2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
•
2 likes•1,579 views
This document discusses next generation epigenetic profiling and biomarkers. It provides an overview of epigenetics and methylation in oncology. MDxHealth is developing next-generation epigenetic biomarkers including methylation-based companion diagnostics. Deep sequencing techniques like MBD-Seq are being used to discover biomarkers from genome-wide methylation profiling and provide high resolution of methylation heterogeneity. Validation studies of biomarkers like MGMT promoter methylation are also discussed.
Recommended
More Related Content
What's hot
What's hot (20)
Similar to 2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
Similar to 2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb (20)
More from Prof. Wim Van Criekinge
More from Prof. Wim Van Criekinge (20)
Recently uploaded
Recently uploaded (20)
2014 03 28_next_generation_epigenetic_profling_v_les_epigenetica_vweb
- 1. Next Generation Epigenetic Profiling Wim Van Criekinge 28th March 2014, UGent (BE)
- 2. Overview Epigene,cs – Introduc*on – Methyla*on & Oncology – Biomarkers MDxHealth – NEXT-‐GENera*on Epigene*c Biomarkers – Methyla*on Based CDx
- 3. Confidential Information | ©2013 MDxHealth Inc. All rights reserved.
- 6. Historically, Cancer Was Considered to be Driven Mostly by Gene,c Changes Example: Replica,on errors GENETIC Altered DNA/mRNA/proteins Altered DNA sequence X X Oncogenesis Tumor § Muta*ons in p53 § Ac*va*ng muta*ons in RAS § Muta*ons or amplifica*ons of the HER-‐2 gene § Chromosomal transloca*ons in myeloid cells and the genera*on of the BCR-‐ABL fusion protein
- 7. Epigene,c Changes are Important in Causing Cancer Example: Replica,on errors GENETIC EPIGENETIC Example: Chroma,n modifica,on errors Altered DNA/mRNA/proteins Altered DNA sequence Altered levels of mRNA/proteins Altered chroma,n structure X X Oncogenesis Tumor
- 8. Source: Schuebel et al 2007 0 20 40 60 80 100 120 Methylated Mutated 76-100 51-75 21-50 1-20 Dx CDx Example of Methyla,on vs Muta,on: Colon & Breast Cancer
- 9. MGMT Biology O6 Methyl-Guanine Methyl Transferase Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: -‐ MGMT is an essen*al DNA repair enzyme Loss of MGMT ac*vity makes individuals suscep*ble to DNA damage and prone to tumor development Glioblastoma pa,ent on alkylator chemotherapy: -‐ Pa*ents with MGMT promoter methyla*on show have longer PFS and OS with the use of alkyla*ng agents as chemotherapy
- 10. MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation 0 5 10 15 20 25 Median Overall Survival 21.7 months 12.7 months radiotherapy plus temozolomide Methylated MGMT Gene Non-Methylated MGMT Gene radiotherapy Adapted from Hegi et al. NEJM 2005 352(10):1036-‐8. Study with 207 pa*ents
- 11. Overview Epigene,cs – Introduc*on – Methyla*on & Oncology – Biomarkers MDxHealth – NEXT-‐GENera*on Epigene*c Biomarkers Can we rediscover MGMT ? What does the epigenome look like ?
- 12. MBD_Seq DNA Sheared Immobilized Methyl Binding Domain Condensed Chroma*n DNA Sheared
- 13. Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads MBD_Seq
- 14. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Quality evalua*on of Methyl Binding Domain based kits for enrichment DNA-‐methyla*on sequencing De Meyer et al (2013) Plos One
- 15. MBD_Seq MGMT = dual core
- 18. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
- 19. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense methylated needed for transcrip*onal silencing Are there alleles with all three posi4ons methylated ?
- 20. GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT! unmethylated alleles less methyla*on methylated alleles more methyla*on Deep Sequencing
- 21. Deep Sequencing MGMT Heterogenic complexity
- 22. # samples # markers MBD_Seq BT_Seq Genome-‐wide methyla,on …. by next genera,on sequencing Discovery Verifica*on Valida*on
- 23. Assay Technology: Methyla,on-‐ Specific PCR (MSP) DNA Modification 1 2 Methyl Cytosine Methyl Cytosine Uracil Primer Choice DNA modification chemical Cytosine To design PCR primers to differen*ate methylated from unmethylated we take advantage of the base pair binding proper*es of Uracil
- 24. 3 amplification occurs when methylation specific primers bind to the promoter DNA Amplification and Detection by quantitative PCR MSPrimer MSPrimer Methylated CPG Islands Ct value Signal change per cycle Assay Technology: Methyla,on-‐ Specific PCR (MSP)
- 25. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Gene,c tes,ng 107 106 105 104 103 102 101 1108109 Full genome bp Whole-genome Bisulphite seq MSP Probes (450-27K) Enrichment Targeted Panels
- 26. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. Gene,c tes,ng 107 106 105 104 103 102 101 1108109 Full genome bp G E N E T I C Whole-genome sequencing Enrichment seq (Exome) PCR Enrichment Targeted Panels Instrument and Assay providers CLIA Lab service providers
- 27. Confidential Information | ©2013 MDxHealth Inc. All rights reserved. § An epigene*c assay to help dis*nguish pa*ents who have a true-‐nega*ve biopsy from those who may have occult cancer. § Provides urologists with ac*onable informa*on to help: − RULE OUT prostate-‐cancer-‐free men from undergoing unnecessary repeat biopsies − RULE IN those who require repeat biopsies and poten4al treatment Addressing False-‐Nega,ve Biopsy Concerns