Millennium Problems Conclusions
P, NP, NP-Complete, and NP-Hard
P, NP, NP-Complete, and NP-Hard
Animesh Chaturvedi
Artificial Intelligence: Introduction, Typical Applications. State Space Search: Depth Bounded DFS, Depth First Iterative Deepening. Heuristic Search: Heuristic Functions, Best First Search, Hill Climbing, Variable Neighborhood Descent, Beam Search, Tabu Search. Optimal Search: A * algorithm, Iterative Deepening A* , Recursive Best First Search, Pruning the CLOSED and OPEN Lists
I.BEST FIRST SEARCH IN AI
I.BEST FIRST SEARCH IN AI
vikas dhakane
AND/OR graph & AO* algorithem .this is simple problem redusing ppt by arun singh
Problem reduction AND OR GRAPH & AO* algorithm.ppt
Problem reduction AND OR GRAPH & AO* algorithm.ppt
arunsingh660
This slides gives a strong overview of backtracking algorithm. How it came and general approaches of the techniques. Also some well-known problem and solution of backtracking algorithm.
BackTracking Algorithm: Technique and Examples
BackTracking Algorithm: Technique and Examples
Fahim Ferdous
This presentation discusses briefly about Dempster Shafer Theory in Artificial Intelligence
Dempster shafer theory
Dempster shafer theory
Dr. C.V. Suresh Babu
This Presentation will Use to develop your knowledge and doubts in Knapsack problem. This Slide also include Memory function part. Use this Slides to Develop your knowledge on Knapsack and Memory function
Knapsack problem and Memory Function
Knapsack problem and Memory Function
Barani Tharan
AI_Session 7 Greedy Best first search algorithm. pptx
AI_Session 7 Greedy Best first search algorithm.pptx
AI_Session 7 Greedy Best first search algorithm.pptx
Asst.prof M.Gokilavani
Np complete
Np complete
Dr. C.V. Suresh Babu
Define Greedy algorithm. solution for knapsack problem using greedy approach
Greedy Algorithm - Knapsack Problem
Greedy Algorithm - Knapsack Problem
Madhu Bala
Problem-solving in AI.
Lecture 3 problem solving
Lecture 3 problem solving
Vajira Thambawita
This Presentation discusses he following topics: Introduction Need for Problem formulation Problem Solving Components Definition of Problem Problem Limitation Goal or Solution Solution Space Operators Examples of Problem Formulation Well-defined Problems and Solution Examples of Well-Defined Problems Constraint satisfaction problems (CSPs) Examples of constraint satisfaction problem Decision problem
Problem Formulation in Artificial Inteligence Projects
Problem Formulation in Artificial Inteligence Projects
Dr. C.V. Suresh Babu
State Space Representation and Search
State Space Representation and Search
State Space Representation and Search
Hitesh Mohapatra
Was ist angesagt?
(20)
State Space Search in ai
State Space Search in ai
Finite automata examples
Finite automata examples
8 queens problem using back tracking
8 queens problem using back tracking
Greedy algorithms
Greedy algorithms
The n Queen Problem
The n Queen Problem
Backtracking
Backtracking
Generating code from dags
Generating code from dags
N queen problem
N queen problem
P, NP, NP-Complete, and NP-Hard
P, NP, NP-Complete, and NP-Hard
I.BEST FIRST SEARCH IN AI
I.BEST FIRST SEARCH IN AI
Problem reduction AND OR GRAPH & AO* algorithm.ppt
Problem reduction AND OR GRAPH & AO* algorithm.ppt
BackTracking Algorithm: Technique and Examples
BackTracking Algorithm: Technique and Examples
Dempster shafer theory
Dempster shafer theory
Knapsack problem and Memory Function
Knapsack problem and Memory Function
AI_Session 7 Greedy Best first search algorithm.pptx
AI_Session 7 Greedy Best first search algorithm.pptx
Np complete
Np complete
Greedy Algorithm - Knapsack Problem
Greedy Algorithm - Knapsack Problem
Lecture 3 problem solving
Lecture 3 problem solving
Problem Formulation in Artificial Inteligence Projects
Problem Formulation in Artificial Inteligence Projects
State Space Representation and Search
State Space Representation and Search
Andere mochten auch
Knapsack using greedy algorithm with simple example
Knapsack
Knapsack
Karthik Chetla
pengantar kecerdasan buatan logika fuzzy. arsitektur komputer. salah satu materi untuk memahami cara kerja logika fuzzy
1 blind search
1 blind search
Rahel Amanda
ADA- 0-1 knapsack problem
Knapsack problem using dynamic programming
Knapsack problem using dynamic programming
khush_boo31
a
0 1 knapsack problem using dynamic programming
0 1 knapsack problem using dynamic programming
Maher Alshammari
Kruskal Algorithm
Kruskal Algorithm
Snehasis Panigrahi
Problem: Given, number of items each with a weight and value. The aim is to find each item to be put in a knapsack so that the total weight of included items is less than or equal to the capacity of the knapsack simultaneous total value of the included items should be maximum. It’s a problem that belongs to the NP class of problems. The decision problem form of the knapsack problem is NP-complete whereas optimization problem is NP-hard..
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
International Islamic University
DESIGN AND ANALYSIS OF ALGORITHMS
DESIGN AND ANALYSIS OF ALGORITHMS
Gayathri Gaayu
Knapsack problem ==>> Given some items, pack the knapsack to get the maximum total value. Each item has some weight and some value. Total weight that we can carry is no more than some fixed number W. So we must consider weights of items as well as their values.
Knapsack problem
Knapsack problem
Vikas Sharma
In this you can learn how to solve Knapsack Problem of fixed tuple using Space Tree
Knapsack problem using fixed tuple
Knapsack problem using fixed tuple
Mohanlal Sukhadia University (MLSU)
Andere mochten auch
(9)
Knapsack
Knapsack
1 blind search
1 blind search
Knapsack problem using dynamic programming
Knapsack problem using dynamic programming
0 1 knapsack problem using dynamic programming
0 1 knapsack problem using dynamic programming
Kruskal Algorithm
Kruskal Algorithm
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
Genetic Algorithm based Approach to solve Non-Fractional (0/1) Knapsack Optim...
DESIGN AND ANALYSIS OF ALGORITHMS
DESIGN AND ANALYSIS OF ALGORITHMS
Knapsack problem
Knapsack problem
Knapsack problem using fixed tuple
Knapsack problem using fixed tuple
Ähnlich wie 01 knapsack using backtracking
Helpful for the cse students
Dynamic Programming for 4th sem cse students
Dynamic Programming for 4th sem cse students
DeepakGowda357858
Disjoint sets
Disjoint sets
Core Condor
This lecture presented as part of Model Uncertainty: Statistical and Mathematical fall course.
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
The Statistical and Applied Mathematical Sciences Institute
CS 354 Computer Graphics University of Texas, Austin February 2, 2012
CS 354 Graphics Math
CS 354 Graphics Math
Mark Kilgard
These presentation slides serve as a presenting tool for a Computer Science lecture to teach the subject of Recursion in the context of Computer Algorithms.
Recursion - Computer Algorithms
Recursion - Computer Algorithms
Alaa Al-Makhzoomy
Dynamic Programming-DAA
Dynamic Programming.pptx
Dynamic Programming.pptx
Thanga Ramya S
Divide-and-Conquer & Dynamic Programming Divide-and-Conquer: Divide a problem to independent subproblems, find the solutions of the subproblems, and then merge the solutions of the subproblems to the solution of the original problem. Dynamic Programming: Solve the subproblems (they may overlap with each other) and save their solutions in a table, and then use the table to solve the original problem. Example 1: Compute Fibonacci number f(0)=0, f(1)=1, f(n)=f(n-1)+f(n-2) Using Divide-and-Conquer: F(n) = F(n-1) + F(n-2) F(n-2) + F(n-3) + F(n-3) + F(n-4) F(n-3)+F(n-4) + F(n-4)+F(n-5) + F(n-4)+F(n-5) + F(n-5) + F(n-6) ……………………. Computing time: T(n) = T(n-1) + T(n-2), T(1) = 0 T(n)=O(2 ) Using Dynamic Programmin: Computing time=O(n) n Chapter 8 Dynamic Programming (Planning) F(0) F(1) F(2) F(3) F(4) …… F(n) Example 2 The matrix-train mutiplication problem * Structure of an optimal parenthesization Matrix Size A1 30×35 A2 35×15 A3 15×5 A4 5×10 A5 10×20 A6 20×25 Input 6 5 3 2 4 1 3 3 3 3 3 3 3 3 5 1 2 3 4 5 i j 1 2 3 4 5 s[i,j] 6 5 3 2 4 i j m[i,j] 15125 10500 5375 3500 5000 0 11875 7125 2500 1000 0 9375 4375 750 0 7875 2625 0 15750 0 0 1 2 3 4 5 6 1 i-1 k j Matrix-Chain-Order(p) 1 n := length[p] -1; 2 for i = 1 to n 3 do m[i,i] := 0; 4 for l =2 to n 5 do {for i=1 to n-l +1 6 do { j := i+ l-1; 7 m[i,j] := ; 8 for k = i to j-1 9 do {q := m[i,k]+m[k+1,j] +p p p ; 10 if q < m[i,j] 11 then {m[i,j] :=q; s[i,j] := k}; }; }; 13 return m, s; Input of algorithm: p , p , … , p (The size of A = p *p ) Computing time O(n ) 8 0 1 n i i+1 i 3 Example 3 Longest common subsequence (LCS) A problem from Bioinformatics: the DNA of one organism may be S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAAA, while the DNA of another organism may be S2 = GTCGTTCTTAATGCCGTTGCTCTGTAAA. One goal of comparing two strands of DNA is to determine how “similar” the two strands are, as some measure of how closely related the two organisms are. Problem Formulization Given a sequence X = ( ), another sequence Z = ( ) is a subsequence of X if there exists a strictly increasing sequence ( ) of indices of X such that for all j = 1, 2, …k, we have . Theorem Let X = ( ) and Y = ( ...
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
jacksnathalie
This learner's module discusses or talks about the topic of Quadratic Functions. It also discusses what is Quadratic Functions. It also shows how to transform or rewrite the equation f(x)=ax2 + bx + c to f(x)= a(x-h)2 + k. It will also show the different characteristics of Quadratic Functions.
Mathematics 9 Quadratic Functions (Module 1)
Mathematics 9 Quadratic Functions (Module 1)
Juan Miguel Palero
Introduction for Backtracking
Backtracking
Backtracking
Sally Salem
This is a project based on a class performance
Integer_Functions .pdf
Integer_Functions .pdf
JainggaPotla
Fast parallelizable scenario-based stochastic optimization: a forward-backward LBFGS method for stochastic optimal control problems with global convergence rate guarantees. (Talk at EUCCO 2016, Leuven, Belgium).
Fast parallelizable scenario-based stochastic optimization
Fast parallelizable scenario-based stochastic optimization
Pantelis Sopasakis
quadratic functions
Module 1 quadratic functions
Module 1 quadratic functions
dionesioable
Dynamic programming /Analysis of Algorithm
AOA ppt.ppt
AOA ppt.ppt
SaimaShaheen14
Algorithm to find Single Source Shortest Paths in a Weighted Directed Graph consisting of Negative Cycles
Bellman ford
Bellman ford
Kiran K
design analysis algorithm
designanalysisalgorithm_unit-v-part2.pptx
designanalysisalgorithm_unit-v-part2.pptx
arifimad15
Newton Raphson method for load flow analysis
Newton Raphson method for load flow analysis
divyanshuprakashrock
Design and Analysis of Algorithms
Daa chpater14
Daa chpater14
B.Kirron Reddi
Polynomials are very important mathematical tool for Engineers. In this lecture we will discuss about how to deal with Polynomials in MATLAB and one of its application, Curve Fitting.
Polynomials and Curve Fitting in MATLAB
Polynomials and Curve Fitting in MATLAB
Shameer Ahmed Koya
Maths04
Maths04
sansharmajs
solutions
Chapter 04 answers
Chapter 04 answers
Rajwinder Marock
Ähnlich wie 01 knapsack using backtracking
(20)
Dynamic Programming for 4th sem cse students
Dynamic Programming for 4th sem cse students
Disjoint sets
Disjoint sets
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
2018 MUMS Fall Course - Statistical Representation of Model Input (EDITED) - ...
CS 354 Graphics Math
CS 354 Graphics Math
Recursion - Computer Algorithms
Recursion - Computer Algorithms
Dynamic Programming.pptx
Dynamic Programming.pptx
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
Divide-and-Conquer & Dynamic ProgrammingDivide-and-Conqu.docx
Mathematics 9 Quadratic Functions (Module 1)
Mathematics 9 Quadratic Functions (Module 1)
Backtracking
Backtracking
Integer_Functions .pdf
Integer_Functions .pdf
Fast parallelizable scenario-based stochastic optimization
Fast parallelizable scenario-based stochastic optimization
Module 1 quadratic functions
Module 1 quadratic functions
AOA ppt.ppt
AOA ppt.ppt
Bellman ford
Bellman ford
designanalysisalgorithm_unit-v-part2.pptx
designanalysisalgorithm_unit-v-part2.pptx
Newton Raphson method for load flow analysis
Newton Raphson method for load flow analysis
Daa chpater14
Daa chpater14
Polynomials and Curve Fitting in MATLAB
Polynomials and Curve Fitting in MATLAB
Maths04
Maths04
Chapter 04 answers
Chapter 04 answers
Kürzlich hochgeladen
Abhishek Deb(1), Mr Abdul Kalam(2) M. Des (UX) , School of Design, DIT University , Dehradun. This paper explores the future potential of AI-enabled smartphone processors, aiming to investigate the advancements, capabilities, and implications of integrating artificial intelligence (AI) into smartphone technology. The research study goals consist of evaluating the development of AI in mobile phone processors, analyzing the existing state as well as abilities of AI-enabled cpus determining future patterns as well as chances together with reviewing obstacles as well as factors to consider for more growth.
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
debabhi2
A Principled Technologies deployment guide Conclusion Deploying VMware Cloud Foundation 5.1 on next gen Dell PowerEdge servers brings together critical virtualization capabilities and high-performing hardware infrastructure. Relying on our hands-on experience, this deployment guide offers a comprehensive roadmap that can guide your organization through the seamless integration of advanced VMware cloud solutions with the performance and reliability of Dell PowerEdge servers. In addition to the deployment efficiency, the Cloud Foundation 5.1 and PowerEdge solution delivered strong performance while running a MySQL database workload. By leveraging VMware Cloud Foundation 5.1 and PowerEdge servers, you could help your organization embrace cloud computing with confidence, potentially unlocking a new level of agility, scalability, and efficiency in your data center operations.
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Principled Technologies
MINDCTI Revenue Release Quarter 1 2024
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
MIND CTI
Read about the journey the Adobe Experience Manager team has gone through in order to become and scale API-first throughout the organisation.
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
Radu Cotescu
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
The Digital Insurer
MySQL Webinar, presented on the 25th of April, 2024. Summary: MySQL solutions enable the deployment of diverse Database Architectures tailored to specific needs, including High Availability, Disaster Recovery, and Read Scale-Out. With MySQL Shell's AdminAPI, administrators can seamlessly set up, manage, and monitor these solutions, ensuring efficiency and ease of use in their administration. MySQL Router, on the other hand, provides transparent routing from the application traffic to the backend servers in the architectures, requiring minimal configuration. Completely built in-house and supported by Oracle, these solutions have been adopted by enterprises of all sizes for their business-critical applications. In this presentation, we'll delve into various database architecture solutions to help you choose the right one based on your business requirements. Focusing on technical details and the latest features to maximize the potential of these solutions.
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Miguel Araújo
As privacy and data protection regulations evolve rapidly, organizations operating in multiple jurisdictions face mounting challenges to ensure compliance and safeguard customer data. With state-specific privacy laws coming up in multiple states this year, it is essential to understand what their unique data protection regulations will require clearly. How will data privacy evolve in the US in 2024? How to stay compliant? Our panellists will guide you through the intricacies of these states' specific data privacy laws, clarifying complex legal frameworks and compliance requirements. This webinar will review: - The essential aspects of each state's privacy landscape and the latest updates - Common compliance challenges faced by organizations operating in multiple states and best practices to achieve regulatory adherence - Valuable insights into potential changes to existing regulations and prepare your organization for the evolving landscape
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc
Join our latest Connector Corner webinar to discover how UiPath Integration Service revolutionizes API-centric automation in a 'Quote to Cash' process—and how that automation empowers businesses to accelerate revenue generation. A comprehensive demo will explore connecting systems, GenAI, and people, through powerful pre-built connectors designed to speed process cycle times. Speakers: James Dickson, Senior Software Engineer Charlie Greenberg, Host, Product Marketing Manager
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
DianaGray10
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving. A report by Poten & Partners as part of the Hydrogen Asia 2024 Summit in Singapore. Copyright Poten & Partners 2024.
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Edi Saputra
Presented by Mike Hicks
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
ThousandEyes
Three things you will take away from the session: • How to run an effective tenant-to-tenant migration • Best practices for before, during, and after migration • Tips for using migration as a springboard to prepare for Copilot in Microsoft 365 Main ideas: Migration Overview: The presentation covers the current reality of cross-tenant migrations, the triggers, phases, best practices, and benefits of a successful tenant migration Considerations: When considering a migration, it is important to consider the migration scope, performance, customization, flexibility, user-friendly interface, automation, monitoring, support, training, scalability, data integrity, data security, cost, and licensing structure Next Wave: The next wave of change includes the launch of Copilot, which requires businesses to be prepared for upcoming changes related to Copilot and the cloud, and to consolidate data and tighten governance ShareGate: ShareGate can help with pre-migration analysis, configurable migration tool, and automated, end-user driven collaborative governance
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
sammart93
Presentation from Melissa Klemke from her talk at Product Anonymous in April 2024
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
Product Anonymous
The value of a flexible API Management solution for Open Banking Steve Melan, Manager for IT Innovation and Architecture - State's and Saving's Bank of Luxembourg Apidays New York 2024: The API Economy in the AI Era (April 30 & May 1, 2024) ------ Check out our conferences at https://www.apidays.global/ Do you want to sponsor or talk at one of our conferences? https://apidays.typeform.com/to/ILJeAaV8 Learn more on APIscene, the global media made by the community for the community: https://www.apiscene.io Explore the API ecosystem with the API Landscape: https://apilandscape.apiscene.io/
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
apidays
Following the popularity of "Cloud Revolution: Exploring the New Wave of Serverless Spatial Data," we're thrilled to announce this much-anticipated encore webinar. In this sequel, we'll dive deeper into the Cloud-Native realm by uncovering practical applications and FME support for these new formats, including COGs, COPC, FlatGeoBuf, GeoParquet, STAC, and ZARR. Building on the foundation laid by industry leaders Michelle Roby of Radiant Earth and Chris Holmes of Planet in the first webinar, this second part offers an in-depth look at the real-world application and behind-the-scenes dynamics of these cutting-edge formats. We will spotlight specific use-cases and workflows, showcasing their efficiency and relevance in practical scenarios. Discover the vast possibilities each format holds, highlighted through detailed discussions and demonstrations. Our expert speakers will dissect the key aspects and provide critical takeaways for effective use, ensuring attendees leave with a thorough understanding of how to apply these formats in their own projects. Elevate your understanding of how FME supports these cutting-edge technologies, enhancing your ability to manage, share, and analyze spatial data. Whether you're building on knowledge from our initial session or are new to the serverless spatial data landscape, this webinar is your gateway to mastering cloud-native formats in your workflows.
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Safe Software
Increase engagement and revenue with Muvi Live Paywall! In this presentation, we will explore the five key benefits of using Muvi Live Paywall to monetize your live streams. You'll learn how Muvi Live Paywall can help you: Monetize your live content easily: Set up pay-per-view access to your live streams and start generating revenue from your content. Increase audience engagement: Provide exclusive, premium content behind the paywall to keep your viewers engaged. Gain valuable viewer insights: Track viewer data and analytics to better understand your audience and tailor your content accordingly. Reduce content piracy: Muvi Live Paywall's security features help protect your content from unauthorized distribution. Streamline your workflow: The all-in-one platform simplifies the process of managing and monetizing your live streams. With Muvi Live Paywall, you can take control of your live stream monetization and create a sustainable business model for your content. Learn more about Muvi Live Paywall and start generating revenue from your live streams today!
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Roshan Dwivedi
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
The Digital Insurer
Terragrunt, Terraspace, Terramate, terra... whatever. What is wrong with Terraform so people keep on creating wrappers and solutions around it? How OpenTofu will affect this dynamic? In this presentation, we will look into the fundamental driving forces behind a zoo of wrappers. Moreover, we are going to put together a wrapper ourselves so you can make an educated decision if you need one.
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
Andrey Devyatkin
These are the slides delivered in a workshop at Data Innovation Summit Stockholm April 2024, by Kristof Neys and Jonas El Reweny.
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Neo4j
Scaling API-first – The story of a global engineering organization Ian Reasor, Senior Computer Scientist - Adobe Radu Cotescu, Senior Computer Scientist - Adobe Apidays New York 2024: The API Economy in the AI Era (April 30 & May 1, 2024) ------ Check out our conferences at https://www.apidays.global/ Do you want to sponsor or talk at one of our conferences? https://apidays.typeform.com/to/ILJeAaV8 Learn more on APIscene, the global media made by the community for the community: https://www.apiscene.io Explore the API ecosystem with the API Landscape: https://apilandscape.apiscene.io/
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
apidays
JAM, the future of Polkadot.
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Juan lago vázquez
Kürzlich hochgeladen
(20)
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
Mastering MySQL Database Architecture: Deep Dive into MySQL Shell and MySQL R...
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
Strategize a Smooth Tenant-to-tenant Migration and Copilot Takeoff
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
ProductAnonymous-April2024-WinProductDiscovery-MelissaKlemke
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
01 knapsack using backtracking
1.
2.
3.
4.
N-Queens Problem
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Jetzt herunterladen