SlideShare ist ein Scribd-Unternehmen logo

ICIC 2013 New Product Introductions GenomeQuest

•
•
Dr. Haxel Consult
Dr. Haxel Consult
Technologie
1 von 5
Downloaden Sie, um offline zu lesen
Henk Heus, Ph.D. IP SEQUENCE SEARCH
THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
HOW IT WAS DONE
HOW IT WAS DONE
PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     

Empfohlen

ICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockDr. Haxel Consult
 
ICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelDr. Haxel Consult
 
ICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsDr. Haxel Consult
 
ICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryDr. Haxel Consult
 
ICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntDr. Haxel Consult
 

Empfohlen

ICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockICIC 2013 Conference Proceedings Sebastian Radestock
ICIC 2013 Conference Proceedings Sebastian RadestockDr. Haxel Consult
 
ICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelICIC 2014 New Product Introduction Questel
ICIC 2014 New Product Introduction QuestelDr. Haxel Consult
 
ICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraICIC 2013 New Product Introductions Dolcera
ICIC 2013 New Product Introductions DolceraDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBICIC 2013 Conference Proceedings Uwe Rosemann TIB
ICIC 2013 Conference Proceedings Uwe Rosemann TIBDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsICIC 2013 Conference Proceedings Krishna Molecular Connections
ICIC 2013 Conference Proceedings Krishna Molecular ConnectionsDr. Haxel Consult
 
ICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsICIC 2013 New Product Introductions Linguamatics
ICIC 2013 New Product Introductions LinguamaticsDr. Haxel Consult
 
ICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryICIC 2013 Conference Proceedings Antony Williams Royal Society of Chemistry
ICIC 2013 Conference Proceedings Antony Williams Royal Society of ChemistryDr. Haxel Consult
 
ICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntICIC 2013 New Product Introductions BizInt
ICIC 2013 New Product Introductions BizIntDr. Haxel Consult
 
ICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftDr. Haxel Consult
 
ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation Dr. Haxel Consult
 
ICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersDr. Haxel Consult
 
ICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemDr. Haxel Consult
 
ICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscDr. Haxel Consult
 
ICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestDr. Haxel Consult
 
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...Dr. Haxel Consult
 
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...Dr. Haxel Consult
 
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...Dr. Haxel Consult
 
ICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveDr. Haxel Consult
 
ICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASDr. Haxel Consult
 
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities Dr. Haxel Consult
 
ICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisDr. Haxel Consult
 
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...Dr. Haxel Consult
 
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallDr. Haxel Consult
 
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementAI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementDr. Haxel Consult
 
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...Dr. Haxel Consult
 
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...Dr. Haxel Consult
 
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...Dr. Haxel Consult
 
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...Dr. Haxel Consult
 
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...Dr. Haxel Consult
 
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...Dr. Haxel Consult
 

Weitere ähnliche Inhalte

Andere mochten auch

ICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftDr. Haxel Consult
 
ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation Dr. Haxel Consult
 
ICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersDr. Haxel Consult
 
ICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemDr. Haxel Consult
 
ICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscDr. Haxel Consult
 
ICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestDr. Haxel Consult
 
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...Dr. Haxel Consult
 
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...Dr. Haxel Consult
 
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...Dr. Haxel Consult
 
ICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveDr. Haxel Consult
 
ICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASDr. Haxel Consult
 
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities Dr. Haxel Consult
 
ICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisDr. Haxel Consult
 
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...Dr. Haxel Consult
 
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallDr. Haxel Consult
 

Andere mochten auch (15)

ICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions MinesoftICIC 2013 New Product Introductions Minesoft
ICIC 2013 New Product Introductions Minesoft
 
ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation ICIC 2014 How the European Patent Office Uses Asian Documentation
ICIC 2014 How the European Patent Office Uses Asian Documentation
 
ICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent SearchersICIC 2014 Panel: Mobile Apps for Patent Searchers
ICIC 2014 Panel: Mobile Apps for Patent Searchers
 
ICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChemICIC 2013 New Product Introductions InfoChem
ICIC 2013 New Product Introductions InfoChem
 
ICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction GridlogiscICIC 2014 New Product Introduction Gridlogisc
ICIC 2014 New Product Introduction Gridlogisc
 
ICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuestICIC 2014 New Product Introduction ProQuest
ICIC 2014 New Product Introduction ProQuest
 
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
ICIC 2014 Patent Landscape Analysis as a Tool for Public Policies Adjustment:...
 
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
ICIC 2014 The Intermediates are becoming extict - radical Change for Info Pr...
 
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
ICIC 2016: Mind the Gap: The novel benefits of human-curated substance locat...
 
ICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction InfotrieveICIC 2014 New Product Introduction Infotrieve
ICIC 2014 New Product Introduction Infotrieve
 
ICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CASICIC 2014 New Product Introduction CAS
ICIC 2014 New Product Introduction CAS
 
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
ICIC 2014 Chemical Patent Curation and Management – New Tools and Capabilities
 
ICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexisICIC 2014 New Product Introduction LexisNexis
ICIC 2014 New Product Introduction LexisNexis
 
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
ICIC 2014 Tracking of the Mode of Action Landscape in Breast Cancer using Rep...
 
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recallICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
ICIC 2013 Conference Proceedings Andreas Pesenhofer max.recall
 

Mehr von Dr. Haxel Consult

AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementAI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementDr. Haxel Consult
 
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...Dr. Haxel Consult
 
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...Dr. Haxel Consult
 
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...Dr. Haxel Consult
 
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...Dr. Haxel Consult
 
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...Dr. Haxel Consult
 
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...Dr. Haxel Consult
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...Dr. Haxel Consult
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...Dr. Haxel Consult
 
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...Dr. Haxel Consult
 
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...Dr. Haxel Consult
 
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...Dr. Haxel Consult
 
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...Dr. Haxel Consult
 
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...Dr. Haxel Consult
 
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...Dr. Haxel Consult
 
AI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance CenterAI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance CenterDr. Haxel Consult
 
AI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOCAI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOCDr. Haxel Consult
 
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...Dr. Haxel Consult
 
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...Dr. Haxel Consult
 

Mehr von Dr. Haxel Consult (20)

AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering ManagementAI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
AI-SDV 2022: Henry Chang Patent Intelligence and Engineering Management
 
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
AI-SDV 2022: Creation and updating of large Knowledge Graphs through NLP Anal...
 
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
AI-SDV 2022: The race to net zero: Tracking the green industrial revolution t...
 
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
AI-SDV 2022: Accommodating the Deep Learning Revolution by a Development Proc...
 
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
AI-SDV 2022: Domain Knowledge makes Artificial Intelligence Smart Linda Ander...
 
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
AI-SDV 2022: Embedding-based Search Vs. Relevancy Search: comparing the new w...
 
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
AI-SDV 2022: Rolling out web crawling at Boehringer Ingelheim - 10 years of e...
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...
 
AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...AI-SDV 2022: Machine learning based patent categorization: A success story in...
AI-SDV 2022: Machine learning based patent categorization: A success story in...
 
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
AI-SDV 2022: Finding the WHAT – Will AI help? Nils Newman (Search Technology,...
 
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
AI-SDV 2022: New Insights from Trademarks with Natural Language Processing Al...
 
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
AI-SDV 2022: Extracting information from tables in documents Holger Keibel (K...
 
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
AI-SDV 2022: Scientific publishing in the age of data mining and artificial i...
 
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
AI-SDV 2022: AI developments and usability Linus Wretblad (IPscreener / Uppdr...
 
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
AI-SDV 2022: Where’s the one about…? Looney Tunes® Revisited Jay Ven Eman (CE...
 
AI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance CenterAI-SDV 2022: Copyright Clearance Center
AI-SDV 2022: Copyright Clearance Center
 
AI-SDV 2022: Lighthouse IP
AI-SDV 2022: Lighthouse IPAI-SDV 2022: Lighthouse IP
AI-SDV 2022: Lighthouse IP
 
AI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOCAI-SDV 2022: New Product Introductions: CENTREDOC
AI-SDV 2022: New Product Introductions: CENTREDOC
 
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
AI-SDV 2022: Possibilities and limitations of AI-boosted multi-categorization...
 
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
AI-SDV 2022: Big data analytics platform at Bayer – Turning bits into insight...
 

Kürzlich hochgeladen

Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptxHampshireHUG
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slidespraypatel2
 
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...gurkirankumar98700
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Igalia
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024The Digital Insurer
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonetsnaman860154
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024The Digital Insurer
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxMalak Abu Hammad
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024The Digital Insurer
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdfhans926745
 
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure servicePooja Nehwal
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking MenDelhi Call girls
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationSafe Software
 
Breaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountBreaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountPuma Security, LLC
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Servicegiselly40
 

Kürzlich hochgeladen (20)

Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
 
How to convert PDF to text with Nanonets
How to convert PDF to text with NanonetsHow to convert PDF to text with Nanonets
How to convert PDF to text with Nanonets
 
Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024Axa Assurance Maroc - Insurer Innovation Award 2024
Axa Assurance Maroc - Insurer Innovation Award 2024
 
The Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptxThe Codex of Business Writing Software for Real-World Solutions 2.pptx
The Codex of Business Writing Software for Real-World Solutions 2.pptx
 
Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024Finology Group – Insurtech Innovation Award 2024
Finology Group – Insurtech Innovation Award 2024
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf
 
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
 
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men08448380779 Call Girls In Greater Kailash - I Women Seeking Men
08448380779 Call Girls In Greater Kailash - I Women Seeking Men
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
Breaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountBreaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path Mount
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Service
 

ICIC 2013 New Product Introductions GenomeQuest

  • 1. Henk Heus, Ph.D. IP SEQUENCE SEARCH
  • 2. THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
  • 3. HOW IT WAS DONE
  • 4. HOW IT WAS DONE
  • 5. PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     