1. Structural features of glycoprotein purified
from Saccharina japonica and its effects on the selected probiotic
properties of Lactobacillus plantarum in Caco-2 cell
Eun-Young Kim & S. M. Rafiquzzaman & Jong Min Lee &
Gyuyou Noh & Geon-a Jo & Jong-Hee Lee & In-Soo Kong
Received: 7 April 2014 /Revised and accepted: 28 July 2014
# Springer Science+Business Media Dordrecht 2014
Abstract The aim of this study was to characterise the struc-
tural features of glycoprotein isolated from the brown alga
Saccharina japonica (SJGP) and to evaluate its effects on the
probiotic properties of Lactobacillus plantarum in Caco-2
cells. The amino acid profile, protein backbone and monosac-
charides were analysed by amino acid analysis, Fourier trans-
form infrared spectroscopy (FT-IR) and high-performance
liquid chromatography (HPLC), respectively. The pretreat-
ment of L. plantarum with SJGP increased cell adhesion,
auto-aggregation and growth in Caco-2 cells, as observed by
plate counting, light microscopy and scanning electron mi-
croscopy. Auto-aggregation and cell surface hydrophobicity
of L. plantarum was also increased following pretreatment
with SJGP. SJGP was shown to improve adhesiveness through
its lipase inhibitory activity. Adhesion-related genes of
L. plantarum showed upregulated expression in the presence
of SJGP confirmed by reverse transcriptase-PCR assay. In
summary, SJGP could be used as a bioactive compound to
improve the probiotic properties of L. plantarum and could be
relevant to the preparation of functional foods.
Keywords Glycoprotein . Saccharina japonica . Structural
features . Probiotic properties . Lactobacillus plantarum .
Caco-2 cell
Introduction
Probiotics have received increasing attention in recent years
and have been suggested to have positive health effects. The
health-promoting effects of probiotics may be acquired
through incorporation in food components, but the safety of
the probiotic is of greatest concern to the consumer.
Lactobacillus spp. and Bifidobacterium spp. are popular due
to their long history of safe use in the fermentation industry
and their being natural inhabitants of the gastrointestinal tract.
These properties have seen generally regarded as safe (GRAS)
status conferred on these microorganisms (Ammor et al. 2007;
Hsu et al. 2005; Puertollano et al. 2008). When selecting
probiotic bacteria, several aspects, including their stability,
functionality, adhesion, auto-aggregation and inhibition of
harmful bacteria, must be taken into consideration. The main
criterion for selecting probiotic strains is their ability to adhere
to the intestinal epithelium, as it determines their interactions
with the host and the microorganisms present in the host
system (Johanson et al. 1993; Ouwehand et al. 1999). Other
phenotypic traits of lactobacilli, such as auto-aggregation
(Voltan et al. 2007) and cell surface hydrophobicity (CSH)
(Pelletier et al. 1997), are also correlated with adhesion. How-
ever, the mechanisms by which probiotic bacteria adhere to
the human gastrointestinal tract are poorly understood. Recent
reports indicated that the attachment of lactobacilli to intesti-
nal cell lines is dependent on bacterial surface properties and
protein structures (Tuomola et al. 2000; Bernet et al. 1993). It
has been found that oxidation of carbohydrate by
metaperiodates and degradation of protein by proteases de-
crease adhesion ability (Greene and Klaenhammer 1994). By
contrast, the addition of honey and inulin as prebiotics en-
hanced the aggregation and adhesion properties of Lactoba-
cillus acidophilus NCDC 13 and L. acidophilus NCDC 291,
indicating that pretreatment can influence their properties
(Saran et al. 2012). Kennedy and Sandin (1988) reported that
Eun-Young Kim and S. M. Rafiquzzaman contributed equally to this
paper.
E.<Y. Kim :S. M. Rafiquzzaman :J. M. Lee :G. Noh :G.<a. Jo :
I.<S. Kong (*)
Department of Biotechnology, Pukyong National University,
Busan 608-737, South Korea
e-mail: iskong@pknu.ac.kr
J.<H. Lee
World Institute of Kimchi, Gwangju 503-360, South Korea
J Appl Phycol
DOI 10.1007/s10811-014-0390-7

2. cell adhesion and hydrophobicity were significantly influ-
enced by the carbohydrate present in the medium. However,
this study provides the first investigation of the effects of
natural bioactive compounds from seaweed on selected pro-
biotic properties of Lactobacillus plantarum.
Seaweeds are an important source of bioactive compounds.
For example, compounds isolated from marine macroalgae
have demonstrated various biological activities, such as anti-
bacterial (Gonzalez del Val et al. 2001), antioxidant (Yuan and
Walsh 2006; Chandini et al. 2008), anti-inflammatory (Kang
et al. 2008) and anticoagulant (Guerra-Rivas et al. 2011)
properties. Saccharina japonica is a brown alga commonly
found in East Asia, particularly Japan, China and Korea,
which is used mainly as food material (Jia and Chen 2001).
Most previous studies have focused on evaluating the biolog-
ical functions of polysaccharides and lipids from S. japonica,
despite glycoproteins having more biological functions (Kim
et al. 2012; Rafiquzzaman et al. 2013). In our previous study,
we have isolated and purified glycoprotein from different
seaweeds, such as S. japonica (SJGP) and Undaria
pinnatifida (UPGP), to characterise the biofunctional activi-
ties; they have considerable antioxidant, DNA-protective,
NO-scavenging and xanthine-oxidase-inhibition activities
(Kim et al. 2012; Rafiquzzaman et al. 2013).
We therefore investigated the structural features of SJGP
and its effects on selected probiotic properties of several
L. plantarum strains in a Caco-2 cell line model system. The
Caco-2 cell line has been used to investigate the adhesion
mechanisms of bacteria, because of the complexity of working
with the in vivo system (Bernet et al. 1993). Hence, the
present study was undertaken to characterise the chemical
composition of SJGP and its effects on the adhesion capacity,
auto-aggregation ability and CSH of various L. plantarum
strains. Moreover, the lipase inhibitory activity of SJGP was
investigated. Both light and scanning electron microscopy
images were used to evaluate the adhesion capacity of
L. plantarum strains in the presence or absence of SJGP in
the in vitro Caco-2 cell line model system. In addition, the
expressionpatterns of multiple adhesiongenes of L.plantarum
were analysed by reverse transcriptase-polymerase chain re-
action (RT-PCR).
Materials and methods
Bacterial strains and growth conditions Lactobacillus.
plantarum KCTC 3108, KCTC 3928, KCTC 13093 and
KCTC 10887BP were obtained from the Korean Collection
for Type Cultures (KCTC) and were isolated from kimchi
and pickled cabbage. All strains were grown in MRS broth
(Difco, USA) at 37 °C and stored in MRS with 7 %
dimethyl sulfoxide (DMSO) at −70 °C.
Isolation of SJGP Glycoprotein (MW ~10 kDa) was isolated
from S. japonica and identified by sodium dodecyl sulphate-
polyacrylamide gel electrophoresis (SDS-PAGE) followed by
Coomassie Brilliant Blue (CBB), silver and periodic acid-
Schiff (PAS) staining, as reported previously (Kim et al.
2012).
Analysis of chemical composition of SJGP The amino acid
content of purified SJGP was determined using an amino acid
analyser (Membrapure Co., Germany) according to the meth-
od of Rafiquzzaman et al. (2013). The amount of each amino
acid was expressed as the percentage per 100 g of amino acids.
The freeze-dried SJGP was subjected to Fourier transform
infrared (FT-IR) measurement in the frequency range 4,000–
650 cm−1
using a Spectrum X instrument (Perkin Elmer,
USA).
SJGP monosaccharides were determined according to the
method of Meinita et al. (2012). The monosaccharides rham-
nose, mannose, galactose, xylose, glucose, fructose, lactose,
ribose, raffinose and maltose were used as standards for high-
performance liquid chromatography (HPLC).
Effect of SJGP on the probiotic properties of L. plantarum
Cell culture Caco-2 cells (KCLB 30037) were obtained from
the Korean Cell Line Bank (KCLB) and grown at 37 °C in an
atmosphere of 95 % air and 5 % CO2 in minimal essential
medium (MEM, Sigma M0643) supplemented with 25 mM
HEPES, 10 % heat-inactivated foetal bovine serum (FBS,
Gibco 16000), 1 % non-essential amino acids and 1 %
penicillin/streptomycin (Gibco, Grand Island, NY).
Enumeration of adhered cell by direct counting The adhesive
capacities of L. plantarum strains were examined in the ab-
sence or presence of SJGP using the Caco-2 cell line, as
described previously (Bojana et al. 2003; Kotzamanidis
et al. 2010) with slight modifications. Briefly, 100 μL of
L. plantarum (106
CFU mL−1
) was added with or without
SJGP at various concentrations onto a monolayer of Caco-2
cells in separate wells. The plates were incubated for 4 h at
37 °C in a 5 % CO2 incubator. After incubation, bacterial cells
were collected from the wells and Caco-2 cells were washed
twice with 1 mL sterile phosphate buffered saline (PBS).
Adhered cells were treated with 1 mL of 0.5 % Triton X-100
for 3 min on ice and then serially diluted and plated onto MRS
agar for quantification.
Microscopic observation of adhered cells The adhered cells
were observed by light microscopy and scanning electron
microscopy (SEM) for qualitative determination. The light
microscopic observation of L. plantarum was carried out by
fixing washed cells in 100 % methanol for 30 min followed by
J Appl Phycol

3. Gram staining. For SEM, the samples were prepared as de-
scribed previously (Darilmaz et al. 2011). Briefly, the samples
were postfixed with 1 % osmium tetroxide for 2 h in a dark
room. Then, they were washed three times with 0.1 M sodium
phosphate buffer (pH 7.2) for 20 min and serially dehydrated
with series of ethanol solutions of different concentration
(50 %→70 %→80 %→90 %→95 %→98 %→100 %→
100 %) for 20 min. Next, substitution of ethanol by amyl
acetate (3:1→1:1→0:1) was performed for 30 min and the
samples were then critical-point dried with CO2 gas and
subjected to sputter coating for 1 min. Sputter-coated cells
were examined using a scanning electron microscope
(S-2400, Hitachi, Japan).
Cell surface hydrophobicity Lactobacillus plantarum KCTC
3108 was selected for further study based on the results
obtained from cell line experiments. The CSH of this
strain with or without SJGP was assessed as described
previously (Kotzamanidis et al. 2010) with slight modifi-
cations. Cells cultured for 18 h were washed twice with
PBS and the OD at 600 nm was adjusted to 1.0 (A0). One
millilitre of xylene and 3 mL of 0.1, 0.5 or 1.0 mg mL−1
SJGP were then added to the cell suspension to form a
two-phase system. The aqueous phase was removed care-
fully and its absorbance at 600 nm (A1) was measured.
Percentage CSH was calculated using the following for-
mula: % CSH=[(A0−A1)/A0]×100.
Auto-aggregation assay An auto-aggregation assay was per-
formed in the presence or absence SJGP as described by
Rahman et al. (2008), with some modifications. The bacterial
culture was collected, harvested by centrifugation at 13,000×g
for 3 min, washed and resuspended in PBS, and then the OD
at 600 nm was adjusted to 1.0. Accordingly, the samples were
treated with SJGP at various concentrations. Percentage auto-
aggregation was expressed as follows: % auto-
aggregation=[(A0−A1)/A0]×100, where A0 represents initial
OD and A1 is OD after mixing with SJGP at different time
intervals.
Lipase inhibition assay The method used for measuring
lipase inhibitory activity was modified from that described
previously by Zhang et al. (2008). Briefly, lipase (0.3 mg)
was dissolved in a buffer consisting of 5 mM CaCl2 and
100 mM Tris-HCl (pH 8.0). And then, 30 μL of 10 mM
MOPS and 30 μL of 1 mM EDTA was added to the
lipase solution. A 100 μL amount of SJGP at different
concentrations (0.1, 0.5, 1.0 or 2.0 mg mL−1
) was added
and incubated at 37 °C for 15 min and subsequently
added 10 mM p-nitrophenyl butyrate to that solution.
The amount of p-nitrophenol released in the reaction was
measured at 400 nm using a UV-visible spectrophotometer
(BioTek Synergy HT, USA).
RT-PCR assay for adhesion-related genes L. plantarum
KCTC 3108 cells, grown in MRS broth at 37 °C for 18 h,
were centrifuged and the resulting pellet was washed twice
with PBS. The washed pellet was resuspended in PBS and the
OD at 600 nm was adjusted to 1.0. Cell suspensions contain-
ing 0.1, 0.5 or 1.0 mg mL−1
SJGP were incubated at 37 °C for
4 h. Total RNA was prepared using TRIzol reagent
(Invitrogen, USA) and treated with RNase-free DNase
(Takara, Japan) to remove contaminating DNA. Complemen-
tary DNA (cDNA) was synthesised using a first-strand cDNA
synthesis kit for RT-PCR (Roche). The expression of cell-
adhesion-related genes (mub, map, ef-Tu and fbp) and control
genes (glyceraldehyde-3-phosphate, gdph; L. plantarum
KCTC 3108-specific 16s RNA, lp) was assayed by PCR using
specific primer sets (Table 1). PCR amplification (94 °C for
5 min; 25 cycles of 94 °C for 30 s and annealing at 72 °C for
30 s; and 72 °C for 7 min) was performed with ExTaq DNA
polymerase (Takara) using L. plantarum KCTC 3108 cDNA
as the template. PCR products were subjected to 1 % agarose
gel electrophoresis. The band intensity was measured with
Image J (version 1.45) software (National Institute of Health,
USA).
Results
Analysis of chemical composition
Amino acid and monosaccharide composition The amino
acid profile of purified SJGP is shown in Fig. 1. Purified SJGP
contained both essential and non-essential amino acids. It was
rich in glutamic acid, arginine and aspartic acid and poor in
glycine, alanine, valine, cysteine, leucine, tyrosine, histidine,
ammonia and lysine.
HPLC analysis of purified SJGP was carried out to deter-
mine the monosaccharide composition. Individual compo-
nents were identified by comparison of their retention times
with different commercial sugars used as standards. Peak
analysis identified five monosaccharides: galactose, raffinose,
maltose, mannose and xylose.
FT-IR spectroscopy The FT-IR spectrum of purified SJGP
showed 12 major peaks between 3,280 and 704 cm−1
and
revealed the presence of various protein backbones (Fig. 2).
The amide B band (3,194 cm−1
) originated from Fermi reso-
nance and corresponded to N-H stretching vibrations. The
amide B band corresponded to peaks at 2,935, 2,902 and
2,838 cm−1
, which are associated with C-H stretching vibra-
tions. Three other peaks at 1,593, 1,449 and 1,403 cm−1
represented stretching vibrations of C-O and C=O, which
are generated mainly by arginine, histidine and aspartic acid,
J Appl Phycol

4. respectively. Rocking vibrations of CH2 resulted in peaks at
929 and 704 cm−1
.
Effects of SJGP on the probiotic properties of L. plantarum
The adhesion of L. plantarum with or without SJGP to Caco-2
cells was investigated quantitatively and qualitatively using
two independent methods: enumeration by plating on MRS
agar and direct microscopic examination.
Enumeration of adherent bacteria by plate counting
L. plantarum strains were treated with SJGP at various concen-
trations to investigate their capacity to adhere to Caco-2 cells. To
liberate lactobacilli from the surface, the Caco-2 cells were
treated with Triton X-100. The adhesion ability of L. plantarum
varied considerably among strains (Table 2). SJGP-treated
KCTC 3108 showed the highest number of adhesive cells
(~1.8-fold more than non-treated samples), followed by KCTC
Table 1 Primers used in this study for all the primer set, it should be as per revised submission. It needs to seperate between up and rp by drawing a line
between the two set of primer for particular gene
Primer set Sequence 5′ to 3′ Target Annealing
temperature (°C)
Size of
amplicon (bp)
Reference
mub GTAGTTACTCAGTGACGATCAATG
TAATTGTAAAGGTATAATCGGAGG
Mucus binding protein 50 150 Ramiah et al. (2007)
map TGGATTCTGCTTGAGGTAAG
GACTAGTAATAACGCGACCG
Mucus adhesion promoting
protein
50 156 Ramiah et al. (2007)
ef-Tu TTCTGGTCGTATCGATCGTG
CCACGTAATAACGCACCAAC
Elongation factor Tu 50 161 Ramiah et al. (2007)
fbp GTCCTTTGATGGTTTATTTACCC
AGAAGTATGCGGCGAGATTCGC
Fibronectin binding protein 48 1,500 Kaushik et al. (2009)
gdph ACTGAATTAGTTGCTATCTTAGAC
GAAAGTAGTACCGATAACATCAGA
Glyceraldehyde-3-phosphate 50 140 Ramiah et al. (2007)
lp ATTCATAGTCTAGTTGGAGGT
CCTGAACTGAGAGAATTTGA
L. plantarum specific 16S rRNA 48 248 Song et al. (2000)
Fig. 1 Analysis of amino acid profile of SJGP by amino acid analyser
J Appl Phycol

5. 3928. Overall, the adhesion capacity was 1.13- to 1.86-fold
greater in SJGP-treated compared to non-treated samples.
Microscopic observation
Observations with regard to adhesion scores obtained using
Caco-2 cells were further corroborated by light microscopic
and SEM observation of adherent cells. Observation of Gram-
stained cells under a light microscope showed that SJGP
treatment improved growth, with the development of small
black spots (Fig. 3a, b), which extended the cell to a greater
extent that makes unclear cell boundaries. Oppositely, the cell
boundaries were clear in case of untreated cells. SEM showed
that SJGP-treated cells were more swollen than non-treated
cells (Fig. 4a, b). Regarding auto-aggregation, it has been
found that SJGP-treated cells were more aggregated than
non-treated cells (Fig. 4c, d).
Cell surface hydrophobicity
CSH is an important determinant of the adhesion capacity of
probiotic bacteria. Figure 5a shows that CSH increased with an
increasing concentration of SJGP. The highest relative CSH
value, 110 %, was found at a concentration of 0.8 mg mL−1
whereas the CSH value of the samples without SJGP was 65 %.
Auto-aggregation
The rate of auto-aggregation of L. plantarum KCTC 3108 was
time-dependent. After 12 h, the cells treated with 0.1 mg mL−1
Fig. 2 FT-IR spectrum of SJGP
Table 2 Total number of bacterial cells of different strains of L. plantarum pretreated with or without SJGP adhering to CaCo-2 cells
L. plantarum strain Number of adhered bacteria (×106
CFU mg mL−1
, folda
)
SJGP (0 mg mL−1
) 0.1 mg mL−1
0.5 mg mL−1
1 mg mL−1
KCTC 3108 4.5±0.5 (1.0)b
5.6±0.6 (1.24)a
7.3±0.9 (1.69)a
8.4±0.6 (1.86)a
KCTC 3928 4.5±0.5 (1.0)b
5.47±0.3 (1.21)a
7.97±0.6 (1.77)a
8.1±0.9 (1.80)a
KCTC 13093 4.5±0.5 (1.0)b
5.1±0.3 (1.13)a
6.3±0.6 (1.40)a
6.7±0.9 (1.49)a
K8 4.5±0.5 (1.0)b
5.9±0.6 (1.31)a
7.9±0.6 (1.76)a
7.3±0.6 (1.62)a
Values are means±standard deviations of three independent experiments
a
Relative increment (in fold) of adhered bacteria of different strain of L. plantarum following treatment of SJGP at different concentrations
b
Control value of adhered bacteria of different strain of L. plantarum
J Appl Phycol

6. SJGP showed 86 % auto-aggregation whereas untreated cells
showed only 17 % auto-aggregation (Fig. 5b).
Lipase inhibitory activity
Lipase inhibition activity is indirectly related to the CSH of
bacteria. Lipase inhibitors can enhance CSH. The pancreatic
lipase inhibition activity of SJGP was evaluated; SJGP
inhibited lipase activity in a dose-dependent manner. The
highest inhibition (92 %) was at 1.0 mg mL−1
SJGP, followed
by 64 % at 0.5 mg mL−1
(Fig. 6).
Expression of adhesion-related genes
RT-PCR was performed to quantify the expression of
adhesion-related genes (mub, map, ef-Tu and fbp) in
L. plantarum treated with various SJGP concentrations. All
genes were upregulated in the presence of SJGP (Fig. 7).
Image analysis showed that map was the most highly upreg-
ulated adhesion gene, showing 3.4-fold higher expression
compared to untreated cells; the values for mub, fbp and ef-
Tu were 2.8-, 1.9- and 1.5-fold, respectively.
Discussion
Recently, there has been an increasing recognition of the role
of probiotic bacteria in the maintenance of homeostasis and in
the prevention of colonisation by pathogenic organisms within
the dynamic ecosystem in the human body. Therefore, the
identification of new natural bioactive compounds that en-
hance the probiotic properties is of prime importance.
Therefore, in this study, we characterised the chemical com-
position of SJGP and evaluated its effects on selected probi-
otic properties of L. plantarum in a Caco-2 cell line model
system.
Firstly, we characterised the structural features of SJGP by
FT-IR spectroscopy, amino acid analysis and HPLC. Amino
acid analysis and the FT-IR spectrum provided information
regarding the amino acid profile, protein backbone and sec-
ondary structure, which are important for structural character-
isation of the glycoprotein (Barth 2007). Both analyses
showed that SJGP contains diverse amino acids and protein
backbones. Notably, no serine or threonine, important deter-
minants for glycosylation analysis, was detected by amino
acid analysis (Fig. 1) and FT-IR spectroscopy (Fig. 2) (Varki
et al. 2009). Similarly, in our previous study, we performed a
chemical composition analysis of a glycoprotein isolated from
U. pinnatifida and confirmed the presence of serine and
threonine residues, suggesting the presence of O-linked gly-
can (Rafiquzzaman et al. 2013). The difference in their com-
position was confirmed by Western blot analysis (data not
shown). Considering the FT-IR and amino acid profiles, we
can predict that the protein of SJGP is linked with carbohy-
drates, either N-linked or both. In addition, the analysis of the
monosaccharide composition of SJGP revealed that it
contained galactose, raffinose, maltose, mannose and xylose.
Generally, characterisation of glycoprotein structure is a com-
plex process involving several steps. Therefore, further studies
are required to determine the structure of SJGP.
As part of a continuous effort to identify new functional
activities from seaweed and its derivatives, we investigated
the probiotic properties of L. plantarum pretreated with SJGP
in a Caco-2 cell line model system. Using this SJGP, we
initially examined the cell adhesion, auto-aggregation and
growth of several L. plantarum strains. It was found that cell
adhesion, auto-aggregation and growth were increased in the
presence of SJGP, with variation among the strains (Table 2
and Figs. 3a, b and 4a–d). This is in agreement with the study
by Del Re et al. (2000), which suggested that variation in
adhesion ability was due to the use of different strains of
B . l o n g n u m a n d L . a c i d o p h i l u s . M o r e o v e r,
exopolysaccharides (EPS) secreted from probiotic bacteria
are one of the major mediators of adhesion to the intestinal
epithelium (Darilmaz et al. 2011). To demonstrate this, we
isolated EPS from the strains and found that KCTC 3108
produced the highest amount of EPS (data not shown). This
may explain the differing adhesion abilities among the strains.
The variation in adhesion ability was confirmed by micro-
scopic observations. Light microscopy showed no clear zones
between bacterial cells and CaCo-2 cells, whereas untreated
cells exhibited a clear zone (Fig. 3a, b). Similarly, SEM
images also showed that cells pretreated with SJGP tended
to auto-aggregate, indicating that SJGP increased aggregation
(Fig. 4c–d). This was most likely due to the presence of
Fig. 3 Light microscopic images (magnification ×1,000) of L. plantarum
to Caco-2 cells in the presence or absence of SJGP showing a clear
boundaries in untreated cell and b improved growth and extends outside
the boundaries in case of SJGP-treated cells
J Appl Phycol

7. several monosaccharides and proteins in SJGP. This result is
consistent with the findings of Tomás and Nader-Macías
(2007), who reported increased auto-aggregation with an in-
creasing glucose concentration in the growth medium.
Fig. 5 Cell surface
hydrophobicity (a) and cellular
auto-aggregation (b) of
L. plantarum KCTC 3108
pretreated with SJGP at different
concentrations. Mean values and
standard deviations were
calculated from the data obtained
from triplicate assays
Fig. 4 SEM images
(magnification ×15,000 and
×10,000) of L. plantarum to
Caco-2 cells in the presence or
absence of SJGP showing a
normal cells without SJGP, b
swollen cells with SJGP, c less
auto-aggregated cells without
SJGP, and d more auto-
aggregated cells with SJGP
J Appl Phycol

8. Strong relationships of adhesion capacity with auto-aggrega-
tion, CSH and lipase inhibition activity have been reported
(Perez et al. 1998; Doyle et al. 1984; Wadstrom et al. 1987).
To confirm this, we carried out spectrometric studies of pheno-
types related to adhesion capacity, such as auto-aggregation,
CSH and lipase inhibition activity, under in vitro conditions.
The cellular auto-aggregation rate increased with increasing
incubation time and by the addition of SJGP (Fig. 5b). Our
results confirmed the results of Saran et al. (2012) and Collado
et al. (2007). The measurement of CSH can be considered an
indicator of the ability of bacteria to adhere to intestinal epithelial
cells. We also found that CSH was increased with increasing
SJGP concentration (Fig. 5a). This result was in agreement with
the findings of Kushal (2001), who reported higher CSH in the
presence of inulin. Furthermore, Doyle et al. (1984) reported that
compounds possessing lipase inhibition activity have a marked
effect on CSH. To confirm this fact, we evaluated the lipase
inhibition activity of SJGP and found that it can potentially
inhibit the lipase activity (Fig. 6). Thus, SJGP was shown to
improve CSH as a result of its lipase inhibitory activity. It may
be suggested that SJGP either directly improves or acts on the
cell surface to improve the receptivity of cells, as probiotics
compete for receptor sites. It has been reported that cell
aggregation and adhesion seem to involve the interactions of
cell surface components such as lipoteichoic acid, proteins and
carbohydrates, as well as soluble proteins (Reniero et al. 1991).
In the present study, several important probiotic properties,
including adhesion, auto-aggregation, CSH and lipase inhib-
itory activity, were evaluated. However, the molecular mech-
anisms and genotypic characterisation of adhesive elements
have not received as much attention compared to other aspects
of probiotic research. Here, we also evaluated the expression
of the mucus adhesion genes mub, mapA and fbp and the
adhesion-like factor EF-Tu in L. plantarum KCTC 3108 in
the presence or absence of SJGP. Little is known about the
expression of genes involved in adhesion, especially during
exposure of cells to natural bioactive compounds. In this
study, all of the genes examined were upregulated upon incu-
bation of L. plantarum in the presence of SJGP (Fig. 7). The
effects of growth medium, pH and enzymes on the expression
of adhesion genes have been reported. Ramiah et al. (2007)
reported that in the presence of normal physiological concen-
trations of bile and pancreatin, the expression of Mub was
altered and MapA was over-expressed, while EF-Tu expres-
sion remained stable.
In conclusion, our data suggest that SJGP could be used
successfully to improve the probiotic properties of
L. plantarum. Chemical analyses of SJGP demonstrated that
it is composed of diverse chemical compounds that directly or
indirectly improve the probiotic properties. Taking all param-
eters into consideration, L. plantarum KCTC 3108 was more
suitable than other strains. Regarding the molecular mecha-
nism, the expression of adhesion-related genes was upregu-
lated by pretreatment with SJGP. Taken together, our findings
indicate that SJGP pretreatment may significantly increase the
adhesion, auto-aggregation and CSH of the tested strains.
Therefore, SJGP could be used as a food ingredient in com-
bination with probiotic bacteria.
Acknowledgments This research was supported from a project titled as
“Development for Novel Biofunctional Protein Source from Marine
Algae produced in the Coastal Area of Busan” funded by the Ministry
of Land, Transport and Maritime Affairs, Korea. Gyuyou wishes to thank
Novus International Inc. for financial support in the form of scholarship.
References
Ammor MS, Florez AB, Mayo B (2007) Antibiotic resistance in
nonenterococcal lactic acid bacteria and bifidobacteria. Food
Microbiol 24:559–570
Barth A (2007) Infrared spectroscopy of proteins. BBA Bioenerg 1767:
1073–1101
Bernet MF, Brassart D, Neeser JR, Servin AL (1993) Adhesion of human
bifidobacterial strains to cultured human intestinal epithelial cells
and inhibition of enteropathogen-cell interactions. Appl Environ
Microbiol 59:4121–4128
Fig. 6 Lipase inhibitory activity of SJGP at different concentrations.
Mean values and standard deviations were calculated from the data
obtained from triplicate assays
Fig. 7 Expression analysis of the multiple adherence genes of
L. plantarum (KCTC 3108) incubated with SJGP by reverse transcrip-
tase-PCR
J Appl Phycol

9. Bojana BM, Mojca N, Metoda Z (2003) Adhesion of two Lactobacillus
gasseri probiotic strains on Caco-2 cells. Food Technol Biotechnol
41:83–88
Chandini SK, Ganesan P, Bhaskar N (2008) In vitro antioxidant activities
of three selected brown seaweeds of India. Food Chem 107:707–713
Collado MC, Meriluoto J, Salminen S (2007) Adhesion and aggregation
properties of probiotic and pathogen strains. Eur Food Res Technol
226:1065–1073
Darilmaz DO, Aslim B, Suludere Z, Akca G (2011) Influence of gastro-
intestinal system conditions on adhesion of exopolysaccharide-
producing Lactobacillus delbrueckii subspecies bulgaricus strains
to Caco-2 cells. Int J Braz Arch Biol Technol 54:917–926
Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000) Adhesion,
autoaggregation and hydrophobicity of 13 strains of
Bifidobacterium longum. Lett Appl Microbiol 31:438–442
Doyle RJ, Nedjat-Haiem F, Singh JS (1984) Hydrophobic characteristics
of Bacillus spores. Curr Methodol 10:329–332
Gonzalez del Val A, Platas G, Basilio A, Cabello A, Gorrochategui J,
Suay I, Vicente F, Portillo E, Jimenez del Rio M, Reina GG, Pelaez F
(2001) Screening of antimicrobial activities in red, green and brown
macroalgae from Gran Canaria (Canary Islands, Spain). Int
Microbiol 4:35–40
Greene JD, Klaenhammer TR (1994) Factors involved in adherence of
lactobacilli to human Caco-2 cells. Appl Environ Funct Microbiol
60:4487–4494
Guerra-Rivas G, Gómez-Gutiérrez CM, Alarcón-Arteaga G, Soria-
Mercado IE, Ayala-Sánchez NE (2011) Screening for anticoagulant
activity in marine algae from the Northwest Mexican Pacific coast. J
Appl Phycol 23:495–503
Hsu CA, Yu RC, Chou CC (2005) Production of galactosidase by
bifidobacteria as influenced by various culture conditions. Int J
Food Microbiol 104:197–206
Jia J, Chen J (2001) FAO Fisheries Technical Paper, No. 418: sea farming
and sea ranching in China. FAO United Nations, Rome, p 71
Johanson M-L, Molin B, Jeppsson B, Nobaek S, Ahrne S, Bengmark S
(1993) Administration of different lactobacillus strains in fermented
oatmeal soup: in vivo colonization of the human intestinal mucosa
and effects on the indigenous microflora. Appl Environ Microbiol
59:15–20
Kang JY, Khan MNA, Park NH, Cho JY, Lee MC, Fujii H, Hong YK
(2008) Antipyretic, analgesic, and anti-inflammatory activities of
the seaweed Sargassum fulvellum and Sargassum thunbergii in
mice. J Ethnopharmacol 116:187–190
Kaushik JK, Kumar A, Duary RK, Mohanthy AK, Grover S, Batish VK
(2009) Functional and probiotic attributes of an indigenous isolate of
Lactobacillus plantarum. Plos One 4:1–11
Kennedy MJ, Sandin RL (1988) Influences of growth conditions on
Candida albicans adhesion, hydrophobicity and cell wall ultrastruc-
ture. J Med Vet Mycol 26:79–92
Kim EY, Kim YR, Nam TJ, Kong IS (2012) Antioxidant and DNA
protection activities of a glycoprotein isolated from a seaweed
Saccharina japonica. Int J Food Sci Technol 47:1020–1027
Kotzamanidis C, Kourelis A, Litopoulou-Tzanetaki E, Tzanetakis N,
Yiangou M (2010) Evaluation of adhesion capacity, cell surface
traits and immunomodulatory activity of presumptive probiotic
Lactobacillus strains. Int J Food Microbiol 140:154–163
Kushal R (2001) Studies on the effects of microentraped co-culture of
L. acidophilus and B. bifidobacterium on the inhibition of
enteropathogens. Ph.D Thesis, National Dairy Research Institute
(Deemed University), Karnal, India
Meinita MDN, Hong YK, Jeong GT (2012) Comparison of sulfuric and
hydrochloric acids as catalysts in hydrolysis of Kappaphycus
alvarezii (cottonii). Bioprocess Biosyst Eng 35:123–128
Ouwehand AC, Kirjavainen PV, Shortt C, Salminen S (1999) Probiotics:
mechanisms and established effects. Int Dairy J 9:43–52
Pelletier C, Bouley C, Cayuela C, Bouttier S, Bourlioux P, Fontaine M
(1997) Cell surface characteristics of Lactobacillus casei subsp.
casei, Lactobacillus paracasei subsp. paracasei, and Lactobacillus
rhamnosus strains. Appl Environ Microbiol 63:1725–1731
Perez PF, Minnaard Y, Disalvo EA, De Antoni GL (1998) Surface
properties of bifidobacterial strains of human origin. Appl Environ
Microbiol 64:21–26
Puertollano E, Puertollano MA, Cruz-Chamorro L, Alvarez de
Cienfuegos G, Ruiz-Bravo A, De Pablo MA (2008) Orally admin-
istered Lactobacillus plantarum reduces pro-inflammatory interleu-
kin secretion in sera from Listeria monocytogenes infected mice. Br
J Nutr 99:819–825
Rafiquzzaman SM, Kim EY, Kim YR, Nam TJ, Kong IS (2013)
Antioxidant activity of a glycoprotein isolated from a seaweed
Undaria pinnatifida measured by an in vitro digestion model. Int J
Biol Macromol 62:265–272
Rahman MM, Kim W-S, Kumura H, Shimazaki K-I (2008)
Autoaggregation and surface hydrophobicity of bifidobacteria.
World J Microb Biotechnol 24:1593–1598
Ramiah K, Van Reenen CA, Dicks LM (2007) Expression of the mucus
adhesion genes Mub and MapA, adhesion like factor EF-TU and
bacteriocin gene PlaA of Lactobacillus plantarum 423, monitored
with real-time PCR. Int J Food Microbiol 116:405–409
Reniero R, Cocconcelli PS, Bottazzi V, Morelli L (1991) High-frequency
conjugation in Lactobacillus mediated by an aggregation-promoting
factor. J Gen Microbiol 138:763–768
Saran S, Bisht MS, Singh K, Teotia UVS (2012) Comparing adhesion
attributes of two isolates of Lactobacillus acidophilus for assess-
ment of prebiotics, honey and inulin. Int J Sci Res Publ 4:1–7
Song YL, Kato N, Liu CX, Matsumiya Y, Kato H, Wantanabe K (2000)
Rapid identification of 11 human intestinal Lactobacillus species by
multiplex PCR assays using group and specific marker derived from
16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.
FEMS Microbiol Lett 187:167–173
Tomás MSJ, Nader-Macías ME (2007) Effect of a medium simulating
vaginal fluid on the growth and expression of beneficial character-
istics of potentially probiotic lactobacilli. Curr Res Educ Top Trends
Appl Microbiol 2:732–739
Tuomola EM, Ouwehand AC, Salminen SJ (2000) Chemical, physical
and enzymatic pre-treatments of probiotic lactobacilli alter their
adhesion to human intestinal mucus glycoproteins. Int J Food
Microbiol 15:75–81
Varki A, Cummings RD, Esko JD, Freeze HH, Stainly P, Bertozzi CR,
Hart GW, Etzler ME, (Eds.) (2009) Essentials of glycobiology, 2nd
edition, Cold Spring Harbor Laboratory Press
Voltan S, Castagliuolo I, Elli M, Long S, Brun P, D’Inca R,
Porzionato A, Macchi V, Palu G, Sturniolo GC, Morelli L,
Martines D (2007) Aggregating phenotype in Lactobacillus
crispatus determines intestinal colonization and TLR2 and
TLR4 modulation in murine colonic mucosa. Clin Vaccine
Immunol 14:1138–1148
Wadstrom T, Anderson K, Sydow M, Axelsson L, Lindgren S,
Gullmar B (1987) Surface properties of lactobacilli isolated
from the small intestine of pigs. J Appl Microbiol 62:513–
520
Yuan YV, Walsh NA (2006) Antioxidant and antiproliferative activities of
extracts from a variety of edible seaweeds. Food Chem Toxicol 44:
1144–1150
Zhang J, Kang MJ, Kim MJ, Kim ME, Song JH, Lee YM, Kim JI (2008)
Pancreatic lipase inhibitory activity of Taraxacum officinale in vitro
and in vivo. Nutr Res Pract 2:200–203
J Appl Phycol