ICIC 2013 New Product Introductions GenomeQuest

904 Aufrufe

Veröffentlicht am

Veröffentlicht in: Technologie
0 Kommentare
1 Gefällt mir
Statistik
Notizen
  • Als Erste(r) kommentieren

Keine Downloads
Aufrufe
Aufrufe insgesamt
904
Auf SlideShare
0
Aus Einbettungen
0
Anzahl an Einbettungen
329
Aktionen
Geteilt
0
Downloads
10
Kommentare
0
Gefällt mir
1
Einbettungen 0
Keine Einbettungen

Keine Notizen für die Folie

ICIC 2013 New Product Introductions GenomeQuest

  1. 1. Henk Heus, Ph.D. IP SEQUENCE SEARCH
  2. 2. THE QUESTION AND THE ANSWER CCCCGATCCTGGGGCAGAGGCGGCCTCTGGATCAT ACATATG 5 granted patents with a sequence mentioned in the claims with over 70% identity to the query
  3. 3. HOW IT WAS DONE
  4. 4. HOW IT WAS DONE
  5. 5. PRODUCT OVERVIEW  GQ-Pat database coverage / / / / ST.25 listings and sequences in text, tables, and figures 217 million sequences 437 thousand documents in 182 thousand INPADOC families 25 authorities US, CN, WO, EP, KR, JP, IN, CA, etc.  Easy to use web interface Multiple sequence search algorithms (genePAST) Result filtering capabilities Word and Excel exports Automated search alerts Result sharing within your team  Used by almost all big pharma and ag companies worldwide     

×