SlideShare a Scribd company logo
1 of 57
Dr. Stickle

an EST-Database
Dr. Stickle
an EST-Database
The Goal
The Goal


• Creating a pipeline for EST-Analysis
The Goal


• Creating a pipeline for EST-Analysis
• Displaying the results via an online
 framework
wtf is a pipeline?
Different steps of analysis performed in an
             automated fashion




       wtf is a pipeline?
wtf is a pipeline?


Different steps of analysis performed in an
             automated fashion
Analysis:
✓Assembly of EST-Reads into contigs
✓SNP-Detection
               MIRA
               But:
       ★Takes ages
       ★not well documented
       ★buggy
✓Assembly of EST-Reads into contigs
✓SNP-Detection
               MIRA
               But:
       ★Takes ages
       ★not well documented
       ★buggy
✓Assembly of EST-Reads into contigs
✓SNP-Detection
               MIRA
               But:
       ★Takes ages
       ★not well documented
       ★buggy
MIRA
✓Assembly of EST-Reads into contigs
✓SNP-Detection


               But:
       ★Takes ages
       ★not well documented
       ★buggy
MIRA
✓Assembly of EST-Reads into contigs
✓SNP-Detection


               But:
       ★Takes ages
       ★not well documented
       ★buggy
MIRA
✓Assembly of EST-Reads into contigs
✓SNP-Detection

               But:
       ★Takes ages
       ★not well documented
       ★buggy
MIRA
✓Assembly of EST-Reads into contigs
✓SNP-Detection

               But:
       ★Takes ages
       ★not well documented
       ★buggy
SNPs   ORFs   Contigs BLAST
               MIRA




       PFAM        BLAST2GO
MIRA




SNPs   ORFs   Contigs BLAST




       PFAM           BLAST2GO
MIRA
              Contigs




SNPs   ORFs             BLAST




       PFAM        BLAST2GO
MIRA
              Contigs




SNPs   ORFs             BLAST




       PFAM        BLAST2GO
MIRA
              Contigs




SNPs   ORFs             BLAST




       PFAM        BLAST2GO
MIRA
              Contigs




SNPs   ORFs             BLAST




       PFAM        BLAST2GO
MIRA
              Contigs




SNPs   ORFs             BLAST




       PFAM        BLAST2GO
BLAST
Basic Local Alignment Search Tool
BLAST
Basic Local Alignment Search Tool
BLAST
              Basic Local Alignment Search Tool




• Standard for searching sequences against
 a database
BLAST
            Basic Local Alignment Search Tool




• Standard for searching sequences against
  a database
• emphasizes speed over sensitivity
BLAST
            Basic Local Alignment Search Tool




• Standard for searching sequences against
  a database
• emphasizes speed over sensitivity
BLAST
            Basic Local Alignment Search Tool




• Standard for searching sequences against
  a database
• emphasizes speed over sensitivity
BLAST
            Basic Local Alignment Search Tool




• Standard for searching sequences against
  a database
• emphasizes speed over sensitivity
Tools


                   gene ontology
Blast2GO
                     mapping


              open reading frame
  ORF
                  prediction


 PFAM          domain annotation
Blast2GO
Tools


                   gene ontology
Blast2GO
                     mapping


              open reading frame
  ORF
                  prediction


 PFAM          domain annotation
ORF
Tools


                   gene ontology
Blast2GO
                     mapping


              open reading frame
  ORF
                  prediction


 PFAM          domain annotation
PFAM
Ugly *.ace-output generated via MIRA
What we‘ve got here:
What we‘ve got here:

•Different tools
•many different output-files
What we‘ve got here:

     •Different tools
     •many different output-files

             What we want:

a structured database containing all the
              information
How to parse


Class «Parser»
 •Function BLAST-Parser
 •Function PFAM-Parser
 •Function FASTA-Parser
 •...
                                         Data



Script
 •read input
 •use parser
 •insert db
How to parse


Class «Parser»
 •Function BLAST-Parser
 •Function PFAM-Parser
 •Function FASTA-Parser
 •...
                                         Data



Script
 •read input
 •use parser
 •insert db
How to parse


Class «Parser»
 •Function BLAST-Parser
 •Function PFAM-Parser
 •Function FASTA-Parser
 •...
                                         Data



Script
 •read input
 •use parser
 •insert db
How to parse


Class «Parser»
 •Function BLAST-Parser
 •Function PFAM-Parser
 •Function FASTA-Parser
 •...
                                         Data



Script
 •read input
 •use parser
 •insert db
How to parse

                                Data
Class «Parser»
 •Function BLAST-Parser
 •Function PFAM-Parser
 •Function FASTA-Parser
 •...            Script
                  •read input
                  •use parser
                  •insert db


                           Database
>abc_123
agtagtacgtacgtggacgtatgact
>def_456
agtagtacgtacgtggacgtatgact
Summary & Results
Summary & Results

•created the pipeline
•analysed data
•started filling the database
Summary & Results

•created the pipeline
•analysed data
•started filling the database

        To be done


•wait for MIRA
•SNP-parser
thx to:


•Marvin, for «time till scooter» and sending us to Lothar
•Lothar, for providing always friendly and calm advice
•Suse, for actually having used MIRA at least once
•Andrew, for Andreas
•Andreas, for Andrew
•Bastien Chevreux, for not fixing those damn bugs in MIRA
k,thx,bai
Dr. Iglo
Dr. Iglo

More Related Content

Similar to Dr. Stickle

ICAR 2015 Workshop - Agnes Chan
ICAR 2015 Workshop - Agnes ChanICAR 2015 Workshop - Agnes Chan
ICAR 2015 Workshop - Agnes ChanAraport
 
Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...
Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...
Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...Databricks
 
தமிழ்க்கணிமை கட்டமைப்பு
தமிழ்க்கணிமை கட்டமைப்புதமிழ்க்கணிமை கட்டமைப்பு
தமிழ்க்கணிமை கட்டமைப்புBalaSundaraRaman (Sundar)
 
From Zero to Nextflow 2017
From Zero to Nextflow 2017From Zero to Nextflow 2017
From Zero to Nextflow 2017Luca Cozzuto
 
Jan2015 GIAB intro, Update, and Data Analysis Planning
Jan2015 GIAB intro, Update, and Data Analysis PlanningJan2015 GIAB intro, Update, and Data Analysis Planning
Jan2015 GIAB intro, Update, and Data Analysis PlanningGenomeInABottle
 
The RNA workbench - Galaxy User Conference 2018
The RNA workbench - Galaxy User Conference 2018The RNA workbench - Galaxy User Conference 2018
The RNA workbench - Galaxy User Conference 2018Florian Eggenhofer
 
A guided tour of Araport
A guided tour of AraportA guided tour of Araport
A guided tour of AraportAraport
 
Evaluation of the impact of error correction algorithms on SNP calling.
Evaluation of the impact of error correction algorithms on SNP calling.Evaluation of the impact of error correction algorithms on SNP calling.
Evaluation of the impact of error correction algorithms on SNP calling.Nathan Olson
 
Computational biology bls 303
Computational biology bls 303Computational biology bls 303
Computational biology bls 303Bruno Mmassy
 
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016Prof. Wim Van Criekinge
 
Creating a SNP calling pipeline
Creating a SNP calling pipelineCreating a SNP calling pipeline
Creating a SNP calling pipelineDan Bolser
 
Introduction to NGS
Introduction to NGSIntroduction to NGS
Introduction to NGScursoNGS
 
Enabling Biobank-Scale Genomic Processing with Spark SQL
Enabling Biobank-Scale Genomic Processing with Spark SQLEnabling Biobank-Scale Genomic Processing with Spark SQL
Enabling Biobank-Scale Genomic Processing with Spark SQLDatabricks
 
Programming for biologists
Programming for biologistsProgramming for biologists
Programming for biologistsjigma
 
20110524zurichngs 1st pub
20110524zurichngs 1st pub20110524zurichngs 1st pub
20110524zurichngs 1st pubsesejun
 
The Postmodern Binary Analysis
The Postmodern Binary AnalysisThe Postmodern Binary Analysis
The Postmodern Binary AnalysisOnur Alanbel
 
Presentation on FASTA
Presentation on FASTAPresentation on FASTA
Presentation on FASTANancy599470
 
Species identification.pptx
Species identification.pptxSpecies identification.pptx
Species identification.pptxMaiAnh409544
 

Similar to Dr. Stickle (20)

ChipSeq Data Analysis
ChipSeq Data AnalysisChipSeq Data Analysis
ChipSeq Data Analysis
 
ICAR 2015 Workshop - Agnes Chan
ICAR 2015 Workshop - Agnes ChanICAR 2015 Workshop - Agnes Chan
ICAR 2015 Workshop - Agnes Chan
 
Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...
Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...
Microservices and Teraflops: Effortlessly Scaling Data Science with PyWren wi...
 
தமிழ்க்கணிமை கட்டமைப்பு
தமிழ்க்கணிமை கட்டமைப்புதமிழ்க்கணிமை கட்டமைப்பு
தமிழ்க்கணிமை கட்டமைப்பு
 
From Zero to Nextflow 2017
From Zero to Nextflow 2017From Zero to Nextflow 2017
From Zero to Nextflow 2017
 
Jan2015 GIAB intro, Update, and Data Analysis Planning
Jan2015 GIAB intro, Update, and Data Analysis PlanningJan2015 GIAB intro, Update, and Data Analysis Planning
Jan2015 GIAB intro, Update, and Data Analysis Planning
 
The RNA workbench - Galaxy User Conference 2018
The RNA workbench - Galaxy User Conference 2018The RNA workbench - Galaxy User Conference 2018
The RNA workbench - Galaxy User Conference 2018
 
A guided tour of Araport
A guided tour of AraportA guided tour of Araport
A guided tour of Araport
 
Evaluation of the impact of error correction algorithms on SNP calling.
Evaluation of the impact of error correction algorithms on SNP calling.Evaluation of the impact of error correction algorithms on SNP calling.
Evaluation of the impact of error correction algorithms on SNP calling.
 
Computational biology bls 303
Computational biology bls 303Computational biology bls 303
Computational biology bls 303
 
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
Galaxy dna-seq-variant calling-presentationandpractical_gent_april-2016
 
Creating a SNP calling pipeline
Creating a SNP calling pipelineCreating a SNP calling pipeline
Creating a SNP calling pipeline
 
Introduction to NGS
Introduction to NGSIntroduction to NGS
Introduction to NGS
 
Enabling Biobank-Scale Genomic Processing with Spark SQL
Enabling Biobank-Scale Genomic Processing with Spark SQLEnabling Biobank-Scale Genomic Processing with Spark SQL
Enabling Biobank-Scale Genomic Processing with Spark SQL
 
Programming for biologists
Programming for biologistsProgramming for biologists
Programming for biologists
 
20110524zurichngs 1st pub
20110524zurichngs 1st pub20110524zurichngs 1st pub
20110524zurichngs 1st pub
 
The Postmodern Binary Analysis
The Postmodern Binary AnalysisThe Postmodern Binary Analysis
The Postmodern Binary Analysis
 
Fasta
FastaFasta
Fasta
 
Presentation on FASTA
Presentation on FASTAPresentation on FASTA
Presentation on FASTA
 
Species identification.pptx
Species identification.pptxSpecies identification.pptx
Species identification.pptx
 

More from Bastian Greshake

2020 03-11-open-life-sciences
2020 03-11-open-life-sciences2020 03-11-open-life-sciences
2020 03-11-open-life-sciencesBastian Greshake
 
openSNP @ Geekend Darmstadt
openSNP @ Geekend DarmstadtopenSNP @ Geekend Darmstadt
openSNP @ Geekend DarmstadtBastian Greshake
 
Crowdsourcing the Analysis of Genomes
Crowdsourcing the Analysis of GenomesCrowdsourcing the Analysis of Genomes
Crowdsourcing the Analysis of GenomesBastian Greshake
 
openSNP - QS Cologne Meetup
openSNP - QS Cologne MeetupopenSNP - QS Cologne Meetup
openSNP - QS Cologne MeetupBastian Greshake
 
openSNP - Crowdsourcing Genome Wide Association Studies
openSNP - Crowdsourcing Genome Wide Association StudiesopenSNP - Crowdsourcing Genome Wide Association Studies
openSNP - Crowdsourcing Genome Wide Association StudiesBastian Greshake
 
Was die Post-Genomics-Ära für die Privatssphäre bedeutet
Was die Post-Genomics-Ära für die Privatssphäre bedeutetWas die Post-Genomics-Ära für die Privatssphäre bedeutet
Was die Post-Genomics-Ära für die Privatssphäre bedeutetBastian Greshake
 
PiratenMS - Google Street View
PiratenMS - Google Street ViewPiratenMS - Google Street View
PiratenMS - Google Street ViewBastian Greshake
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisBastian Greshake
 
Medienkompetenz in Sozialen Netzwerken
Medienkompetenz in Sozialen NetzwerkenMedienkompetenz in Sozialen Netzwerken
Medienkompetenz in Sozialen NetzwerkenBastian Greshake
 
Denkt denn keiner an die Kernthemen?
Denkt denn keiner an die Kernthemen?Denkt denn keiner an die Kernthemen?
Denkt denn keiner an die Kernthemen?Bastian Greshake
 
Uncanny Valley - Affen vs. Menschen
Uncanny Valley - Affen vs. MenschenUncanny Valley - Affen vs. Menschen
Uncanny Valley - Affen vs. MenschenBastian Greshake
 

More from Bastian Greshake (19)

My Life in Lockdown
My Life in LockdownMy Life in Lockdown
My Life in Lockdown
 
2020 03-11-open-life-sciences
2020 03-11-open-life-sciences2020 03-11-open-life-sciences
2020 03-11-open-life-sciences
 
openSNP @ Geekend Darmstadt
openSNP @ Geekend DarmstadtopenSNP @ Geekend Darmstadt
openSNP @ Geekend Darmstadt
 
Crowdsourcing the Analysis of Genomes
Crowdsourcing the Analysis of GenomesCrowdsourcing the Analysis of Genomes
Crowdsourcing the Analysis of Genomes
 
openSNP - QS Cologne Meetup
openSNP - QS Cologne MeetupopenSNP - QS Cologne Meetup
openSNP - QS Cologne Meetup
 
The Future of Genetics
The Future of GeneticsThe Future of Genetics
The Future of Genetics
 
openSNP - Crowdsourcing Genome Wide Association Studies
openSNP - Crowdsourcing Genome Wide Association StudiesopenSNP - Crowdsourcing Genome Wide Association Studies
openSNP - Crowdsourcing Genome Wide Association Studies
 
Was die Post-Genomics-Ära für die Privatssphäre bedeutet
Was die Post-Genomics-Ära für die Privatssphäre bedeutetWas die Post-Genomics-Ära für die Privatssphäre bedeutet
Was die Post-Genomics-Ära für die Privatssphäre bedeutet
 
Crowdsourcing GWAS
Crowdsourcing GWASCrowdsourcing GWAS
Crowdsourcing GWAS
 
Gentechnik
GentechnikGentechnik
Gentechnik
 
Lernen durch Lehren
Lernen durch LehrenLernen durch Lehren
Lernen durch Lehren
 
Haushalt 2011 Münster
Haushalt 2011 MünsterHaushalt 2011 Münster
Haushalt 2011 Münster
 
LiquidFeedback Workshop
LiquidFeedback WorkshopLiquidFeedback Workshop
LiquidFeedback Workshop
 
PiratenMS - Google Street View
PiratenMS - Google Street ViewPiratenMS - Google Street View
PiratenMS - Google Street View
 
Next Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome AnalysisNext Generation Sequencing & Transcriptome Analysis
Next Generation Sequencing & Transcriptome Analysis
 
Medienkompetenz in Sozialen Netzwerken
Medienkompetenz in Sozialen NetzwerkenMedienkompetenz in Sozialen Netzwerken
Medienkompetenz in Sozialen Netzwerken
 
Denkt denn keiner an die Kernthemen?
Denkt denn keiner an die Kernthemen?Denkt denn keiner an die Kernthemen?
Denkt denn keiner an die Kernthemen?
 
Uncanny Valley - Affen vs. Menschen
Uncanny Valley - Affen vs. MenschenUncanny Valley - Affen vs. Menschen
Uncanny Valley - Affen vs. Menschen
 
Meerschweinchen
MeerschweinchenMeerschweinchen
Meerschweinchen
 

Recently uploaded

Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3JemimahLaneBuaron
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104misteraugie
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Krashi Coaching
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityGeoBlogs
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformChameera Dedduwage
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeThiyagu K
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfAyushMahapatra5
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room servicediscovermytutordmt
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDThiyagu K
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Student login on Anyboli platform.helpin
Student login on Anyboli platform.helpinStudent login on Anyboli platform.helpin
Student login on Anyboli platform.helpinRaunakKeshri1
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfchloefrazer622
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxVishalSingh1417
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxheathfieldcps1
 

Recently uploaded (20)

Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Advance Mobile Application Development class 07
Advance Mobile Application Development class 07Advance Mobile Application Development class 07
Advance Mobile Application Development class 07
 
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
Kisan Call Centre - To harness potential of ICT in Agriculture by answer farm...
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activity
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy Reform
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdf
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room service
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SD
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Student login on Anyboli platform.helpin
Student login on Anyboli platform.helpinStudent login on Anyboli platform.helpin
Student login on Anyboli platform.helpin
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdf
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptx
 

Dr. Stickle

  • 4. The Goal • Creating a pipeline for EST-Analysis
  • 5. The Goal • Creating a pipeline for EST-Analysis • Displaying the results via an online framework
  • 6. wtf is a pipeline?
  • 7. Different steps of analysis performed in an automated fashion wtf is a pipeline?
  • 8. wtf is a pipeline? Different steps of analysis performed in an automated fashion
  • 10. ✓Assembly of EST-Reads into contigs ✓SNP-Detection MIRA But: ★Takes ages ★not well documented ★buggy
  • 11. ✓Assembly of EST-Reads into contigs ✓SNP-Detection MIRA But: ★Takes ages ★not well documented ★buggy
  • 12. ✓Assembly of EST-Reads into contigs ✓SNP-Detection MIRA But: ★Takes ages ★not well documented ★buggy
  • 13. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
  • 14. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
  • 15. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
  • 16. MIRA ✓Assembly of EST-Reads into contigs ✓SNP-Detection But: ★Takes ages ★not well documented ★buggy
  • 17. SNPs ORFs Contigs BLAST MIRA PFAM BLAST2GO
  • 18. MIRA SNPs ORFs Contigs BLAST PFAM BLAST2GO
  • 19. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
  • 20. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
  • 21. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
  • 22. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
  • 23. MIRA Contigs SNPs ORFs BLAST PFAM BLAST2GO
  • 26. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database
  • 27. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
  • 28. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
  • 29. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
  • 30. BLAST Basic Local Alignment Search Tool • Standard for searching sequences against a database • emphasizes speed over sensitivity
  • 31. Tools gene ontology Blast2GO mapping open reading frame ORF prediction PFAM domain annotation
  • 33. Tools gene ontology Blast2GO mapping open reading frame ORF prediction PFAM domain annotation
  • 34. ORF
  • 35. Tools gene ontology Blast2GO mapping open reading frame ORF prediction PFAM domain annotation
  • 36. PFAM
  • 37.
  • 40. What we‘ve got here: •Different tools •many different output-files
  • 41. What we‘ve got here: •Different tools •many different output-files What we want: a structured database containing all the information
  • 42. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
  • 43. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
  • 44. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
  • 45. How to parse Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Data Script •read input •use parser •insert db
  • 46. How to parse Data Class «Parser» •Function BLAST-Parser •Function PFAM-Parser •Function FASTA-Parser •... Script •read input •use parser •insert db Database
  • 48.
  • 49.
  • 50.
  • 52. Summary & Results •created the pipeline •analysed data •started filling the database
  • 53. Summary & Results •created the pipeline •analysed data •started filling the database To be done •wait for MIRA •SNP-parser
  • 54. thx to: •Marvin, for «time till scooter» and sending us to Lothar •Lothar, for providing always friendly and calm advice •Suse, for actually having used MIRA at least once •Andrew, for Andreas •Andreas, for Andrew •Bastien Chevreux, for not fixing those damn bugs in MIRA