Diese Präsentation wurde erfolgreich gemeldet.
Wir verwenden Ihre LinkedIn Profilangaben und Informationen zu Ihren Aktivitäten, um Anzeigen zu personalisieren und Ihnen relevantere Inhalte anzuzeigen. Sie können Ihre Anzeigeneinstellungen jederzeit ändern.

ICIC 2013 New Product Introductions GenomeQuest

960 Aufrufe

Veröffentlicht am

Veröffentlicht in: Technologie
  • Als Erste(r) kommentieren

ICIC 2013 New Product Introductions GenomeQuest

  1. 1. Henk Heus, Ph.D. IP SEQUENCE SEARCH
  2. 2. THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
  5. 5. PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     
